Forbidden

You don't have permission to access /zzz_siteguard.php on this server.

‘–ј√ћ≈Ќ“ Ќ” Ћ≈»Ќќ¬ќ…  »—Ћќ“џ,  ќƒ»–”ёў»… ѕќЋ»ѕ≈ѕ“»ƒ, ќЅЋјƒјёў»… ј “»¬Ќќ—“№ё Ќ»“–»Ћ√»ƒ–ќ“ј«џ, –≈ ќћЅ»ЌјЌ“Ќјя ѕЋј«ћ»ƒЌјя ƒЌ  PPCL 4,  ќƒ»–”ёўјя ѕќЋ»ѕ≈ѕ“»ƒ, ќЅЋјƒјёў»… ј “»¬Ќќ—“№ё Ќ»“–»Ћ√»ƒ–ј“ј«џ, Ў“јћћ Ѕј “≈–»… ESCHERICHIA COLI - ѕ–ќƒ”÷≈Ќ“ ѕќЋ»ѕ≈ѕ“»ƒј, ќЅЋјƒјёў≈√ќ ј “»¬Ќќ—“№ё Ќ»“–»Ћ√»ƒ–ј“ј«џ, —ѕќ—ќЅ ѕќЋ”„≈Ќ»я Ќ»“–»Ћ√»ƒ–ј“ј«џ - ѕатент –‘ 2028380
√лавна€ страница  |  ќписание сайта  |   онтакты
‘–ј√ћ≈Ќ“ Ќ” Ћ≈»Ќќ¬ќ…  »—Ћќ“џ,  ќƒ»–”ёў»… ѕќЋ»ѕ≈ѕ“»ƒ, ќЅЋјƒјёў»… ј “»¬Ќќ—“№ё Ќ»“–»Ћ√»ƒ–ќ“ј«џ, –≈ ќћЅ»ЌјЌ“Ќјя ѕЋј«ћ»ƒЌјя ƒЌ  PPCL 4,  ќƒ»–”ёўјя ѕќЋ»ѕ≈ѕ“»ƒ, ќЅЋјƒјёў»… ј “»¬Ќќ—“№ё Ќ»“–»Ћ√»ƒ–ј“ј«џ, Ў“јћћ Ѕј “≈–»… ESCHERICHIA COLI - ѕ–ќƒ”÷≈Ќ“ ѕќЋ»ѕ≈ѕ“»ƒј, ќЅЋјƒјёў≈√ќ ј “»¬Ќќ—“№ё Ќ»“–»Ћ√»ƒ–ј“ј«џ, —ѕќ—ќЅ ѕќЋ”„≈Ќ»я Ќ»“–»Ћ√»ƒ–ј“ј«џ
‘–ј√ћ≈Ќ“ Ќ” Ћ≈»Ќќ¬ќ…  »—Ћќ“џ,  ќƒ»–”ёў»… ѕќЋ»ѕ≈ѕ“»ƒ, ќЅЋјƒјёў»… ј “»¬Ќќ—“№ё Ќ»“–»Ћ√»ƒ–ќ“ј«џ, –≈ ќћЅ»ЌјЌ“Ќјя ѕЋј«ћ»ƒЌјя ƒЌ  PPCL 4,  ќƒ»–”ёўјя ѕќЋ»ѕ≈ѕ“»ƒ, ќЅЋјƒјёў»… ј “»¬Ќќ—“№ё Ќ»“–»Ћ√»ƒ–ј“ј«џ, Ў“јћћ Ѕј “≈–»… ESCHERICHIA COLI - ѕ–ќƒ”÷≈Ќ“ ѕќЋ»ѕ≈ѕ“»ƒј, ќЅЋјƒјёў≈√ќ ј “»¬Ќќ—“№ё Ќ»“–»Ћ√»ƒ–ј“ј«џ, —ѕќ—ќЅ ѕќЋ”„≈Ќ»я Ќ»“–»Ћ√»ƒ–ј“ј«џ

‘–ј√ћ≈Ќ“ Ќ” Ћ≈»Ќќ¬ќ…  »—Ћќ“џ,  ќƒ»–”ёў»… ѕќЋ»ѕ≈ѕ“»ƒ, ќЅЋјƒјёў»… ј “»¬Ќќ—“№ё Ќ»“–»Ћ√»ƒ–ќ“ј«џ, –≈ ќћЅ»ЌјЌ“Ќјя ѕЋј«ћ»ƒЌјя ƒЌ  PPCL 4,  ќƒ»–”ёўјя ѕќЋ»ѕ≈ѕ“»ƒ, ќЅЋјƒјёў»… ј “»¬Ќќ—“№ё Ќ»“–»Ћ√»ƒ–ј“ј«џ, Ў“јћћ Ѕј “≈–»… ESCHERICHIA COLI - ѕ–ќƒ”÷≈Ќ“ ѕќЋ»ѕ≈ѕ“»ƒј, ќЅЋјƒјёў≈√ќ ј “»¬Ќќ—“№ё Ќ»“–»Ћ√»ƒ–ј“ј«џ, —ѕќ—ќЅ ѕќЋ”„≈Ќ»я Ќ»“–»Ћ√»ƒ–ј“ј«џ

ѕатент –оссийской ‘едерации
—уть изобретени€: »зобретение относитс€ к биотехнологии и генетической инженерии, в частности к получению ферментов клетчатого метаболизма. —ущность изобретени€ состоит в том, что из Pseudomonas chlororaphis ¬23 получен фрагмент ƒЌ , который кодирует полипептид, обладающий активностью нитрилгидратазы и способный гидратировать нитрилы в амиды. ѕолучена рекомбинантна€ ƒЌ , содержаща€ этот ген, и трансформант, образованный путем трансформации штамма E. coli этой рекомбинантной ƒЌ . »зобретение, кроме того, включает способ получени€ нитрилгидратазы, использу€ трансформант. 4 с.п. ф-лы, 10 ил.
ѕоиск по сайту

1. — помощью поисковых систем

   — помощью Google:    

2. Ёкспресс-поиск по номеру патента


введите номер патента (7 цифр)

3. ѕо номеру патента и году публикации

2000000 ... 2099999   (1994-1997 гг.)

2100000 ... 2199999   (1997-2003 гг.)
Ќомер патента: 2028380
 ласс(ы) патента: C12N15/31, C12N9/14, C12P13/02, C12N9/78
Ќомер за€вки: 4895024/13
ƒата подачи за€вки: 27.02.1991
ƒата публикации: 09.02.1995
«а€витель(и): Ќитто  емикал »ндастриз  о., Ћтд. (JP); “ерухико Ѕеппу (JP); ’идеаки ямада (JP)
јвтор(ы): “ерухико Ѕеппу[JP]; ’идеаки ямада[JP]; “ору Ќагасава[JP]; —уехару ’ориноути[JP]; ћакато Ќиси€ма[JP]
ѕатентообладатель(и): Ќитто  емикал »ндастриз  о., Ћтд. (JP); “ерухико Ѕеппу (JP); ’идеаки ямада (JP)
ќписание изобретени€: »зобретение относитс€ к гену, который получен из Rseudomonas chlororaphis ¬23 и который кодирует полипептид, обладающий активностью нитрилгидратазы, гидратирующей нитрилы в амиды. »зобретение относитс€ к рекомбинантной ƒЌ , содержащей ген, и трансформанту, трансформированному этой рекомбинантной ƒЌ . »зобретение относитс€, кроме того, к способу получени€ нитрил гидратазы, использу€ трансформант, и амидов, использу€ нитрил гидратазу.
Ќитрилгидратаза или нитрилаза известна как фермент, который гидратирует нитрилы в амиды. ћикроорганизмы, которые продуцируют нитрил гидратазу, включают те, которые принадлежат роду Bacillus, роду Bacteridium роду Micrococcus и роду Brcvibacterium (см. JP-B-62-21517/1989, патент —Ўј N 4001081), роду Coryhebacterium и роду Vocardia (см. JP-B-56-17918/1989, патент —Ўј 4248968), роду Pseudomonas (см.JP B-59-37951/1984, патент —Ўј 4637982), роду Rhodococcus, роду Arthrobacter и роду Microbacterium (см, JP-ј-61-162193/1986, ≈ѕ-ј-0188316) и Rhodococcus rhodochroous (см. JP-ј-2-470/1990, ≈ѕ-ј-0307928).
Ќитрилгидратаза использовалась дл€ гидратации нитрилов в амиды.  онструиру-ютс€ микроорганизмы, содержащие несколько копий рекомбинантной ƒЌ , кодирующей нитрилгидратазу, с использованием приемов рекомбинантной ƒЌ . –екомбинант продуцирует значительные уровни нитрилгидратазы по сравнению с известными приемами.
ѕредложен ранее ген, полученный из Rhodococcus вида N-774 (FERM ¬–-1936), который также кодирует полипептид, обладающий активностью нитрилгидратазы (JP-ј-2-119778/1988). Ќапротив, в соответствии с насто€щим изобретением используют ген, полученный из Pseudomonas chlororaphis ¬23, описанный в патенте —Ўј N 4637982 дл€ продуцировани€ нитрилгидратазы. ¬ыделен ген, кодирующий нитрилгидратазу, вставил ген в соответствующий вектор плазмиды и трансформировал соответствующего хоз€ина этой рекомбинантной плазмидой, получа€ таким образом трансформант, продуцирующий нитрилгидратазу.
»зобретение относитс€ к
1) гену, кодирующему полипептид, который обладает активностью нитрилгидратазы и который содержит α-субблок со следующей аминокислотной последовательностью:
MetSerThrSerIlSerThrThrAlaTProSerThrProG GluArgAlaTrpALeuPheGlnValLLysSerLysGluL IleProGluGlyTValGluGlnLeuTGlnLeuMetAlaH AspTrpSerProGAsnGlyAlaArgVValAlaLysAlaT ValAspProGlnPArgAlaLeuLeuLLysAspGlyThrA AlaCysAlaGlnPGlyTyrThrGlyPGlnGlyGluTyrI ValAlaLeuGluAThrProGlyValAsnValIleVal SerLeuCysSerThrAsnTrpProLeuGlyLeuPro GluTrpTyrLysPheGluPheArgArgLeuValArg GlyArgThrValArgGluLeuGlyGluLeuProSer ThrValIleLysTrpAspThrSerGluSerArgTyr ValLeuProGlnProGluGlySerHisMetSerGlu GlnLeuGlnGlnValThrLysAspLeuIleGlyVal LeuProArgVal
и β -субъединицу со следующей аминокислотной последовательностью
MetAspGlyPheHiAspLeuGlyGlyPGlnGlyPheGlyL ValProHisThrIAsnSerLeuSerTLysGlnValPheL GlnAspTrpGluHLeuAlaTyrSerLMetPheValGlyV AspGlnLeuLysLPheSerValAspGValArgHisAlaV GluArgLeuAspVArgGlnHisValGThrGlnTyrTyrG ArgTyrIleIleAThrAlaThrLeuLValGluThrGlyV IleThrGlnAlaGLeuAspGlnAlaGlySerHisPhe LeuAlaAsnProHisAlaThrGlyProAlaIleThr ArgProProPheValGlyAspArgValValArgAsp TyrValAlaGlyIleArgMetProTyrValArgGly GluGlyValValHisArgThrSerGlnTrpProPhe AspAlaIleGlyGlyAspLeuSerAlaHisGlnPro TyrHisValGluArgValLysAspTrpGlyAspAla AspAspGlyTyrValValAspLeuGluSerTyrLeu LysAlaProGlyGlnAlaValAsn
2) гену, описанному в (1), кодирующему α- и β -субблоку, содержащему кодирующую α- субблок последовательностью
15 30 45
ATGAGTACATCTATTTCCACGACTGCGACACCTTCGACACCCGGC
60 75 90
GAGAGGGCATGGGCCTTGTTTCAAGTGCTCAAGAGCAAGGAACTC
105 120 135
ATCCCAGAGGGCTATGTCGAGCAGCTCACTCAATTGATGGCCCAT
150 165 180
GACTGGAGCCCGGAGAACGGCGCTCGCGTGGTCGCCAAGGCATGG
195 210 225
GTCGATCCGCAGTTCCGGGCGCTGCTGCTCAAGGACGGAACAGCC
240 255 270
GCTTGCGCGCAGTTCGGCTACACCGGCCCACAAGGCGAATACATC
285 300 315
GTCGCCCTGGAAGATACACCGGGGGTGAAGAACGTCATCGTCTGC
330 345 360
AGCCTGTGCTCCTGCACCAACTGGCCGGTCCTCGGCCTGCCGCCC
375 390 405
GAGTGGTACAAGGGCTTTGAGTTTCGTGCGCGCCTGGTCCGGGAG
420 435 450
GGGCGCACCGTACTGCGCGAGCTGGGGACGGAGTTGCCGAGCGAC
465 480 495
ACGGTCATCAAAGTCTGGGATACCAGCGCCGAAAGCCGTTACCTG
510 525 540
GTGTTGCCGCAAAGGCCTGAAGGCTCTGAGCACATGAGTGAAGAA
555 570 585
CAGCTTCAACAGCTGGTGACCAAAGACGTGCTGATTGGCGTCGCC
600
CTGCCACGCGTTGGC
и последовательность, кодирующую β-субъединицу:
15 30 45
ATGGATGGCTTTCACGATCTCGGCGGTTTCCAAGGCTTTGGCAAA
65 75 90
GTGCCGCACACCATCAACAGCCTCAGCTACAAACAGGTTTTCAAG
105 120 135
CAGGACTGGGAACACCTGGCCTATAGCTTGATGTTTGTCGGCGTT
150 165 180
GACCAATTGAAAAAGTTCAGCGTGGACGAAGTGCGTCATGCCGTC
195 210 225
GAACGCCTGGACGTTCGCCAGCATGTCGGCACCCAGTACTACGAA
240 255 270
CGCTACATCATCGCGACCGCCACGCTGCTGGTGGAAACGGGCGTT
285 300 315
ATCACCCAGGCGGAGCTCGATCAGGCATTGGGTTCCCACTTCAAG
330 345 360
CTGGCGAACCCCGCCCATGCGACAGGTCGCCCGGCGATCACCGGC
375 390 405
AGGCCGCCCTTCGAAGTGGGCGATCGGGTTGTGGTTCGAGACGAA
420 435 450
TATGTGGCGGGGCATATCCGCATGCCGGCCTACGTGCGCGGTAAG
465 480 495
GAAGGCGTGGTCCTGCACCGCACCTCAGAGCAGTGGCCCTTCCCC
510 525 540
GACGCCATTGGCCACGGCGACTTGAGCGCAGCCCATCAGCCTACC
555 570 585
TACCACGTCGAGTTTCGCGTGAAAGATCTATGGGGTGACGCGGCA
600 615 630
GATGACGGTTACGTCGTGGTCGATCTTTTCGAAAGCTACTTGGAT
645 660
AAGGCCCCCGGTGCCCAAGCGGTGAACGCA
3) рекомбинантной ƒЌ , содержащей вектор, включающий ген, описанный в [1] или [2]; 4) трансформанту, трансформированному рекомбинантной ƒЌ , описанной в [3] ; 5) способу продуцировани€ нитрилгидратазы, который содержит культивирование трансформанта, и выделение нитрилгидратазы из культуры; 6) способу продуцировани€ амидов, который содержит гидратирование нитрилов, использу€ нитрилгидратазу, с целью получени€ амидов; 7) способу получени€ амидов, который содержит культивирование трансформанта и гидратирование нитрилов, использу€ полученную в результате культуру изолированных бактериальных клеток, обработанных им, или фиксированным их материалом, чтобы получить амиды.
»зол€ци€ и очистка нитрилгидратазы и частичный анализ последовательности аминокислот нитрилгидратазы.
Ќитрилгидратазу изолируют и подвергают очистке из Psudomonas chlororaphis ¬ 23 и раздел€ют между α и β субблоками, использу€ ∆’¬ƒ (жидкосткую хроматографию под высоким давлением). ќпредел€ют часть аминокислотной последовательности субблоками (фиг.1).
ѕолучение ƒЌ -зонда дл€ гена нитрилгидратазы.
ƒH -зонд получают из штамма J ћ105/ру V  121 (FERM ¬–-1937), как это описано в JP-ј-2-119778/1990, благодар€ высокой степени гомологичности в аминокислотной последовательности между β-субблоком нитрилгидратазы Rhodococcus вида N-744, описанным в вышеупом€нутой японской √осударственной ѕатентной √азете, и соответствующим β-субблоком Pseudomonas chlororahis ¬23. ѕлазмиду –уV 121, содержащую ген нитрилгидратазы, полученный из Rhodococcus вида N-744, приготавливают из культуры JM105/р”V 121, ƒЌ  р”V 121 переваривают при помощи ферментов Sph I и Sal I. ‘рагмент Sph I-Sal I содержит ген нитрилгидратазы (фиг. 2-5) Rhodococcus вида N-744. ƒЌ -фрагмент мет€т радиоизотопом, чтобы получить зонд.
ќбнаружение ƒЌ -сегмента, содержащего ген нитрилгидратазы из хромосомы Pseurdomonas chlororaphis ¬ 23.
’ромосомную ƒЌ  получают из культуры Pseudomonas chlororaphis ¬23. ’ромосомную ƒЌ  переваривают ферментами рестрикции и подвергают гибридизации с зондом, описанным в [2], использу€ процедуру гибридизации —аутерна (—аутерн, Ё.M, J Mol. Biol, т.98, с. 503 (1975). ѕросеивают два ƒЌ -фрагменты различной длины.
 онструкци€ рекомбинантной плазмиды. –екомбинантную плазмиду конструируют при помощи вставки фрагмента хромосомной ƒЌ , полученной в [3], в вектор плазмиды.
“рансформаци€ и просеивание трансформанта, содержащего рекомбинантную плазмиду. “рансформанты получают с использование известной рекомбинантной плазмиды. “рансформант, содержащий рекомбинантную плазмиду, подвергают селекции с использованием зонда, описанного в [2], в соответствии с процедурой гибридизации колоний (–.Ѕрюс ”оллес и др. NUC/ Aci. Res, т.9, с.879 (1981)).  роме того, присутствие гена нитрилгидратазы в рекомбинантной плазмиде подтверждают при помощи процедуры гибридизации —аутерна. ќтобранные таким образом плазмиды обозначают р–—N1 и p–CN3.
6) »зол€ци€ и очистка ƒЌ -плазмиды, и конструкци€ карты рестрикции. ƒЌ  плазмид р–—N1 и pPCN3, изолируют и подвергают очистке.  онструируют карту рестрикции ƒЌ  (фиг.6), чтобы определить область, содержащую ген нитрилгидратазы.
7) јнализ ƒЌ -последовательности. ƒополнительный сегмент вставленного ƒЌ -фрагмента в р–—N1 и р–—N3 расщепл€ют с использованием соответствующего фермента рестрикции. ¬ставленный ƒЌ -фрагмент затем используют дл€ анализа последовательности. Ќуклеотидна€ последовательность ƒЌ -фрагмента (фиг.7-10) показывает, что она содержит последовательность, полученную из аминокислотной последовательности, как это описано в (1).
8) ¬ставка ƒЌ -фрагмента в вектор экспрессии и трансформаци€. ƒЌ -фрагмент отсекают от р–—N1 и рP—N3, используют соответствующие ферменты рестрикции. Ёти два фрагмента подвергают лигации и вставл€ют в вектор экспрессии рV—19. Ёту конструкцию используют дл€ трансформации ≈.coli JM105 (јмершэм) и этот трансформант обозначают через JM105/pPCN4.
9) ѕродуцирование нитрилгидратазы с использованием трансформанта и превращение нитрилов в амиды.  ультивируют трансформант, описанный в (8). Ѕактериальные клетки смешивают с нитрилами, субстратом нитрилгидратазы и получают амиды.
Pseudomonas chlororaphis ¬23 сдан на хранение в »сследовательский институт ферментации. јгенство по промышленной науке и технологии, и ему присвоен шифр хранени€ FEPM B–-187. “рансформант JM105/pPCN4 сдан на хранение в тот же институт и ему присвоен шифр хранени€ FERM ¬R-2779.
Ћюбой вектор, включающий вектор плазмиды (например, рј“ 153, рћ–9, рЌ—624, р —7, и т.д.), вектор фага (например, λ gt II (“оиобо), „арон 4ј (јмершэм) и т,д,) можно использовать в соответствии с насто€щим изобретением. ‘ерменты, которые можно при этом использовать включают Sph I, Sal I, Sac, Bam, HI, EcoRI, Pst I и т.д., которые производ€тс€ промышленностью (фирма “акара Ўузо). —амых разнообразных хоз€ев можно использовать дл€ трансформации, например, ≈.coli, JM105 и TGI (но ими не исчерпываетс€ весь список).  ультурной средой дл€ трансформанта может быть люба€ среда, которую в общем случае используют дл€ этих целей.
ѕревращение нитрилов в амиды осуществл€ют с использованием нитрилгидратазы, неочищенной нитрилгидратазы, культуры трансформанта, изолированных бактериальных клеток или их обработанного материала и т.п., полученных из культуры трансформанта.
—оответствующие нитрилы насто€щего изобретени€ включают те, которые содержат 2-4 атома углерода, также, как ацетонитрил, пропионитрил, акрилонитрил, метакрилонитрил, н-бутиронитрил и изобутилонитрил, причем акрилонитрил €вл€етс€ предпочтительным.
Ќа фиг.1 показана N-терминальна€ аминокислотна€ последовательность α- и β -субблоков нитрилгидратазы, полученной с использованием Pseudomonas chlororaphis B 23; на фиг.2-5 - ƒЌ -последовательность гена нитрилгидратазы Rhodococcus виды N-774, использованна€ в качестве ƒЌ-зонда; на фиг.6 - частичные карты рестрикций рекомбинантных плазмид, pP—N1, pPCN3 и ppCN4; на фиг. 7-10 - нуклеoтидна€ последовательность ƒЌ -вставки в pP—N3, полученна€ из ¬23, и выделенна€ аминокислотна€ последовательность.
¬ соответствии с насто€щим изобретением предлагаетс€ аминокислотна€ последовательность и нуклеотидна€ последовательность α- и β -субблоков нитрил- гидратазы, получены из Pseudomonas chlororaphis B23. √ен, кодирующий нитрилгидратазу, вставл€ют в вектор экспрессии, а рекомбинантный вектор используют дл€ трансформации. “рансформант содержит несколько копий гена и продуцирует более высокие концентрации нитрилгидратазы по сравнению с известными, используемыми дл€ этих целей, микроорганизмами.
»зобретение описано подробно в приводном ниже примере. ¬ этом примере используют следующие сокращени€.
T≈: трис-H—l (10 мћ, рЌ 7,8), Ёƒ“  (1 мћ, рЌ 8,0)
“NE: трис-HCl (50 мћ, рЌ 8,0), Ёƒ“  (1 мћ, рЌ 8,0), NaCl (50 мћ)
“≈: трис-HCl (50 мћ, рЌ 8,0), Ёƒ“  (5 мћ, рЌ 8,0), сахароза (35 мћ)
—реда 2 ’”“: 1,6% “риптон, 1,0% экстракт дрожжей, 0,5% NaCl
1. »зол€ци€ и очистка нитрилгидратазы и анализ аминокислотной последовательности части нитрилгидратазы Pseudomonas chlororaphis ¬23 культивировали в среде (10 г/л сахарозы, 4 г/л метакриламида, 0,5 г/л  Ќ2–ќ4, 0,5 г/л  2ЌPO4, 0,5 г/л MgSO4.7H2O, 0,01 г/л FeSO4.7H2O, рЌ 7,0) при 25о— в течение 28 ч. Ѕактериальные клетки собирали. 100 г бактериальных клеток разрушали и фракционировали при помощи сульфата аммони€. ѕробу подвергали диализу и диализат подвергали центрифугированию. ¬ерхний слой удал€ли и загружали на хроматографическую колонну ƒ≈ј≈-—ефадцел, ќктил-—ефароза  Ћ-4Ѕ, ‘енил-—ефароза  Ћ-4Ѕ и —ефадекс-√-150. јктивные фракции собирали и подвергали диализу. ƒиализат, содержащий фермент, загружали на колонну высокоэффективной жидкостной хроматографии, использу€ обращенно-фазовую колонну (—еншу ÷ак ¬–-304-1251, —еншу  агаку) и получали два субблока (α и β) , N-терминальную аминокислотную последовательность α- и β -субблоков определ€ли с использованием анализатора аминокислотных последовательностей (фирмы јпплайед Ѕиосистемз, ћодели 470ј), N-терминальные аминокислотные последовательности α- и β -субблоков приведены на фиг.1.
2. ѕолучение ƒЌ -зонда дл€ гена нитрилгидратазы E.coli JM105, содержащую p”VK121 (FERM BP-1927), культивировали в 100 мл среды 2 х ”“, содержащей 50 μ г/мл ампициллина, при 30о— в течение ночи (12 ч). Ѕактериальные клетки собирали и в клетки добавл€ли TNE. —успензию клеток затем подвергали центрифугированию. ¬ таблетку добавл€ли 8 мл STEи 10 мг лизоцима. —месь инкубировали при 0о— в течение 5 мин, затем добавл€ли 4 мл 0,25 ћ Ёƒ“ . ƒалее, добавл€ли в смесь при комнатной температуре 2 мл 10% ƒ—Ќ )додецил сульфата натри€ пер. ) и 5 мл 5ћ NaCl. ѕолученную в результате смесь выдерживали при 0-4о— в течение 3 ч, а затем подвергали ультрацентрифугированию. ¬ верхний слой добавл€ли 1/2 объема 30% ѕ≈√ 6000. —месь выдерживали при 0-4о— в течение ночи (12 ч) и подвергали центрифугированию. ¬ таблетку добавл€ли TNE, чтобы получить объем 7,5 мл, а затем в суспензию добавл€ли CSCl. —месь подвергали центрифугированию, чтобы удалить протеины. ƒалее в верхний слой добавл€ли 300-500 мг/мл бромида этиди€. —месь переносили в пробирку дл€ центрифугировани€. ѕробирку запаивали, а затем подвергали ультрацентрифугированию, ƒЌ  экстрагировали, использу€ перистальтический насос. ¬ экстракт, чтобы удалить бромид этиди€, добавл€ли несколько больше, чем равное количество изопропилового спирта, насыщенного водой. ѕробу подвергали диализу против “≈. ѕолучали примерно 3 мл очищенной р”V 121.
р”V 121 ƒЌ  переваривали ферментами Sph I и Sal I, получа€ в результате ƒЌ -фрагмент в 2,07 ко (килоосновани€ - пер.), содержащий ген нитрилгидратазы, полученный и Rpodococcus вида N-774. ‘рагмент метили радиоизотопом 32–, чтобы получить зонд. Ќуклеатидна€ последовательность зонда приведена фиг.2-5.
3. ѕолучение ƒЌ -фрагмента, содержащего геннитрил гидратазы хромосомы. Pseudomonas chlororaphis ¬23 культивировали в 100 мл среды, описанной [1]. Ѕактериальные клетки собирали и таблетку промывали при помощи TNE. «атем таблетку суспендировали в 10 мл “≈. ¬ суспензию добавл€ли 4 мл 0,25M Ёƒ“ , 10-20 мг лизозима, 10-20 мл ахромопротеазы и 10 мл 10% ƒ—Ќ. —успензию инкубировали при 37о— в течение 3 ч. ¬ суспензию добавл€ли 15 мл фенола. —месь инкубировали при комнатной температуре 60о— в течение 15 мин, а затем центрифугировали. ¬ 15 мл верхнего сло€ добавл€ли 0,7 мл 2,5ћ ацетата натри€ и диэтиловый простой эфир, смесь центрифугировали. ¬ерхний слой сбрасывали. ¬ нижний слой добавл€ли два объема этанола и ƒЌ  удал€ли стекл€нным стержнем. ƒЌ  промывали в течение 5 мин при помощи смеси “≈ : этанол 2:8, 1:9и 0:10 (о/o). ƒЌ  затем снова суспендировали в 2-4 мл “≈ (37о—). 10 μ л смеси –Ќазы ј и “1 добавл€ли в суспензию смесь инкубировали при 37о—. ¬ смесь добавл€ли равное количество фенола, а затем подвергали центрифугированию. ¬ 2-4 мл верхнего сло€ добавл€ли больше, чем равное количество простого эфира. —месь подвергали центрифугированию. ѕосле центрифугировани€ верхний слой сбрасывали. Ќижний слой подвергали диализу относительно 2 л “≈, содержащего небольшое количество хлороформа, в течение ночи, а затем диализу относительно свежего “≈ в течение 3-4 чл. ѕолучали 4 мл неочищенной хромосомной ƒЌ . ѕереваривание ферментом хромосомной ƒЌ  осуществл€ли следующим образом:
а) 2 μ л Sac I + 3 μ л реакционного буфера (10х) + 15 л хромосомной ƒЌ  + 10 μ л “≈
в) 2 μ л Bam HI + 2 μ л Sal I + 3 μ л реакционного буфера (10х) + 15 μ л хромосомной ƒЌ  + 10 μ л “≈.
—месь инкубировали при 37о— в течение 1 ч, а затем подвергали электрофорезу на геле агарозы при разности потенциалов 60 ¬ в течение 3 ч. √ибридизацию —аутерна хромосомной ƒЌ  осуществл€ли с использованием зонда, описанного в (2). ќбнаруживали фрагменты в примерно 4,6 ко и 4,7 ко, что говорит о сильной гибридизации. 15 μ л хромосомной ƒЌ  переваривали при помощи Sac I Bam HI и Sal I и подвергали электрофорезу на геле агарозы, как это было описано выше. ƒЌ -фрагменты в 4,6 ко и 4,7 ко срезали с гел€ и переносили в три объема 8ћ NaClO4. –аствор наносили капл€ми на фильтровальную бумагу GF/C/Bатман/ (диаметр 6 мм). Ќа фильтровальную бумагу добавл€ли дес€ть капель (≈ 100 μ л) “≈, содержащего 6ћ NaClO4, и дес€ть капель (≈ 100 μ л) 95% этанола. «атем бумагу сушили воздухом и помещали в 0,5 мл пробирку Ёппендорфа. ¬ пробирку добавл€ли 40 μ л “≈ и все это инкубировали при 37о— в течение 30 мин. «атем пробирку центрифугировали. ѕолучали примерно 40 μ л верхнего сло€, который содержал ƒЌ -фрагменты в 4,6 ко и 4,7 ко, содержащие ген нитрилгидратазы хромосомной ƒЌ .
4. ¬ставка хромосомного ƒЌ -фрагмента в вектор.
а) ƒЌ -фрагмента 4,6 ко
2 μ л Sac I, 3 μ л реакционного буфера (10х) и 10 мл “≈ добавл€ли в 10 μ в ƒЌ  pVC18. —месь инкубировали при температуре 37о— в течение 1 ч. 2 μ л 0,25M Ёƒ“  добавл€ли в смесь, чтобы прекратить реакцию. «атем в смесь добавл€ли 7 μ л “ћ “pис-HCl (pH 9) и 3 μ л Ѕƒ‘ (бактериальной щелочной фосфатазы). —месь инкубировали при 65о— в течение 1 ч. «атем в смесь добавл€ли “≈, чтобы довести общий объем до 100 μ л. —месь экстрагировали 3х равным количеством фенола. ¬ экстракт добавл€ли равное количество простого эфира. Ќижний слой удал€ли и в нижний слой добавл€ли 10 μ л 3ћ ацетат натри€ и 250 μ л этанола. —месь инкубировали при -80о— а течение 30 мин, подвергали центрифугированию. —ушили и снова суспендировали в “≈.
ѕолученные таким образом 5 μ л ƒЌ  – —18 и 40 μ л ƒЌ -фрагмента в 4,6 ко, описанного в (3), смешивали. ¬ смесь добавл€ли 6 μ л буфера лигации, 6 μ л ј“‘ (6 мг/мл) и 3 μ л ƒЌ  “4-лигазы. —месь инкубировали при 4о— в течение ночи (12 ч), чтобы получить рекомбинантную плазмиду, содержащую ƒЌ -фрагмент в 4,6 ко в —айте Sal I ч –VC18.
в) ƒЌ -фрагмент в 4,7 ко
рVC18 переваривали при помощи Bam HI и Sal I. ƒЌ -фрагмент в 4,7 ко вставл€ли в сайт Bam HI - Sal I в рVC18 точно так же, как это описано в (4а). ѕолучали рекомбинантную плазмиду, содержащую ƒЌ -фрагмент в 4,7 ко в сайтe Bam HI - Sal I.
5. “рансформаци€ и просеивание трансформантов.
E. coli JM105 (јмерщэм) прививали на 10 мл среды 2 х ”“ и инкубировали при 37о— в течение 12 ч. ѕосле инкубировани€ полученную в результате культуру добавл€ли в свежую среду 2 х ”“ до концентрации 1%, смесь инкубировали при 37о— в течение 1 ч.  ультуру подвергали центрифугированию и таблетку суспендировали в 5 мл холодного 50 мћ CaCl2. —успензию помещали в температуру 0о— на 40 мин, а затем подвергали центрифугированию. ¬ таблетку в отдельной пробирке добавл€ли 0,25 мл холодного 50 мћ CaCl2 и 60 μ л каждой из рекомбинантных плазмид, полученных в (4а,в). —месь инкубировали при 0о— в течение 40 мин, подвергали термическому удару до 42о— в течение 2 мин, помещали в температуру 0о— 5 мин и добавл€ли в 10 мл среды 2 х ”“. —месь инкубировали при 37о— в течение 90 мин при встр€хивании, затем центрифугировали. “аблетку суспензировали в 1 мл среды 2 х ”“ и 10 μ л суспензии наносили на агарозную пластинку 2 х ”“, содержащую 50 μ г/мл ампициллина. ѕластинку инкубировали при 37о—.  ологию выращивали на пластинке, затем подвергали селекции методом гибридизации колонии:  олонию переносили на нитроцеллюлозные фильтр и переваривали. ƒЌ  фиксировали на фильтре и гибридизировали с зондом, описанным в [2]. ‘ильтр подвергали авторадиографии и отбирали рекомбинантную колонию.  роме того, присутствие гена нитрилгидратазы в трансформанте подтверждали в соответствии с процедурой гибридизации —аутерна.
6) »зол€ци€ и очистка рекомбинантной плазмиды и конструкци€ карты рестрикции вставленных ƒЌ -фрагментов.
“рансформант выращивали в 100 мл среды 2 х ”“, содержащей 50 μ г/мл ампициллина при 37о— в течение ночи (12 ч). Ѕактериальные клетки собирали и в клетки добавл€ли TN≈.  летки собирали снова центрифугированием и в клетки добавл€ли 8 мл “≈ и 10 мг лизоцима. —месь инкубировали при 0о— в течение 5 мин. ¬ смесь добавл€ли 4 мл 0,25 м Ёƒ“ , 2 мл 10% ƒ—Ќ (при комнатной температуре) и 5 мл 5ћ NaCl. —месь инкубировали при 0-4о— в течение 3 ч и подвергали ультрацентрифугированию. ¬ верхний слой добавл€ли 1/2 объема 30- ѕ≈Ќ 6000. —месь инкубировали при 0-4о— в течение ночи (12 ч) и снова центрифугировали. TNE добавл€ли в таблетку, чтобы довести до объема 7,5 мл. ¬ суспензию добавл€ли CSCl. —успензию центрифугировали, чтобы удалить протеины. ƒалее, в верхний слой добавл€ли 300-500 мг/мл бромида этиди€ и смесь переносили в пробирку дл€ центрифугировани€. ѕробирку запаивали нагреванием и подвергали ультрацентрифугиро- ванию. ƒЌ  удал€ли, использу€ перистальтический насос. ¬ ƒЌ , чтобы удалить бромид этиди€, добавл€ли несколько больше, чем равное количество изопропилового спирта, насыщенного водой. ѕробу ƒЌ  подвергали диализу относительно “≈, что приводило к образованию примерно 3 мл рекомбинантной ƒЌ . ѕолученную таким образом рекомбинантную плазмиду, содержащую ƒЌ -фрагмент в 4,6 ко, переваривали как pPCN1 (–екомбинантную плазмиду, содержащую ƒЌ -фрагмент в 4,5 ко, переваривали как pPCN3).
Ёти ƒЌ  плазмид переваривали при помощи Eco RI, Bam HI, Pst I, Sac I и Cal I.  арты рестрикции конструировали и они приведены на фиг.6.
7) јнализ ƒЌ -последовательности.
–асположение гена нитрилгидратазы в ƒЌ -фрагментах pPCN1 и pPCN3 определ€ли при помощи карты рестрикции и использованием процедуры гидролизации —аутерна. ќсновыва€сь на этих результатах, анализировали ƒЌ -фрагмент Bam HI - Hinc II при помощи процедуры —ангера (—ангер, ‘., Science, т.214, с. 1205-1210, (1981)), используют вектор фага ћ13. ƒЌ -фрагмент в 2456 ко из Pseudomonas chlororaphis ¬23 приведен на фиг.4.
¬с€ нуклеотидна€ последовательность, полученна€ из аминокислотной последовательности, определенной в [1], была обнаружена в последовательности в соответствии с описанием, приведенным выше. јнализ последовательности также обнаруживали, что этот ƒЌ -фрагмент содержал последовательность, кодирующую α - и β -субблоки.
8) ¬ставка ƒЌ -фрагмента Bam HI - Hinc IIв вектор экспрессии и трансформации.
‘рагмент Sph I - Bam HI в 2,2 ко в pPCN1 и фрагмент Nam HI - Sal I в 4,7 ко в pPCN3 расщепл€ли, оба фрагмента подвергали лигации (фиг.3). ‘рагмент после лигации вставл€ли в сайт Sph I - Sal I вектора экспрессии pVC19 и полученную конструкцию обозначали как pPCN4.
E. coli Jћ105 трансформировали при помощи pPCN4 точно так же, как это делали в (5), и трансформант обозначали через JM105/pPCN4 (FERM ¬–-2779).
9) ѕродуцирование нитрилгидратазы, использу€ трансформант, и превращение нитрилов в амиды, использу€ нитрилгидратазу.
JM105/pPCN4 прививали в 10 мл среды 2 х ”“, содержащей 50 μ г/мл ампициллина, и инкубировали при 26,5о— в течение ночи (12 ч). 100 μ л полученной в результате культуры добавл€ли в 10 мл среды 2 х ”“ (50 г/мл ампициллина, 50 мг/л FeSO4.7H2O, 10 мг/л MgSO4.7H2O, 1 мг/л пирролохинолинхонона). Ёту смесь инкубировали при 26,5о— в течение 5 ч. ¬ смесь добавл€ли IPTG до финальной концентрации I мм. —месь инкубировали при 26,5о— в течение 10 мин. ѕосле сбора клеток клетки суспендировали в 5 мл 1/20 ћ фосфатного буфера (рЌ 7,7). ¬ 0,1 мл суспензии добавл€ли 10 μ л раствора субстрата (1ћ акрилонитрила). —месь инкубировали при 20о— в течение 20 мин. ¬ качестве контрольного испытани€ использовали смесь, полученную при помощи аналогичной процедуры, что была oписана выше, но из E.coli JM105. –еакционную смесь испытывали на присутствие акриламида (продукта ферментной реакции) и акрилонитрила, использу€ ∆’¬ƒ. јкриламид, но не акрилонитрил обнаруживали в реакционной смесь JM105 pPCN4, в то врем€, как акрилонитрил, а не акриламид обнаруживали в реакционной смеси JM105.
‘ормула изобретени€: ‘–ј√ћ≈Ќ“ Ќ” Ћ≈»Ќќ¬ќ…  »—Ћќ“џ,  ќƒ»–”ёў»… ѕќЋ»ѕ≈ѕ“»ƒ, ќЅЋјƒјёў»… ј “»¬Ќќ—“№ё Ќ»“–»Ћ√»ƒ–ј“ј«џ, –≈ ќћЅ»ЌјЌ“Ќјя ѕЋј«ћ»ƒЌјя ƒЌ  рPCL 4,  ќƒ»–”ёўјя ѕќЋ»ѕ≈ѕ“»ƒ, ќЅЋјƒјёў»… ј “»¬Ќќ—“№ё Ќ»“–»Ћ√»ƒ–ј“ј«џ, Ў“јћћ Ѕј “≈–»… ESCHERICHIA COLI - ѕ–ќƒ”÷≈Ќ“ ѕќЋ»ѕ≈ѕ“»ƒј, ќЅЋјƒјёў≈√ќ ј “»¬Ќќ—“№ё Ќ»“–»Ћ√»ƒ–ј“ј«џ, —ѕќ—ќЅ ѕќЋ”„≈Ќ»я Ќ»“–»Ћ√»ƒ–ј“ј«џ.
1. ‘рагмент нуклеиновой кислоты, кодирующий полипептид, обладающий активностью нитрилгидратазы, полученный путем клонировани€ гена нитрилгидратазы, происход€щего из Pseudomonas chlororaphis-B23, со следующей нуклеотидной последовательностью, приведенной в описании изобретени€.
2. –екомбинантна€ плазмидна€ ƒЌ  pPCL4, кодирующа€ полипептид, обладающий активностью нитрилгидратазы, размером 9,574 т.п.о., содержаща€ Sph1 - Sal1-фрагмент нуклеиновой кислоты, кодирующий полипептид, обладающий свойствами нитрилгидратазы из Pseudomonas chlororaphis-B23 размером 6,9 т.п.о., Sal1 - Sph1-фрагмента ƒЌ  вектора pUC19, размером 2.674, т.п.о., уникальные сайты рестрикции: два сайта Sal1, по одному сайту Sph1, Bam H1, Sac1, Bgl1, Hinc11, генетические маркеры Ampr - ген устойчивости к ампициллину.
3. Ўтамм бактерий Escherichia coli FERM BP-2779 - продуцент полипептида, обладающего активностью нитрилгидратазы.
4. —пособ получени€ нитрилгидратазы, заключающийс€ в том, что культивируют штамм бактерий Escherichia coli FERM BP-2779 и извлекают нитрилгидратазу из культуральной среды.