Главная страница  |  Описание сайта  |  Контакты
ФРАГМЕНТ ДНК, КОДИРУЮЩИЙ СИНТЕЗ ГЛИКОПРОТЕИНА G ВИРУСА БЕШЕНСТВА, РЕКОМБИНАНТНАЯ ПЛАЗМИДНАЯ ДНК PVG18-1, КОДИРУЮЩАЯ ГЛИКОПРОТЕИН G ВИРУСА БЕШЕНСТВА, ШТАММ БАКТЕРИЙ ESCHERICHIA COLI - ПРОДУЦЕНТ ГЛИКОПРОТЕИНА G ВИРУСА БЕШЕНСТВА
ФРАГМЕНТ ДНК, КОДИРУЮЩИЙ СИНТЕЗ ГЛИКОПРОТЕИНА G ВИРУСА БЕШЕНСТВА, РЕКОМБИНАНТНАЯ ПЛАЗМИДНАЯ ДНК PVG18-1, КОДИРУЮЩАЯ ГЛИКОПРОТЕИН G ВИРУСА БЕШЕНСТВА, ШТАММ БАКТЕРИЙ ESCHERICHIA COLI - ПРОДУЦЕНТ ГЛИКОПРОТЕИНА G ВИРУСА БЕШЕНСТВА

ФРАГМЕНТ ДНК, КОДИРУЮЩИЙ СИНТЕЗ ГЛИКОПРОТЕИНА G ВИРУСА БЕШЕНСТВА, РЕКОМБИНАНТНАЯ ПЛАЗМИДНАЯ ДНК PVG18-1, КОДИРУЮЩАЯ ГЛИКОПРОТЕИН G ВИРУСА БЕШЕНСТВА, ШТАММ БАКТЕРИЙ ESCHERICHIA COLI - ПРОДУЦЕНТ ГЛИКОПРОТЕИНА G ВИРУСА БЕШЕНСТВА

Патент Российской Федерации
Суть изобретения: Использование: изобретение относится к генетической инженерии и представляет собой фрагмент ДНК, кодирующий синтез гликопротеина g вируса бешенства, рекомбинантную плазмидную ДНК и штамм, содержащий эту рекомбинантную плазмиду - продуцент структурного белка гликопротеина g. Изобретение может быть использовано при создании вакцин и диагностикумов против бешенства. Сущность изобретения: вирус бешенства - штамм "Внуково - 32" размножали в культуре клеток почек сирийского хомячка. Вирионы, находящиеся в культурной жидкости, концентрировали путем ультрафильтрации через специальные фильтры, а затем осаждали ультрацентрифугированием. Вирионную РНК выделяли с помощью гуанидин-тиоционата и использовали для синтеза кДНК гена гликопротеина g. кДНК с помощью специфических праймеров амплифицировали методом полимеразной цепной реакции (PCR). Амплифицированный ген гликопротеина g клонировали в клетках Е, соli с помощью прокариотического вектора рИС - 19. Определили методом Сенгера нуклеотидную и аминокислотную последовательность. Ген гликопротеина g переклонировали в экспрессирующий прокаритеческий вектор рИС - 18. Экспрессируемый вирусный белок проявил специфическую иммуногенную активность. 3 з. п. ф - лы, 2 ил. , 2 табл.
Поиск по сайту

1. С помощью поисковых систем

   С помощью Google:    

2. Экспресс-поиск по номеру патента


введите номер патента (7 цифр)

3. По номеру патента и году публикации

2000000 ... 2099999   (1994-1997 гг.)

2100000 ... 2199999   (1997-2003 гг.)
Номер патента: 2008355
Класс(ы) патента: C12N15/23, C12N15/70
Номер заявки: 5024340/13
Дата подачи заявки: 18.12.1991
Дата публикации: 28.02.1994
Заявитель(и): Грабко Владимир Иванович
Автор(ы): Грабко Владимир Иванович
Патентообладатель(и): Грабко Владимир Иванович
Описание изобретения: Изобретение относится к биотехнологии, в частности к генетической инженерии, и представляет собой фрагмент ДНК, кодирующий синтез гликопротеина G вируса бешенства, рекомбинантную плазмидную ДНК и штамм, содержащий эту рекомбинантную плазмиду, - продуцент структурного белка гликопротеина G. Изобретение может быть использовано при создании вакцин и диагностикумов против бешенства.
Бешенство является одной из старейших болезней, известных человеку. Этиологическим агентом бешенства является вирус, широко распространенный среди теплокровных животных. Успешное лечение смертельного заболевания связано с созданием вакцины Пастера в 1885 году. К настоящему времени разработана на основе инактивированного вируса, однако стоимость таких вакцин при систематическом использовании достаточно высока и, кроме того, всегда сохраняется риск при недостаточной инактивации вируса вызвать при вакцинации заболевание бешенством.
Известно, что протективный эффект вакцин связан с поверхностным белком оболочки вируса бешенства (белок G [1] ). Также, установлено, что изолированный белок G способен защищать животных от заболеваний бешенством [2] .
О клонировании кДНК, соответствующей гену гликопротеина вируса бешенства, вирусного штамма ERA, впервые сообщили Anillionis A. и Wunner W. H. с соавторами [3] , а для штамма CVS-Yelverton E. [4] .
Известен фрагмент ДНК, кодирующий гликопротеин антигена вируса бешенства [5] . Фрагмент ДНК, представленный в патенте USA N 4393201, обладает рядом недостатков он не пригоден для экспрессии вирусного белка из-за гомополимерных концевых последовательностей на 5' и 3'-концах фрагмента; ген содержит мутацию, возникшую в процессе синтеза кДНК с вирионной мРНК, которая влияет на иммуногенные и протективные свойства белка G (в зрелом гликопротеине в 8-м положении вместо пролина закодирован лейцин).
Известен способ получения фрагмента ДНК, кодирующего синтез гликопротеина G, описанный в вышеуказанном патенте USA [5] . Известный способ включает культивирование клеток, инфицированных вирусом бешенства, выделение и очистку из них матричных РНК с использованием олиго-(dT)-целлюлозы и ультрацентрифугирования в градиенте сахарозы с последующим синтезом одноцепочечной и двухцепочечной кДНК, пришивку гомополимерных концов и клонирование в клетках Е. coli. К недостаткам данного способа относится сложность выделения матричных РНК, невозможность получить чистую фракцию вирионных мРНК, специфический синтез кДНК, необходимость синтеза второй цепи, пришивку неспецифических гомополимерных концов и в связи с этим проведение большого скрининга полученных клонов для поиска клона, содержащего фрагмент ДНК, кодирующий синтез гликопротеина G. Фрагмент ДНК, полученный этим способом, для дальнейшего использования, например экспрессии вирусного белка G, непригоден и требует трудоемких генно-инженерных перестроек - замены гомополимерных концов последовательностями, узнаваемыми эндонуклеазами рестрикции; замены нуклеотидных последовательностей, кодирующих аминокислоту лейцин в положении 8 на последовательность, кодирующую аминокислоту пролин.
Известна рекомбинантная ДНК, кодирующая ген гликопротеина G вируса бешенства [5] . К недостаткам данной рекомбинантной ДНК относится то, что она проклонирована по гомополимерным концам и не пригодна для переклонирования без специальных, трудоемких генно-инженерных перестроек в рекомбинантной ДНК и экспрессии вирусного белка.
В связи с тем, что вирус бешенства при инфицировании клеток не ингибирует синтез клеточной РНК, а синтез вирусных мРНК составляет не более 5% тотального клеточного синтеза РНК, выполнение клонирования мРНК гена гликопротеина G весьма затруднительно. В обоих случаях авторам пришлось провести сложную методическую работу по выделению из инфицированных клеток вирусных мРНК, их клонирование и идентификацию клонов, содержащих ген гликопротеина G.
Известен штамм клеток E. coli х1776, в который был проклонирован ген гликопротеина G вируса бешенства (патент США N 4393201). Однако данные по экспрессии вирусного белка G в патенте не представлены.
Задачей, на решение которой направлено заявляемое изобретение, является получение гена, кодирующего синтез гликопротеина G вируса бешенства, клонирование синтезированного гена в клетках Escherichia coli и получение штамма-продуцента гликопротеина G вируса бешенства.
Сущность предлагаемых изобретений состоит в следующем:
Сущность фрагмента ДНК, кодирующего гликопротеин G вируса бешенства, состоит в том, что он имеет размер 1,6 т. п. о. , содержит участки расщепления для рестриктаз BamHl и Pstl в начале и конце гена, 1 участок расщепления рестриктазы Hindlll, расположенный на расстоянии 92 п. о. от BamHl-конца, участок расщепления рестриктазы Pvull, расположенный на расстоянии 130 п. о. от BamHl-конца, участок расщепления рестриктазы Хhol, расположенный на расстоянии 514 п. о. от BamHl-конца, участок расщепления рестриктазы Sphl, расположенный на расстоянии 728 п. о. от BamHl-конца, участок расщепления рестриктазы Clal, расположенный на расстоянии 1458 п. о. от BamHl-конца. Фрагмент содержит в начале гена ATG кодон, инициирующий синтез белка, и TGA кодон в конце гена, терминирующий синтез белка. Всего фрагмент кодирует синтез 505 аминокислот.
Для получения фрагмента ДНК, кодирующего гликопротеин G вируса бешенства, используют способ, который заключается в том, что проводят культивирование вируса штамма Внуково-32 в культуре клеток, концентрирование и очистку вируса методом ультрафильтрации и ультрацентрифугирования, выделение вирионной РНК в присутствии гуанидинтиоционата смесью фенол-хлороформ с последующим осаждением эталоном, далее осуществляют синтез кДНК с помощью фермента обратной транскриптазы и праймера, комплементарного последовательностям гена гликопротеина G, и амплификацию гена гликопротеина G методом полимеразной цепной реакции [6] с помощью специфических праймеров, содержащих последовательности, узнаваемые эндонуклеазами рестрикции BamHl и Pstl и комплементарные концам гена белка G.
Сущность рекомбинантной плазмидной ДНК PBG18-1, кодирующей синтез гликопротеина G, имеющей размер 4, 2 т. п. о. , состоит в том, что она содержит плазмидную ДНК вектора рUC18 размером 2,6 т. п. о. , состоящего из фрагмента плазмиды рBR322 размером 2186 п. о. , участка LacZ оперона размером 445 п. о. и полилинкера, и Bam H1-Pst1-фрагмент ДНК, содержащий ген гликопротеина G размером 1,6 т. п. о.
Мол. м. плазмиды PVG18-1 равна 2,8 МДа.
ДНК плазмиды PVG18-1 содержит уникальные сайты рестрикции-EcoRl, Sacl, Kpnl, Smal, Xmal, BamHl, Pstl, Clal, Pvul, Xhpl и 2 сайта Hindlll. Положение всех перечисленных сайтов рестрикции показано в табл. 1.
В состав плазмиды входят гены:
bla-ген, обеспечивающий синтез бета-лактамазы и устойчивость к ампициллину;
lacZ-ген, обеспечивающий синтез бета-галактозидазы;
ген, кодирующий синтез гликопротеина;
lacZ-промотор, обеспечивающий транскрипцию гена гликопротеина G.
Синтез гликопротеина происходит под контролем lacZ-промотора.
Физическая карта рекомбинантной плазмиды PVG 18-1 представлена на фиг. 1; на фиг. 2 - схема работы полимерной цепной реакции (PCR).
Штамм - продуцент гликопротеина G вируса бешенства получают трансформацией клеток E. coli ДН-5 с помощью рекомбинатной плазмиды PVG18-1.
Штамм бактерий Escherichia coli ДН-5, содержащий плазмиду PVG18-1, депонирован во Всесоюзной коллекции микроорганизмов при ИБФМ АН СССР и содержится в ней под номером ВКМ CR-355Д.
Штамм характеризуется следующими признаками.
Морфологические признаки: клетки прямые, палочковидные, подвижные, имеют перитрихиальные жгутики, грамотрицательные, неспороносные.
Культуральные признаки: клетки хорошо растут на обычно используемых питательных средах. На 1,5% -ном питательном агаpе Дифко колонии гладкие, серые, блестящие, края ровные, мутные. При выращивании в жидких средах - мясопептоном бульоне и L-бульоне образуют ровную интенсивную муть.
Физиолого-биохимические признаки: оптимальная температура культивирования 37оС, рН 6,8-7,5. В качестве источника углерода используют многие углеводы, органические кислоты, спирты. В качестве источника азота используют минеральные соли в аммонийной или нитратной форме, органические соединения в виде пептона, триптона, аминокислот.
Устойчивость к антибиотикам, проявляет устойчивость к ампициллину (100-150 мкг/мл).
Генетические пpизнаки: -генотип: F-, recAl, endAl, gyrA96, thi, usdR17, supE44, relAl, Л;
Присутствие в штамме E. coli ДНК плазмиды PVG18-1, содержащей фрагмент ДНК - ген гликопротеина G вируса бешенства, подтверждается путем проверки его устойчивости к ампициллину, а также путем выделения и анализа плазмидной ДНК с помощью блотгибридизации.
Условия хранения штамма: штамм хранится в 50% -ном глицерине при -20оС в течение года или в лиофильно высушенном состоянии при -70оС (защитная среда - молоко).
П р и м е р 1. Конструирование фрагмента ДНК, содержащего ген гликопротеина G вируса бешенства.
Для клонирования гена гликопротеина используют штамм вируса бешенства "Внуково-32", ранее не применяемый для генно-инженерных исследований [7] . Вирус выращивают либо в культуре первичных клеток почек сирийского хомяка, либо в культуре перевиваемых стромальных клеток почек обезьян (линия 4647). Заражение клеток осуществляют путем введения во взвесь клеток или на монослой вируса из расчета 0,005 ЛД/50 на клетку. Первый сбор урожая вируса проводят через 96 ч инкубирования. Полученный сбор вируссодержащей жидкости осветляют через "ядерные" фильтры с d = 1,9-2,0 мкм, после чего концентрируют на пеликон-кассете в 50-60 раз.
Вирионы из концентрированной культуральной жидкости осаждают центрифугированием (25000 об/мин, 2 ч при 4оС). Осадок гомогенизируют в 5 объемах 4 М раствора гуанидинтиоционата, а затем экстрагируют смесью фенол: хлороформ (1: 1), хлороформом и осаждают водную фазу 0,5 объемами этанола. Остатки солей гуанидинтиоционата отмывают 70% -ным этанолом и переосаждают этанолом. Полученную таким образом вирионную РНК используют для синтеза кДНК. Реакционная смесь в объеме 50 мкл содержит следующие компоненты: 1 мкн вирионный РНК, 1 мкг праймера к 5'-концу гена гликопротеина (5'GGATCCAGGAAAGATGGTTCCTCAGGCTCTCCTGTTTG 3'), 10 мМ трис-HCl pH 8,3; 10 мМ MgCl2, 140 мМ KCl, 1 мМ каждого из четырех трифосфатов, 50 ед. обратной транскриптазы вируса миелобластоза птиц. Инкубацию ведут 2 ч при 42оС. Для гидролиза РНК смесь затем инкубируют 1 ч при 65оС и осаждают 3 объемами этанола. Полученную кДНК используют для синтеза ДНК-вой копии гена гликопротеина G методом PCR (Polymerase chain reaction), фиг. 2. Инкубационная смесь содержит 67 мМ трис-HCl pH 8,4; 2 мМ MgCl2, 16,6 мМ (NH4)2SO4; 10 мМ 2МЕ; 200 мкМ каждого из дезокситрифосфатов, 200 мкг/мл БСА, 1 мкМ 5'-праймера (используемого для синтеза кДНК), 1 мкМ 3'-праймера (5'GCTGCAGCAAGGGGAGGTGATCTTCAGACTTGGATCGT 3'), 10-100 пкг кДНК. Инкубационную смесь прогревают при 94оС 7 мин, затем инкубируют 3 мин при 56оС, центрифугируют 10 с, добавляют 2 мкл (6-7 ед. Tag1-полимеразы) и наслаивают сверху 50 мкл вазелинового масла. Инкубируют при 70оС 10 мин. Для амплификации ДНК используют следующие параметры: 1 мин при 94оС, 4 мин при 65-67оС. Повторяют циклы амплификации 25-30 раз. Заканчивают амплификацию 15-минутным синтезом при 67оС. Экстрагируют хлороформом и продукты амплификации разделяют электрофорезом в 1% -ном агарозном геле. Фpагменты ДНК, соответствующие ожидаемому молекулярному весу, вырезают из геля, элюируют, обрабатывают соответствующими рестриктазами (BamHl; Pst1).
П р и м е р 2. Клонирование гена гликопротеина G в клетках E. coli.
Фрагменты ДНК, обработанные рестриктазами BamHl и Pstl, лигируют с прокариотическим вектором pUC-19, обработанным аналогичными рестриктазами. Лигазная смесь объемом 50 мкл содержит: 0,5 мкг фрагмента ДНК, 0,5 мкг плазмидной ДНК рUC-19, 50 мМ трис-HCl рН 7,6; 10 мМ MgC12, 10 мМ 2-меркаптоэтанола, 100 мкг/мл БСА, 100 ед. ДНК-лигазы фага Т-4. Инкубацию ведут при 8оС 16 ч. Для трансформации используют 25 мкл лигазной смеси. Компетентные клетки E. coli (штамм DH-5) готовят стандартным способом, описанным в методическом пособии (Маниатис Т. , Фрич Э. , Сэмбрук Дж. , Молекулярное клонирование, 1984, с. 240-241). Отбор клонов ведут на селективной среде, содержащей ампициллин (50 мкг/мл) и Х-gal (20 мкг/мл). Бесцветные колонии подращивают, выделяют рекомбинантную плазмидную ДНК и анализируют на наличие вставки электрофорезом в 1% -ном геле. Клоны, содержащие встроенный фрагмент ДНК, анализируют с использованием рестрикционных эндонуклеаз Pst1, BamHl. Продукты гидролиза анализируют электрофорезом в 1% -ном агарозном геле. Клоны, содержащие фрагмент ДНК, соответствующий размеру гена гликопротеина G подвергают дальнейшему анализу. Анализ клонов, несущих рекомбинантные ДНК, методом секвенирования по Сэнгеру [8] , подтверждает наличие нуклеотидной последовательности гена гликопротеина вируса бешенства (клоны PVG19-1; PVG69-3 и PVG12-4). Клон PVG19-1 содержит нуклеотидную последовательность гена гликопротеина G с 1 по 1647.
П р и м е р 3. Получение штамма-продуцента гликопротеина G вируса бешенства.
Клон PVG19-1, содержащий целый ген гликопротеина G, не пригоден для получения экспрессирующего вектора, так как Lac-промотор находится в конце гена. Для получения экспрессирующего вектора ген переклонируют в плазмиду рUC18 по сайтам полилинкера (BamH1-Pst 1). Получают клон PVG18-1, экспрессирующий иммуногенно-активный гликопротеин G вируса бешенства. Для экспрессии рекомбинантного белка клетки E. coli ДН-5 (3-5 мл) инкубируют в LB среде ночь при 37оС. Затем вносят 100 мл свежей LB среды и инкубируют при 37оС до достижения клетками плотности D = 0,5-0,8. Для индукции LacZ промотора добавляют IPTG до 2 мМ и продолжают инкубировать клетки при 37оС в течение 4-5 ч. После этого клетки собирают центрифугированием при 5000 об/мин, 10 мин, 0-4оС. Ресуспендируют в 10 мл охлажденного на льду лизирующего буфера (0,2 М трис-HCl рН 7,5; 0,2 М NaCl, 0,01 М ацетат Mg, 0,01 М 2-МЕ, 5% глицерина). Для полного лизиса и уменьшения вязкости раствора клетки обрабатывают на ультразвуковом дезинтеграторе 8-10 раз по 10-20 с при 22 кГц. После чего гомогенат центрифугируют при 5000-10000 об/мин, 30 мин, 4оС. Осадок растворяют в 10 мл раствора, содержащего 6М гуанидин-хлорида и 1% 2-МЕ. Гомогенат диализуют в течение ночи против 100 объемов буфера PBS. Антигенную активность выделенного белка исследуют иммуноферментным методом (ELISA). Полученные результаты представлены в табл. 2.
Таким образом, предлагаемый способ получения фрагмента ДНК, позволяет получить фрагмент, кодирующий синтез полноценного белка G вируса бешенства, содержащий уникальные сайты рестрикции на концах фрагмента ДНК, позволяющие быстро и эффективно переклонировать его в любую генно-инженерную систему, используемую при создании вакцин и диагностикумов против бешенства.
Предлагаемая рекомбинантная плазмида PVG18-1, содержащая ген гликопротеина G вируса бешенства, позволяет получить штамм E. coli ВКМ CR-355Д - продуцент белка G вируса бешенства. Полученный штамм может быть использован при создании диагностикумов против бешенства. (56) 1. Dietzshold B; Wictor T. Y. ; Wunner W. H. and Varrichio A; Virology, 1983, 124, 330-337.
2. Wunner W. H. Dietzschold B, Curtis P. Y. , Wictor T. Y. , Y. gen. Virol. , 1983, 64, 1649-1656.
3. Anillionis A. , Wunner W. H. , Curtis P. Y. , Nature, 1981, 294, 275-278.
4. Yelverton E. , Norton Sh. , Obiveski Y. H. , Goeddel D. V. , Sciense, 1983, 219, 614-620.
5. Патент США N 4393201, кл. C 07 H 21/04, "DNA which codes for glycoprotein of ERA-strain rabies virus. "
6. Appelhans H. , Biotchnology Education, 1991, vol. 2, N. 1, pp. 31-35.
7. Селимов М. А. Современные достижения в области рабиологии. М. : ВНИИМИ, 1987, с. 69.
8. Sanger F. , Miklen S. , Coukson A. R. , Proc. Nat. Acad. Sci. USA, 1977, 74, 5463-5467.
Формула изобретения: 1. Фрагмент ДНК, кодирующий синтез гликопротеина G вируса бешенства, размером 1,6 т. п. н. , полученный путем выделения вирионной РНК из вируса бешенства и синтезом 1 цепи кДНК с использованием специфических праймеров с последующей амплификацией гена, со следующей последовательностью:
GGATCCAGGAAAG ATG GTT CCT CAG GCT CTC CTG TTT GTA CCC CTT CTG GTT TTT
MET Val Pro Gln Ala Leu Leu Phe Val Pro Leu Leu Val Phe
56 CCA TTG TGT TTT GGG AAA TTC CCT ATT TAC ACG ATA CCA GAC
Pro Leu Cys Phe Gly Lys Phe Pro Ile Tyr Thr Ile Pro Asp
98 AAG CTT GGT CCC TGG AGC CCG ATT GAC ATA CAT CAC CTC AGC
Lys Leu Gly Pro Trp Ser Pro Ile Asp Ile His His Leu Ser
140 TGC CCA AAC AAT TTG GTA GTG GAG GAC GAA GGA TGC ACC AAC
Cys Pro Asn Asn Leu Val Val Glu Asp Glu Gly Cys Thr Asn
182 CTG TCA GGG TTC TCC TAC ATG GAA CTT AAA GTT GGA TAC ATC
Leu Ser Gly Phe Ser Tyr MET Glu Leu Lys Val Gly Tyr Ile
224 TTA GCC ATA AAA ATG AAC GGG TTC ACT TGC ACA GGC GTT GTG
Leu Ala Ile Lys MET Asn Gly Phe Thr Cys Thr Gly Val Val
266 ACG GAG GCT GAA AAC TAC ACT AAC TTC GTT GGT TAT GTC ACA
Thr Glu Ala Glu Asn Tyr Thr Asn Phe Val Gly Tyr Val Thr
308 ACC ACG TTC AAA AGA AAG CAT TTG CGC CCA ACA CCA GAT GCA
Thr Thr Phe Lys Arg Lys His Leu Arg Pro Thr Pro Asp Ala
350 TGT AGA GCC GCG TAC AAC TGG AAG ATG GCC GGT GAC CCCAGA
Cys Arg Ala Ala Tyr Asn Trp Lys MET Ala Gly Asp Pro Arg
392 TAT GAA GAG TCT CTA CAC AAT CCG TAC CCT GAC TAC AGC TGG
Tyr Glu Glu Ser Leu His Asn Pro Tyr Pro Asp Tyr Ser Trp
434 CTT CGA ACT GTA AAA ACC ACC AAG GAG TCT CTC GTT ATC ATA
Leu Arg Thr Val Lys Thr Thr Lys Glu Ser Leu Val Ile Ile
476 TCT CCA AGT GTA GCA GAT TTG GAC CCA TAT GAC AGA TCC CTT
Ser Pro Ser Val Ala Asp Leu Asp Pro Tyr Asp Arg Ser Leu
518 CAC TCG AGG GTC TTC CCT AGC GGG AAG TGC TCA GGA GTA GCG
His Ser Arg Val Phe Pro Ser Gly Lys Cys Ser Gly Val Ala
560 GTG TCT TCT ACC TAC TGC TCC ACT AAC CAC GAT TAC ACC ATT
Val Ser Ser Thr Tyr Cys Ser Thr Asn His Asp Tyr Thr Ile
602 TGG ATG CCC GAG AAT CCG AGA CTA GGG AAG TCT TGT GAC ATT
Trp MET Pro Glu Asn Pro Arg Leu Gly Lys Ser Cys Asp Ile
644 TTT ACC AAT AGT AGA GGG AAG AGA GCA TCC AAA GGG AGT GAG
Phe Thr Asn Ser Arg Gly Lys Arg Ala Ser Lys Gly Ser Glu
686 ACT TGC GGC TTT GTA GAT GAA AGA GGC CTA TAT AAG TCT TTA
Thr Cys Gly Phe Val Asp Glu Arg Gly Leu Tyr Lys Ser Leu
728 AAA GGA GCA TGC AAA CTC AAG TTA TGT GGA GTT CTC GGA CTT
Lys Gly Ala Cys Lys Leu Lys Leu Cys Gly Val Leu Gly Leu
770 AGA CTT ATG GAT GGA ACA TGG GTC GCG ATG CAA ACA TCA AAT
Arg Leu MET Asp Gly Thr Trp Val Ala MET Gln Thr Ser Asn
812 GAA ACC AAA TGG TGC CCT CCC GAT CAG TTG GTG AAC CTG CAC
Glu Thr Lys Trp Cys Pro Pro Asp Gln Leu Val Asn Leu His
854 GAC TTT CGC TCA GAC GAA ATT GAG CAC CTT GTT GTA GAG GAG
Asp Phe Arg Ser Asp Glu Ile Glu His Leu Val Val Glu Glu
896 TTG GTC AGG AAG AGA GAG GAG TGT CTG GAT GCA CTA GAG TCC
Leu Val Arg Lys Arg Glu Glu Cys Leu Asp Ala Leu Glu Ser
938 ATC ATG ACA ACC AAG TCA GTG AGT TTC AGA CGT CTC AGT CAT
Ile MET Thr Thr Lys Ser Val Ser Phe Arg Arg Leu Ser His
980 TTA AGA AAA CTT GTC CCT GGG TTT GGA AAA GCA TAT ACC ATA
Leu Arg Lys Leu Val Pro Gly Phe Gly Lys Ala Tyr Thr Ile
1022 TTC AAC AAG ACC TTG ATG GAA GCC GAT GCT CAC TAC AAG TCA
Phe Asn Lys Thr Leu MET Glu Ala Asp Ala His Tyr Lys Ser
1064 GTC AGA ACT TGG AAT GAG ATC CTC CCT TCA AAA GGG TGT TTA
Val Arg Thr Trp Asn Glu Ile Leu Pro Ser Lys Gly Cys Leu
1106 AGA GTT GGG GGG AGG TGT CAT CCT CAT GTG AAC GGG GTG TTT
Arg Val Gly Gly Arg Cys His Pro His Val Asn Gly Val Phe
1148 TTC AAT GGT ATA ATA TTA GGA CCT GAC GGC AAT GTC TTA ATC
Phe Asn Gly Ile Ile Leu Gly Pro Asp Gly Asn Val Leu Ile
1190 CCA GAG ATG CAA TCA TCC CTC CTC CAG CAA CAT ATG GAG TTG
Pro Glu MET Gln Ser Ser Leu Leu Gln Gln His MET Glu Leu
1232 TTG GAA TCC TCG GTT ATC CCC CTT GTG CAC CCC CTG GCA GAC
Leu Glu Ser Ser Val Ile Pro Leu Val His Pro Leu Ala Asp
1274 CCG TCT ACC GTT TTC AAG GAC GGT GAC GAG GCT GAG GAT TTT
Pro Ser Thr Val Phe Lys Asp Gly Asp Glu Ala Glu Asp Phe
1316 GTT GAA GTT CAC CTT CCC GAT GTG CAC AAT CAG GTC TCA GGA
Val Glu Val His Leu Pro Asp Val His Asn Gln Val Ser Gly
1358 GTT GAC TTG GGT CTC CCG AAC TGG GGG AAG TAT GTA TTA CTG
Val Asp Leu Gly Leu Pro Asn Trp Gly Lys Tyr Val Leu Leu
1400 AGT GCA GGG GCC CTG ACT GCC TTG ATG TTG ATA ATT TTC CTG
Ser Ala Gly Ala Leu Thr Ala Leu MET Leu Ile Ile Phe Leu
1442 ATG ACA TGT TGT AGA AGA GTC AAT CGA TCA GAA CCT ACG CAA
MET Thr Cys Cys Arg Arg Val Asn Arg Ser Glu Pro Thr Gln
1484 CAC AAT CTC AGA GGG ACA GGG AGG GAG GTG TCA GTC ACT CCC
His Asn Leu Arg Gly Thr Gly Arg Glu Val Ser Val Thr Pro
1526 CAA ACG TGG AAG ATC ATA TCT TCA TGG GAA TCA CAC AAG AGT
Gln Thr Trp Lys Ile Ile Ser Ser Trp Glu Ser His Lys Ser
1568 GGG GGT GAG ACC AGA CTG TGA GGACTGGCCGTCCTTTCAACG
Gly Gly Glu Thr Arg Leu TER
1610ATCCAAGTCCTGAAGATCACCTCCCCTTAACTGCAG
2. Рекомбинантная плазмидная ДНК pVG 18-1, кодирующая гликопротеин G вируса бешенства, размером 4,2 т. п. о. , содержащая:
- плазмидную ДНК вектора pUC 18 размером 2,6 т. п. о. , состоящего из фрагмента плазмиды pBR 322 размером 2186 п. о. , участка LacZ оперона размером 445 п. о. и полилинкера,
- BamH1 - Pst1 - фрагмент ДНК в геном гликопротеина вируса бешенства размером 1600 п. о. ,
- участки расщепления рестриктаз:
по участку 1 расщепления рестриктазами Е coR I, Sac I, Kpn I, Sma I, Xma I, BamH I, Pst I, Sph I, Gla I, Pvu I, Xho I и 2 участка расщепления рестриктазой Hind III,
- генетические маркеры;
bla - ген, обеспечивающий синтез бета-лактамазы и устойчивость к ампициллину;
- las Z - ген, обеспечивающий синтез бета-галактозидазы,
- lac Z - промотор, обеспечивающий транскрипцию гена гликопротеина G.
3. Штамм бактерий Escherichia coli ВКМ CR-355Д - продуцент гликопротеина G вируса бешенства.