Главная страница  |  Описание сайта  |  Контакты
СПОСОБ ОПРЕДЕЛЕНИЯ B-ЛИМФОЦИТОВ, ПРОДУЦИРУЮЩИХ IGE
СПОСОБ ОПРЕДЕЛЕНИЯ B-ЛИМФОЦИТОВ, ПРОДУЦИРУЮЩИХ IGE

СПОСОБ ОПРЕДЕЛЕНИЯ B-ЛИМФОЦИТОВ, ПРОДУЦИРУЮЩИХ IGE

Патент Российской Федерации
Суть изобретения: Уникальные антигенные эпитопы JgE (обозначенные ige b1, которые присутствуют на Jg E-продуцирующих B-лимфоцитах) описываются. Один класс igeb эпитопов связывается с ним вблизи FcER-сайта связывания на JgE. Другой класс igeb1 эпитопов ассоциирует с внеклеточным сегментом домена ε цепей, который закрепляет JgE на мембране B клеток emb/ec. Моноклональные антитела, которые связываются с igeb1 эпитопами, используются для лечения аллергических состояний, вызванных JgE. Моноклональные антитела, отдельно взятые или конъюгированные с цитотоксином в качестве иммунотоксинов, могут быть использованы для уменьшения или истощения B клеток, продуцирующих JgE. У лиц, страдающих аллергическими заболеваниями. Моноклональные антитела против идиотипов igeb1 специфических антител или пептидов, экспрессирующих эпитоты, могут быть использованы для активной иммунизации лиц, страдающих аллергическими заболеваниями с тем, чтобы добиться таких же результатов как при лечении моноклональными антителами. 1 з.п.ф-лы, 3 ил. 7 табл.
Поиск по сайту

1. С помощью поисковых систем

   С помощью Google:    

2. Экспресс-поиск по номеру патента


введите номер патента (7 цифр)

3. По номеру патента и году публикации

2000000 ... 2099999   (1994-1997 гг.)

2100000 ... 2199999   (1997-2003 гг.)
Номер патента: 2047177
Класс(ы) патента: G01N33/48
Номер заявки: 4895362/14
Дата подачи заявки: 29.12.1988
Дата публикации: 27.10.1995
Заявитель(и): Тэнокс Биосистемз, Инк. (US)
Автор(ы): Тсе-Вен Чанг[TW]; Билл Сан[US]; Сесили Сан[US]
Патентообладатель(и): Тэнокс Биосистемз, Инк. (US)
Описание изобретения: Гиперчувствительность среднего типа такая, как экзогенная астма, сенная лихорадка и аллергические ответы на определенную пищу и лекарства, опосредована первично иммуноглобулином Е(IgE). При IgE-опосредованном аллергическом ответе аллерген связывается с IgE на поверхности тучных клеток и базофильных лейкоцитов (базофилов). Это связывание вызывает перекрестное сшивание молекул IgE и, следовательно, подлежащих рецепторов Fc части IgE(FcER), т.е. "включает" высвобождение фармакологических медиаторов, таких как гистамин, медленно влияющее вещество анафилаксиса и серотонин. Высвобождение этих продуктов тучных клеток и базофилов вызывает различные патологические проявления аллергии.
Пациентов, пораженных IgE-опосредованными реакциями гиперчувствительности, часто обрабатывают антагонистами гистамина для смягчения симптомов. Кроме того, во время сезонов сенной лихорадки используются процедуры понижения чувствительности для предупреждения или смягчения устойчивых, длящихся аллергических реакций. При этих процедурах инъецируются периодически малые дозы аллергена для индуцирования некоторых не до конца понятных иммунных ответов, которые как-то снижают IgE-опосредованные ответы. Процедуры снижения чувствительности эффективны для некоторых пациентов и лишь незначительно эффективны для других.
Было представлено, что IgE-опосредованная аллергия может лечиться предотвращением связывания IgE c тучными клетками и базофилами. Например, синтетические пептиды, представляющие различные районы IgE(FcE) были исследованы в качестве конкурентных ингибиторов связывания IgE c рецепторами на тучных клетках и базофилах (Molec. Immunol. 21: 1190, 1984; там же, 23: 1231-1235, 1986; там же, 24: 379-389, 1987; Patent N 4683292, Hahn V.S. Patent N 4171299 и 4161522, Hamburger U.S.).
Однако, предположительно из-за намного меньшего средства этих пептидов к FcER по сравнению с целым IgE, такие пептиды не оказались высоко эффективными в лечении аллергии.
В последние годы для картирования различных антигенных и функциональных эпитопов IgE применялись методологии моноклональных антител. Известно, что среди нескольких моноклональных антител крысы, полученных против IgE, три подавляли связывание IgE мыши с базофильными клетками крысы. (Baniyash and Eshkar. Eur. J. Immunol. 14:799-807, 1984). Поскольку антитела могли также вызывать высвобождение серотонина из базофилов, связанных с IgE, антитела предположительно связывали сайты на Fc, расположенные около, но не в сайте связывания с рецепторами IgE на базофилах. Позже было получено моноклональное антитело, которое могло подавлять связывание IgE с базофильными клетками, но не узнавало IgE на поверхности базофила. Известно, что среди приблизительно 10 моноклональных антител мыши, полученных против IgE человека, несколько не могли связывать IgE на базофилах (Baniyash et.al. Molec. Immunol. 25:705, 1988; Sirayanian and Colleagues. Fed. Proc. 40:965, 1981; Fed. Proc. 46:1346, 1987). Известно также, что некоторые из этих последних моноклональных антител могли подавлять связывание IgE человека с базофилами. Эти исследования относили использование моноклональных антител к определению различных эпитопов или функционально отнесенных пептидных сегментов на IgE.
Известен иммунотоксин, специфический для изотопа IgE и его использование в лечении аллергии. Иммунотоксин представлял собой анти-IgE антитело, связанное с токсином. Подразумеваемый фармакологический механизм лечения таков, что иммунотоксин, специфичный для изотопа IgE, будет убивать IgE-продуцирующие В клетки.
Изобретение относится к уникальным антигенным детерминантам на молекулах IgE и к реагентам и методам лечения IgE-опосредованной аллергии, основанного на открытии этих детерминант. Антигенные детерминанты присутствуют на IgE-продуцирующих В-лимфоцитах (В клеток), но не на базофилах и тучных клетках.
Хотя IgE продуцируется только IgE-продуцирующими В клетками, он присутствует не только на этих клетках, но также на тучных клетках и базофилах. IgE имеет очень высокое сродство к FeER на поверхности базофилов и тучных клеток (константа ассоциации Ка находится в пределах 109-1010 л ˙моль-1), и скорость диссоциации очень мала (полупериод жизни около 20 ч). Таким образом, IgE фактически является поверхностным антигеном базофилов и тучных клеток.
Антигенные эпитопы IgE изобретения присутствуют на IgE-продуцирующих В клетках, но не базофилах или тучных клетках и из-за этого эпитопы являются уникальными поверхностными маркерами IgE-продуцирующих В клеток. Эпитопы могут быть обозначены ige, bl (bl обозначает В лимфоциты). IgE на В клетках мембраносвязанная форма, которая заякорена в мембране пронизыванием липидного бислоя мембраны. IgE на базофилах и тучных клетках секреторная форма, которая заякорена на поверхности клеток связыванием с молекулами FcER. Общие структуры двух форм IgE слегка различных тем, что мембраносвязанная форма имеет дополнительный сегмент. Топография связи с поверхностью клетки также различна у IgE на В клетках и на базофилах. Один класс эпитопов ige.bl расположен в Fc районе молекулы IgE или около сайта связывания FcER. Эти эпитопы маскируются связыванием FcER. Другой класс эпитопов ige.bl антигенные эпитопы, которые заключают части внеклеточного сегмента мембраносвязанного района тяжелых цепей иммуноглобулина Е. В общем, эти сегменты различных мембраносвязанных иммуноглобулинов могут быть обозначены mb/ic. Сегмент mb/ec IgE может быть обозначен как сегмент ∈mb/ec. Изобретение относится к определению последовательности сегмента.
Идентификация эпитопов ige.bl обеспечивает различные формы лечения и диагностики IgE-опосредованной аллергии, основанные на агентах, которые специфически связываются с эпитопами. Они включают аллергические болезни, такие как экзогенная бронхиальная астма, аллергический насморк или сенная лихорадка, и аллергии на пищу лекарства. Предпочтенные агенты, которые специфически связываются с эпитопами, это моноклональные антитела или их фрагменты. Однако для целей терапевтических методов изобретения специфический связывающий агент может быть любой молекулой, которая специфически связывается с эпитопами и таким образом связывает IgE-продуцирующие В клетки, но не базофилы. Эти реагенты включают синтетические пептиды, которые идентичны или аналогичны антигенсвязывающему району (вариабельный гипервариабельных районов) анти- ige.bl антител. Хотя описание ниже сфокусировано в основном на анти-ige. bl. антителах, концепция и методологии в равной степени применимы к другим молекулам, специфичным к описанным здесь уникальным эпитопам.
Моноклональные антитела, специфичные к эпитопам ige.bl. могут быть использованы для избирательного разрушения IgE-продуцирующих клеток. Поскольку эпитоп присутствует на IgE-продуцирующих В клетках и отсутствует на тучных клетках или базофилах, моноклональные антитела, специфичные к эпитопу ige. bl. связывают В клетки, но не тучные клетки или базофилы. Это дифференциальное связывание делает возможным мечение и селективную элиминацию IgE-продуцирующих В клеток. Антитела в свободной или токсинсвязанной форме могут быть использованы для мечения и уничтожения В клеток. Моноклональные антитела специфичные к эпитопу ige.bl. в или около сайта связывания с IgE могут иметь дополнительный терапевтический эффект. Антитела связывают IgE, образуя иммунные комплексы, облегчая удаление IgE на иммунной системы ретиэндотелиальной системы.
Изобретение также относится к паратоп-специфическим, антиидиотипическим антителам среди антител, реактивных по отношению к ige.bl. эпитопам, к пептидам, созданным по образцу эпитопов (например, сайта связывания FcER) и к использованию антиидиотипических антител и пептидов для лечения IgE-опосредованных аллергических болезней.
На фиг. 1 представлена схема процесса определения mb/ec сегмента IgE человека (∈.mb/ec); на фиг.2 пробы ДНК, используемые для скрининга библиотеки кДНК на клоны, содержащие ∈mb/ec; на фиг.3 С-конец СН4домена Е-цепи человека и расположение проб b и d.
Уникальные эпитопы иммуноглобулина Е
Изобретение основано на открытии уникально расположенных эпитопов IgE (ige. bl). Эпитопы присутствуют на IgE-продуцирующих В лимфоцитах, но не на тучных клетках и базофилах. Один класс эпитопов ige.bl. расположен в или около сайта связывания FcER. Присутствие этих эпитопов только на IgE-продуцирующих В клетках следствие того факта, что эпитоп маскирован, когда IgE связан с FcER на базофилах и тучных клетках. Эпитопы ige.bl. возможно могут состоять из нескольких антигенодискретных сайтов и каждый из них может быть определен по его реактивности с моноклональным антителом, которое реагирует с IgE-продуцирующими В клетками человека, но не базофилами, такими как Е8-5-3, Е11-4-70, Е101-1 и Е10-12-55.
Другой класс эпитопов ige.bl. эпитопы ∈.mb/ec. Эти эпитопы присутствуют на мембраносвязанной форме иммуноглобулина, но не на секретированной форме. В клетки экспрессируют на своей поверхности молекулы антител, таких как IgE, которые служат рецепторами для антигенов в течение иммунологической индукции. Мембраносвязанные иммуноглобулины отличаются от секреторных растворимых иммуноглобулинов, синтезированных теми же клетками, тем, что они имеют дополнительный пептидный кусок, который заякоривает их на поверхности В клеток. Все 10 мембранно-связанных на В клетках иммуноглобулинов из различных видов, для которых была определена аминокислотная последовательность, имели дополнительные изотопоспецифические районы, которые заякоривают иммуноглобулины на мембране. Эти пептидные районы имеют длину в пределах 41-72 аминокислоты и могут быть разделены на три сегмента в отношении расположения относительно плазматической мембраны. Средние сегменты из 25 гидрофобных и незаряженных аминокислотных остатков расположены в липидном бислое мембраны, С-концевые гидрофильные сегменты из 2-28 аминокислотных остатков внутриклеточные. Сегменты в направлении к N-концу содержат 13-27 аминокислотных остатков, сильнокислотны и гидрофильны и находятся на внеклеточной поверхности плазматической мембраны. Эта часть мембраносвязанного района IgE мыши и крысы содержит 19 аминокислотных остатков, из которых 10 остатки Глу или Асп. Длина, гидрофильность и сильная заряженность внеклеточного сегмента указывает, что этот сегмент экспонирован и доступен антителам.
Поскольку IgE присутствует на поверхности лишь трех типов клеток тела, IgE-продуцирующих В клеток, базофилов, а также тучных клеток, эпитопы ige. bl. являются фактически уникальными маркерами клеточной поверхности IgE-продуцирующих В клеток. Эти новые маркеры обеспечивают несколько типов основанной на моноклональных антителах терапии IgE-опосредованных аллергических болезней.
Моноклональные антитела, которые связывают IgE-продуцирующие В клетки, но не базофилы.
Моноклональные антитела, специфичные к эпитопам ige.bl. связывают IgE на поверхности IgE-продуцирующих В клеток, но не связывают базофилы. Это дифференциальное связывание IgE-продуцирующих клеточных типов обеспечивает основу терапевтических и диагностических применений антител.
Важно, что антитела не связывают базофилы и не индуцируют высвобождение гистамина. Один из наиболее мощных агентов, "включающих" высвобождение фармакологических медиаторов аллергии из тучных клеток и базофилов, анти-IgE антитело. Общепринятые анти-IgE антитела связывают IgE на поверхности тучных клеток и базофилов и вызывают высвобождение фармакологических медиаторов аллергии. Антитела, рассматриваемые в изобретении, не могут связывать IgE на этих клетках, поскольку сродственный эпитоп маскирован и, таким образом, они не могут индуцировать высвобождение гистамина из этих клеток.
Терапия IgE-опосредованной аллергии, основанная на селективном уничтожении IgE-продуцирующих клеток
Антитела, специфичные к IgE-продуцирующим В клеткам, как мышиные, человеческие или мышь/человек химерные антитела, могут быть применены различными способами для лечения IgE-опосредованных аллергий. Для этой цели антитела могут быть использованы для селективного истощения IgE-продуцирующих В клеток. Антитела могут быть использованы как эффекторные агенты, опосредующие иммунную функцию, или как несущие агенты для токсинов или цитотоксических лекарств для доставки эффекторного вещества.
Среди различных иммунных функций, которые может опосредствовать антитело, специфичное к поверхностному антигену на клетки-мишени, находится антитело и комплемент-опосредованный цитолиз и антитело зависимая клеточная цитотоксичность (АDCC). Антитело может также опосредовать иммунные регуляторные функции. Антитела некоторых субклассов IgG, такие как IgG2 мыши и IgG1 и IgG3 человека, могут опосредовать ADCC, осуществляемую некоторыми Fc рецептор-продуцирующими фагоцитирующими лейкоцитами. Например, ОКТЗ, моноклональное антитело мыши специфичное к поверхностному антигену Т-клеток человека (первое моноклональное антитело, санкционированное для продажи в качестве терапевтического агента) применялось к пациентам для получения быстрого истощения Т-клеток в крови и индукции иммуносупрессированного состояния (для трансплантации почки).
ОКТЗ в дозах 5 кг/день субъект может полностью истощать циркулирующие Т-клетки. Антитела, представленные в изобретении, в особенности в виде гамма-2 антител мыши или химерных антител, несущих гамма-1 или гамма-3 цепи человека, могут быть использованы для истощения IgE-продуцирующих В клеток по механизму ADCC. Антитела могут применяться в виде свободных антител пациентам, пораженным IgE-опосредованной аллергией в количествах, достаточных для существенного элиминирования IgE-продуцирующих клеток и, следовательно, для существенного истощения IgE. Например, количество может варьировать в пределах 1-50 мг(доза) субъект. Лечение может включать одну или несколько инъекций. Длительность присутствия антитела и количество антитела, необходимого для уничтожения В клеток меньше того, которое необходимо для длительного подавления связывания IgE c базофилами и тучными клетками.
Для описанных терапевтических применений наиболее предпочтительны человеческие антитела. Антитела человека, однако, трудно производить в больших количествах. В качестве альтернативы предпочтительны химерные или "околочеловеческие" антитела. Химерные антитела представляют собой вариабельный или антиген, связывающий (гипервариабельный) или определяющий комплементарность (район, полученный из животного, например мышиного) антитела и остальных районов, полученных из антитела человека.
Способы получения химерного (например, мышь/человек) антитела описаны ниже. Химерные антитела могут быть получены в больших количествах и они менее иммуногенны для людей, чем нечеловеческие антитела. Следовательно, они более удобны для применения in vivo, чем антитела животных, особенно, когда необходимо повторное или длительное применение. Также могут быть использованы фрагменты химерных антител.
Иммунотерапии, использующие антитела изобретения, могут быть использованы в комбинации с общепринятой иммунотерапией снижения чувствительности. Например, снижение чувствительности при помощи аллергена может быть проведено в сочетании с применением анти-ige.bl. антител или иммунотоксинов для существенного уничтожения IgE-образующих клеток. Эффект понижения чувствительности состоит в том, что против аллергена (иммуногена) индуцируются IgG. Индукция ответа IgG может быть более эффективна, когда IgE-образующие клетки существенно истощены. IgE-продуцирующие В клетки могут быть временно истощены (на несколько недель или месяцев) анти-ige.bl. антителами и в конечном счете их популяция восстановится. Понижение чувствительности может иметь более длительное действие.
Иммунотерапия, объединяющая ige.bl.-специфические антитела и фактор, усиливающий ADCC.
Такие факторы, как GM-CSF (фактор, стимулирующий колонии гранулоцитных моноцитов) или M-CSF (фактор, стимулирующий колонии моноцитов), как известно, индуцируют пролиферацию лейкоцитов, включая те, которые опосредуют ADCC. В экспериментах in vitro было показано, что GM-CSF увеличивают активность ADCC на опухолевых клетках, опосредованную моноклональными антителами, специфичными к поверхностным антигенам, экспрессированным на поверхности опухолевых клеток. Возможно, терапевтический эффект ige.bl. специфических моноклональных антител в лечении аллергий может быть усилен комбинацией с использованием факторов, которые увеличивают активности.
Иммунотоксины, специфичные к IgE-продуцирующим клеткам.
Эпитопы ige. bl. обеспечивают высокоспецифичные мишени для иммунотоксинов, направленных против IgE-образующих В клеток. Иммунотоксины, специфичные к эпитопам, связываются с IgE-продуцирующими В клетками, но не с тучными клетками или базофилами. Таким образом, IgE-продуцирующие В клетки могут быть избирательно истощены или уничтожены у пациента, страдающего от IgE-опосредованной аллергии. Снижение числа IgE-продуцирующих клеток снижает уровни IgE в циркуляции, что приводит к уменьшению количества IgE, могущего связаться с тучными клетками и базофилами. Иммунотоксин не убивает тучные клетки или базофилы и не вызывает высвобождения фармакологических медиатов из этих клеток.
Иммунотоксины для избирательного связывания с IgE-продуцирующими лимфоцитами состоят из цитолитических или цитотоксических агентов, соединенных со связывающимся агентом, специфичным к ige.bl. эпитопу. Предпочтительные специфически связывающиеся агенты анти-ige.bl. антитела или их фрагменты, например, F(ab)2', Fab, Fv или их аналоги или производные. Цитолитические агенты могут быть выбраны среди любых из доступных веществ, включая рицин, токсин Psewdomonas, дифтерийный токсин, антивирусный пептид лаконоса, трихотецены, радиоактивные нуклиды и мембранолитические ферменты. Антитело и цитотоксин могут быть связаны химическими или генно-инженерными методами.
Иммунотоксины применяются к пациенту, страдающему IgE-опосредованной аллергией, в количествах, достаточных для уменьшения количества или уничтожения IgE-образующих лимфоцитов у пациента и т.е. предотвращения или смягчения симптомов IgE-опосредованной аллергии. Иммунотоксины могут быть использованы сами по себе или в комбинации со свободными анти-IgE антителами.
Удаление IgE моноклональными антителами, которые не связывают IgE на базофилах и тучных клетках
В конкретных воплощениях моноклональные анти-IgE антитела изобретения связываются с эпитомом ige.bl. расположенным в или около сайта связывания FcER на растворимом IgE. При этом антитела блокируют для тучных клеток и базофилов сайт связывания на IgE и это вносит частичный вклад в их терапевтическую эффективность. Для достижения этого возможно выигрышного дополнительного терапевтического механизма антитела должны специфически связываться с эпитопом со сродством, которое больше, чем сродство связывания FcER c IgE. Эта комбинация специфичности и сродства обеспечивает эффективное подавление связывания IgE c Fc ER при фармацевтически возможной концентрации. Кроме того, иммунные комплексы IgE и моноклональных антител могут быть быстро удалены клетками ретикулоэндотелиальной системы. После внутривенной инъекции моноклональных антител большинство молекул IgE в циркуляции возможно образуют иммунные комплексы и быстро удаляются. Эти механизмы снижают уровни свободного IgE в теле обработанного пациента, когда терапевтические моноклональные антитела присутствуют в достаточных количествах. Эти различные механизмы вносят вклад в краткосрочные эффекты терапевтических антител. Однако, терапевтические эффекты длительного действия, возможно, могут быть достигнуты без этих механизмов. Поскольку IgE быстро выводится и регенерирует, имея время полужизни в сыворотке три дня, основанная на ige.bl. антителах терапия возможно более эффективна путем уменьшения количества или постепенная IgE-продуцирующих В клеток.
Сродство может быть представлено константой сродства или ассоциации Ка. FcER на тучных клетках и базофилах имеет Ка по оценкам в пределах 1 х 109-1 х 1010 л/моль (New Frends in Allergy II ed. by Ring, J. and Brerg. b. p. 25-32, Spring-Verlag, N-Y. 1986).
Таким образом, моноклональное анти-IgE антитело будет эффективно конкурировать с FcER, если его константа сродства к IgE порядка 1 х 109л/моль или более. В общем, моноклональные антитела имеют Ка ниже 109л/моль. Следовательно, хотя антитело может быть достаточно специфично к описанному эпитопу (ам) и удобно для уничтожения IgE-несущих В клеток по описанному выше механизму, оно не может иметь этот дополнительный терапевтический эффект, если оно не имеет Ка достаточной для эффективной конкуренции с FcER за IgE при фармакологически допустимых концентрациях.
В предпочтенных воплощениях моноклональные анти-IgE антитела изобретения имеют Ка к IgE, которая сравнима или больше, чем сродство FcER и IgE. Тучные клетки и базофилы в теле связаны с IgE, у большинства индивидуумов большая часть FcER насыщена IgE. Молекулы IgE имеют очень длинное время полужизни "на" (занимание рецептора) порядка 20 ч.
Когда молекулы IgE диссоциируют с тучными клетками или базофилами, высокое сродство анти-ige.bl. антител, примененных к пациенту, тесно связывает их и предотвращает их реассоциацию с FcER. Поскольку молекулы IgE имеют большое время "на" и медленно диссоциируют от базофилов и тучных клеток, терапевтический эффект, возможно, будет достигнут лишь несколькими днями позже обработки (или даже более), когда существенная часть IgE на базофилах и тучных клетках уже диссоциирует от FcER и образует комплексы или будет убрана анти-IgE антителом. Когда это достигнуто, плотность молекул IgE, связанных с FcER молекулами на базофилах и тучных клетках, существенно понижена, и следовательно, аллергены не способны перекрестно реагировать с существенными количествами FcER для индукции гистамина.
Диагностические использования антител, специфически связывающихся с IgE-продуцирующими клетками
Антитела против эпитопов ige. bl, такие как продуцируемые TES С-2 CRL 10706, депонированные в АТСС, могут быть использованы для идентификации и оценки числа IgE-образующих лимфоцитов в смешанных популяциях лейкоцитов. Эти антитела, включая TES C-2, могут быть использованы для этой цели в стандартных анализах для определения сигналов клеточной поверхности. В качестве примера такого анализа антитело контактирует с образцом тестируемых лейкоцитов при условиях, позволяющих антителу связываться с IgE-образующими клетками в образце. Клетки затем проверяют на связывание антител. Это может быть осуществлено применением общепринятых процедур окрашивания клеток. Например, флуоресцентно-меченое вторичное антитело может быть использовано для детектированного связывания антитела TES C-2 c B клетками.
Антиидиотипические антитела и способы активной иммунизации против IgE
ige, bl. -специфические моноклональные антитела могут быть использованы для образования паротоп-специфических, антиидиотипических антител, которые делают возможным иной образ лечения IgE-опосредованной аллергии. Антитела против паротипа ige.bl.-специфических антител конформационно напоминают эпитоп, к которому специфично анти-IgE антитело, т.е. они напоминают ige.bl. эпитоп. Эти антиидиотипические антитела могут быть использованы для активной иммунизации против ige.bl. и индукции эндогенного образования антител против ige. bl. эпитопа. Индуцированные антитела опосредуют различные терапевтические эффекты ige.bl.-специфических антител.
Поскольку IgE "своя молекула", он в общем не иммуногенен. Однако, активная иммунизация против IgE может быть достигнута при использовании паротоп-специфичных антител изобретения. Паротоп-специфичное антитело демонстрирует конформационное сходство с антигеном-эпитопом ige.bl. что может вызывать иммунный ответ у людей против эпитопа.
Паротоп-специфические антиидиотипические антитела применяются к пациенту, страдающему от IgE-опосредованной аллергии в иммуногенном количестве для индукции образования антител к ige.bl. Антиидиотипические антитела предпочтительно применяются в виде химерных антител. Они могут быть также применены как фрагменты антител, которые также могут быть химерными по природе или аналогов.
Пептиды, блокирующие FcER на тучных клетках и базофилах
Изобретение также обеспечивает пептиды, воплощающие эпитопы ige.bl. на растворимом IgE. Эти пептиды представляют собой аминокислотные последовательности, которые идентичны или эквивалентны аминокислотной последовательности эпитопа ige.bl. на растворимом IgE. Например, пептиды могут иметь последовательности, соответствующие эпитопам, определяемым антителами Е8-5-3, Е11-4-70, Е101-1 и Е10-12-55 или другими анти-ige.bl. антителами, описанными ниже. Пептиды, соотносящиеся с сайтом связывания FcER, могут быть использованы для блокирования связывания IgE c тучными клетками и базофилами.
Пептидные аналоги ∈ mb/ec и активная иммунизация против ∈mb/ec эпитопа
Несмотря на то, что человеческий пептид ∈ mb/ec возможно не иммуногенен для людей, пептид с той же последовательностью и аминокислотными заменами может быть иммуногенен и индуцировать антитела, которые перекрестно реагируют с аутентичным эпитопом ∈. mb/ec. Эти аналоги пептида ∈. mb/ec могут быть применены к пациентам, страдающим IgE-опосредованными аллергиями. Антитела, индуцированные этой активной иммунизацией, могут функционировать как антитела, описанные здесь.
Заякоривающийся пептидный кусок иммуноглобулинов, связанных с мембраной В клеток
В клетки экспрессируют на своей поверхности молекулы антител, служащие рецепторами антигенов при иммунологической индукции. Мембраносвязанные иммуноглобулины отличаются от секреторных иммуноглобулинов, синтезированных теми же клетками, тем, что они имеют дополнительные пептидные участки, которые заякоривают молекулы иммуноглобулинов на клеточной поверхности.
Были получены данные об аминокислотной последовательности 10 мембраносвязанных иммуноглобулинов из разных видов. Эти последовательности обозначают конкретные общие черты пептидного участка, связанного с плазматической мембраной. Как показано в табл. 1, пептидный якорный участок имеет 3 сегмента, различимых, основываясь на их расположении относительно плазматической мембраны. Несмотря на то, что эти пептидные участки короткие, равные 41-72 аминокислотных остатка, и на них часто ссылаются как на мембраносвязанный домен, пептиды не находятся полностью в липидном бислое мембраны. Фактически лишь 25 аминокислотных остатков, в основном гидрофобных остатков и остатков серина и треонина, расположенных в средней части пептидов, находятся в липидном бислое. С-концевые гидрофильные сегменты из 3-28 аминокислотных остатков расположены на цитоплазматической стороне мембраны. Сегменты ближе к N-концу, которые соединены с 3-м или 4-м константными доменами тяжелых цепей иммуноглобулина (СН3 или СН4) весьма гидрофильны и находятся на внеклеточной стороне плазматической мембраны.
Наименьшая длина внеклеточного сегмента мембраносвязанных участков иммуноглобулинов, обозначенных mb/ec сегменты, составляет 13 аминокислотных остатков μ цепи мыши и кролика (см. табл. 2). Сегменты mb/ec всех иммуноглобулинов содержат высокую долю заряженных аминокислотных остатков, практически целиком кислотных остатков. Процентное содержание заряженных аминокислотных остатков и полярных гидрофильных остатков очень высок для аминокислотного состава mb/ec сегмента (табл. 3). Эти параметры указывают, что все mb/ec сегменты экспонированы и достаточно длинны для того, чтобы быть доступными антителам. Изучение эволюции тяжелых цепей иммуноглобулинов показывает, что ∈ и γ цепи ближе друг к другу (имеют более позднего общего предшественника), чем к другим цепям (Lin.L.C. and Putman F.W. Proc. Natl. Acad. Sci. USA). Кроме того, тяжелые цепи эволюционировали раньше, чем эволюционировали различные виды млекопитающих, мыши, крысы, и люди. Таким образом, среди 10 различных сегментов mb/ec, которые были определены, скорее всего именно мышиный или крысиный ∈ mb/ec. наиболее близок к человеческому ∈mb/ec, последовательность которого пока не сообщалась. Следующее наиболее родственное γ цепи. Мышиный или крысиный ∈mb/ec. имеют 19 аминокислотных остатков, среди них 8 остатков глутамина и 2 аспарагина. Эти данные также дают уверенность, что сегмент ∈.mb/ec. человека экспонирован и доступен антителам.
Определение аминокислотной последовательности сегмента mb/ec IgE человека / ∈.mb/ec/ сегмента
Ряд хорошо обоснованных процедур может быть применен для определения последовательности ДНК, соответствующей ∈.mb/ec сегменту человека. При одном подходе (фиг.1) исходная точка получение мРНК линии клеток миеломы человека, экспрессирующей IgE на поверхности. Для этой цели могут быть использованы клетки SK007. Имея препарат мРНК, можно создать библиотеку кДНК, используя вектор клонирования на основе фага или плазмид. Предпочтительный метод конструирования библиотеки кДНК с применением набора Системы Конструирования Библиотеки кДНК Kit-Librarian I, разработанного и продаваемого Invitrogen (San.Diego.C.A.). Обеспечивается постадийное детальное руководство для выделения РНК из клеток, обратной транскрипции, синтеза второй цепи, лигирования линкера, фракционирования кДНК в агарозном геле, электроэлюции для очистки кДНК, лигирования вектора и трансформации в E.coli. В данной библиотеке использовался вектор pCDM8.
Несколько проб может быть использовано при скрининге библиотеки кДНК на клоны, содержащие ∈. mb/ec сегмент. Библиотека может быть скринирована ДНК пробой а (фиг.2), которая имеет длину 1.1 т.п.н. и является кДНК U266, покрывающей большую часть длины мРНК ∈ (не мембраносвязанный сегмент). Позитивные клоны, включающие как секретированную, так и мембранно-связанную формы, могут быть различны путем использования дополнительных проб. Проба b получена принятием весьма вероятной возможности, что конец домена СН4 прерван в ∈ цепи человека в мембраносвязанной форме. Прерывание происходит, когда перемещаются генные сегменты домена СН4 и мембраносвязанного домена. Потеря С-концов происходит с мембраносвязанными формами иммуноглобулинов, включая ∈ и μ содержащих СН4 домены. Из опубликованной информации о нуклеотидной последовательности домена ∈. СН4 человека следует, что наиболее вероятный донорный сайт пласинга внутрикодоновый GT, 71 п.н. к 5'-концу от терминирующего колона TGA. Другой GT, не являющийся внутрикодоновым и менее вероятно являющийся донорным сайтом оплайсинга, ближе к концу (24 п.н. к 5'-концу от терминирующего колона).
Специфическое расположение пробы b представлено на фиг.2 и 3. Проба должна реагировать с секретированной формой гена цепи и не реагировать с мембранной формой гена цепи.
Создание пробы с основано на обнаружении того, что трансмембранный сегмент мембраносвязанного домена (mb/tm сегмент) весьма консервативен среди всех секвенированных генов иммуноглобулинов. Существует сегмент пептида и соответствующая ему кодирующая ДНК в пределах этого сегмента mb/tm, которые практически идентичны среди всех иммуноглобулинов. Как показано в табл. 4, консенсусная последовательность ДНК с восемью комбинациями используется как проба с. Фиг.2 демонстрирует расположение пробы.
Проба d, представляющая собой сегмент, расположенный по ходу транскрипции относительно наиболее вероятного донорного сайта сплайсинга GT, состоит из 36 п.н. (фиг.2 и 3). Эта проба должна реагировать с геном ∈ цепи как секретированной, так и мембраносвязанной форм.
Табл. 5 суммирует образцы реактивностей клонов, содержащих ∈ генов секретированной или мембраносвязанной форм с 4 пробами.
Размер библиотеки, необходимой для клонирования мембранно-связанной ∈ цепи, зависит от того, насколько обильна мРНК. Если предположить, что секретированный IgE составляет 0,1% поли (А)+ РНК SK007, то размер библиотеки должен быть около 5000 независимых рекомбинантных клонов для выделения позитивного клона с 99% вероятностью. В IgE-продуцирующих клетках иммуноцитомы крысы Ig2 и Ig162 мРНК мембраносвязанной формы ∈ цепи, как было обнаружено, составляет более 2% секретированной формы. Если предположить, что это соотношение мембрано-связанной и секретированной форм ∈ цепей остается верным для IgE-образующих клеток человека SK007, то размер библиотеки кДНК, необходимой для выделения мембраносвязанной ∈ цепи, составляет около 250000. В предпочтенной процедуре большое количество клонов подвергалось скринингу, а именно 1000000.
Альтернативой общепринятому подходу создания библиотеки кДНК и скрининга клонов, представляющих типы мРНК клетки, является амплификация мРНК для получения высокой доли соответствующей им ДНК. Образовавшаяся ДНК затем может быть очищена гель-электрофорезом и подвергнута секвенированию. Методология, на которую ссылаются как на амплификацию посредством полимеразной цепной реакции (PCR), установилась в последние несколько лет, и были коммерциализированы полные системы, включая реагенты и оборудование. Одна предпочтительная система поставляется Perkin Elmer Cetus (Norwalk ст.). Набор реагентов Gene Amp. DNA Amphfication Reagent Kit и оборудования DNA Thermal Cycler.
Некоторые из специфических реагентов, использованных в этом подходе, те же, что используются для клонирования библиотеки кДНК. Поскольку никакой последовательности в мембраносвязанном сегменте ∈ цепи не было определено, стратегия заключается в амплификации как секретированной, так и мембраносвязанной форм ∈ цепей. Используются два праймера, один из которых олиго-dT/25-30-меры) и другой олигомер, соответствующий пробе d (фиг.2 и 3). Проба d расположена ближе к 5-концу от наиболее возможного донорного сайта сплайсинга, и таким образом праймирует как секретированную, так и мембраносвязанную форму ∈ мРНК и ДНК. После существенной амплификации две популяции фрагментов ДНК разрешаются гель-электрофорезом. Секретированная форма ∈ цепи может быть узнана по ее реактивности с пробой b. Очищенные ДНК подвергаются затем ДНК-секвенированию.
Амплификация PCR представляется более эффективной процедурой, чем клонирование кДНК для мРНК, бедно представленных в наборе поли(А)+-РНК, кДНК цепи U 266 может быть использована для выработки неких предварительных условий отжига между матричной ДНК и олигопраймерами.
Другим подходом к получению клона ДНК, содержащего гены, кодирующие мембраносвязанные сегменты, является скрининг геномной библиотеки ДНК человека. Геномная библиотека ДНК человека легко доступна. Предпочтительный источник библиотека, сконструированная с использованием клеток фибробластов легкого W 138, поставляемая Stratogene (La Jolla, CA). Гены заключены в λ вектор и ДНК вставки имеет средний размер 15 т.п.н. Идентификация клонов может быть достигнута гибридизацией с ДНК клона кДНК U 266. Расположение сегмента гена, соответствующего мембраносвязанному району, может быть определено с использованием пробы, полученной из гомологичного мышиного гена трансмембранного сегмента (проба с на фиг.2 и в табл.4). Затем определяется последовательность мембраносвязанного сегмента.
Нуклеотидная последовательность ДНК, кодирующей мембранный заякоривающийся пептид ∈ цепи человека
Нуклеотидная последовательность геномной ДНК, заключающей сегменты заякоривающегося в мембране пептида мембраносвязанной ∈ цепи человека определена и показана ниже с выведенной аминокислотной последовательностью части заякоривающегося в мембране пептида. Распределение экзонов было сделано путем идентификации нуклеотидов доноров и акцепторов сплайсинга и путем сравнения с опубликованными гомологичными последовательностями мембраносвязанной цепи мыши и иммуноглобулинов других классов. CGCTGCCACTGTGGAGCCGGGAGGGCCTGACTGGCCAG
Акцептор сплайсинга
GTCCCCCAGAG ˙CTG˙ GAC˙ GTG ˙TGC˙ GTG ˙ GAG˙ GAG˙ GCC˙ GAG
Glu ˙ Leu ˙ Asp ˙ Val ˙ Cys ˙ Val ˙Glu ˙ Glu ˙ Ala ˙ Glu
GGC˙ GAG˙ GCG˙ CCG˙ TGG˙ ACG ˙TGG ˙ACC˙ GGC˙ CTC ˙TGC˙ ATC˙
Gly ˙ Glu ˙ Ala ˙ Pro ˙Trp ˙ Thr ˙Thp ˙Trr ˙ Gly˙ Leu ˙Cys ˙ IIe Мембраный
экзон I
TTC˙ GCC˙ GCA˙ CTC˙ TTC ˙ CTG˙ CTC˙ AGC ˙ GTG ˙ AGC ˙ TAC ˙ AGC˙
Phe ˙ Ala ˙ Ala ˙ Leu ˙ Phe ˙ Leu˙ Leu ˙ Ser ˙ Val ˙ Ser ˙ Tyr ˙ Ser˙
Донор сплайсинга
GCC˙ GCC˙ CTC˙ ACG˙ CTC ˙CTC˙ ATG˙ GTGGGCACCCACCTCCAGG
Ala ˙ Ala ˙ Leu ˙ Thr ˙ Leu ˙ Leu ˙ Met˙
GGCCCAGCCAGGGCAGGGGGTTGGGCAGAGCAGCAGAGCCCCTGACC Интрон
Акцептор сплайсинга
CACGCCCTCCCCTCAGGTG ˙CAG˙ CGG˙ TTC˙ CTC ˙TCA ˙GCC˙ ACG˙
Val ˙Gln ˙Arg ˙ Phe ˙ Leu ˙ Ser ˙ Ala ˙ Thr˙
CGG˙ CAG˙ GGG ˙AGG ˙CCC˙ CAG˙ ACC˙ TCC˙ CTC˙ GAC˙ TAC˙ ACC˙
Arg ˙ Gln ˙ Gly ˙ Arg ˙ Pro ˙ Gln ˙Thr ˙ Ser ˙Leu ˙ Asp ˙Tyr ˙ Thr ˙ Мембранный
экзон II
AAC˙ GTC˙ CTC ˙ CAG ˙ CCC ˙ CAC ˙ GCC ˙ TAG˙ GCCGCGGGCACTCAC
Asn ˙ Val ˙ Leu ˙ Gln ˙ Pro ˙ His ˙ Ala ˙ end
GCTCCACCAGGCCCAGCTACCC.
Пептид ∈ mb/ec человека определен как первые 14 аминокислоты, кодированных мембранным экзоном 1. Он предшествует блоку из около 25 гидрофобных аминокислот, являющихся трансмембранным районом. Две возможные структуры ∈ mb/ec представлены ниже.
Возможные структуры ∈ mb/ec пептида человека.
Структура 1
Su

Glu-Leu-Asp-Val-Cys-Val-Glu-Glu-Ala1-Glu-Gly-Gly-Ala-Pro.
Структура 2
Glu-Leu-Asp-Val-Cys-Val-Glu-Glu-Ala-Glu-Gly-Glu-Ala-Pro.
Glu-Leu-Asp-Val-Cys-Val-Glu-Glu-Ala-Glu-Gly-Glu-Ala-Pro.
∈ mb/ec пептид может быть использован для индуцирования антител, специфически реагирующих с мембраносвязанным иммуноглобулином Е. Для этой цели пептиды могут быть химически синтезированы с применением обычных методов белкового синтеза. Предпочтительный метод синтезирования пептидов с использованием системы RaMP (Du Pont, Wilmington, DE), которая использует Fmoc химию. С другой стороны, белки могут быть биосинтезированы с применением олигонуклеотидов, кодирующих пептид. Нуклеотидная последовательность дана выше в виде 5'-части мембранного экзона I.
В качестве иммуногенов белки могут быть использованы как в мономерной, так и в димерной структурных формах, показанных выше. Также могут быть использованы пептиды, представляющие собой ∈.mb/ec сегмент человека и прилежащие 4 аминокислоты в домене СН4. Кроме того, могут быть использованы модифицированные пептиды, имеющие существенное иммунологическое сходство. Например, аминокислотная последовательность пептида может быть модифицирована делецией, инсерцией или замещением одной или более аминокислот, которая не искажает существенно иммунологические свойства пептида. Пептиды также могут быть использованы в виде полимеров, где показанная выше аминокислотная последовательность или эквивалентная последовательность является повторяющейся линией полимера.
Выработка моноклональных антител
Моноклональные анти-IgE и антиидиотипические антитела изобретения вырабатываются постоянными (иммортализованными), стабильными, производящими антитела линиями клеток. Предпочтенные линии клеток, продуцирующие антитела, это линии клеток гибридомы и линии клеток миеломы. Линии клеток могут быть любыми клетками, содержащими и способными экспрессировать функционально перестроенные гены, кодирующие вариабельные районы антител легких и тяжелых цепей антител. Предпочтительно линия клеток должна иметь способность сборки цепей в функциональные антитела или фрагменты антител. Таким образом наиболее часто используются лимфоидные клетки, природно продуцирующие иммуноглобулин. Примерами удобных лимфоидных клеток являются вирусно или онкогенно трансформированные лимфоцидные клетки.
Гибридомные клетки, продуцирующие ige,bl специфичные антитела изобретения могут быть получены с использованием стандартной методики соматической гибридизации клеток или сходной процедуры, применяющей отличные агенты для слияния. Процедура состоит в следующем. Моноклональные анти-IgE антитела вырабатываются иммунизацией животного человеческим IgE, или пептидными сегментами человеческого IgE секреторного или мембраносвязанного, которые идентифицированы как возможно компоненты эпитопа ige.bl. Пептиды могут быть синтезированы и конъюгированы с белком -носителем, таким как гемоцианин моллюска (Keyho le) для использования в качестве иммуногена. Затем лимфоидные клетки, например, лимфоциты селезенки) получают из иммунизированных животных и сливают с иммортализованными клетками, например, миеломы или гетеромиеломы, для получения гибридных клеток. Гибридные клетки затем скринируют для выявления тех, которые продуцируют желаемое анти-IgE антитело.
Гибридомы человека, секретирующие человеческое антитело, могут быть получены с использованием методики Kohler and Milstein. Хотя человеческие антитела особенно предпочтительны для лечения людей, в общем получение стабильных человек-человеческих гибридов для длительной выработки человеческого моноклонального антигена может быть трудным. Получение гибридомы на грызунах, особенно мыши, очень хорошо устоявшаяся процедура. Стабильные мышиные гибридомы обеспечивают неограниченный источник антитела, обладающего заданными характеристиками. Мышиные антитела, однако, могут иметь ограниченное применение в лечении людей, поскольку они сильно иммуногенны и сами могут вызвать всплеск аллергических реакций у реципиента. В предпочтенном воплощении изобретения анти-IgE и антиидиотипические антитела производятся в системе, относящейся к грызунам, и превращаются в химерные грызун/человек антитела с использованием устоявшихся методик, описанных детально ниже. Как объяснено выше, эти "околочеловеческие", химерные антитела предпочтительны для применения in vivo особенно в том случае, когда требуются множественные дозы.
Для получения антител, специфичных к ige.bl. эпитопам на растворимом IgE человеческий IgE для иммунизации может быть очищен из человеческой сыворотки. С другой стороны, человеческий IgE может быть произведен культивированием IgE-продуцирующей линии клеток (например, линии клеток U 266, ATCC номер CRL 8033). Человеческий IgE может быть очищен аффинной хроматографией. Мышиные моноклональные антитела, специфичные для человеческого IgE, конъюгируют с подходящей матрицей такой как бромциан-активированная Sepharose 4B для получения IgE-специфичного иммуноадсорбента. Препарат IgE может быть приведен в контакт с иммуноадсорбентом, избирательно адсорбирующим IgE. Адсорбированный IgE может затем быть элюирован существенно в чистом виде с иммуноадсорбента.
В предпочтенных воплощениях животные были иммунизированы с использованием протокола мощной иммунизации в целях получения высокой частоты лимфоцитов, образующих IgE-специфичные антитела. Клетки селезенки получали из иммунизированного животного и сливали с иммортализованными клетками, предпочтительно клетка и миеломы, которые потеряли способность секретировать иммуноглобулин. Известно много удобных линий клеток миеломы. Примером является мышиная миелома NS-1. Слияние клеток селезенки и партнера по слиянию может быть произведено в присутствии полиэтиленгликоля в согласии с установившимися методами. Также могут быть использованы методики электрослияния. Образовавшиеся гибридные клетки клонально культивировали и затем скринировали на выработку анти-IgEr антитела.
Гибридомы, образующие антитела, специфичные к эпитопу, присутствующему на IgE-образующих В клетках и отсутствующему на базофилах и имеющие сродство к IgE, достаточное для блокирования связывания FcER с IgE, могут быть отобраны следующим образом. Гибридомы сначала скринируют на выработку антитела, реактивного с человеческим IgE. Это может быть сделано с использованием связанного с ферментом иммуносорбентного анализа (ELISA), использующего очищенный человеческий IgE, сорбированный на твердой фазе.
Один путь получения в общем высокоаффинных антител заключается в следующем. Твердая фаза для ELISA покрывается очень малым количеством человеческого IgE. Например, если в качестве твердой фазы используется стандартная плата с микроячейками, на каждую ячейку используется около 50 мкл 0,1 мкг/мл раствора IgE. Отбираются гибриды, демонстрирующие сравнительно высокую активность фермента (уровень оптической плотности) в анализе. Супернатанты культур содержат либо относительно большие количества антител, либо антитела с относительно более высоким сродством, либо содержат то и другое одновременно.
Гибридомы затем скринируют на векрецию антител, не реагирующих с базофил-связанным IgE. Предпочтительный способ это скринировать антитела на неспособность индуцировать высвобождение гистамина базофилами. Источник базофилов для такого анализа на высвобождение гистамина лейкоциты крови доноров, чьи базофилы, как известно, очень чувствительны к индукции высвобождения гистамина. Альтернативный и возможно менее чувствительный способ метод иммунофлюоресцентного окрашивания. Базофильные лейкоциты могут быть выделены из крови. Свежевыделенные базофилы имеют на своей поверхности IgE. Моноклональные антитела, которые не связывают базофилосвязанный IgE, специфичны к эпитопу, расположенному в сайте или около него, занятого базофильным (FCER) и таким образом не доступен для моноклональных антител.
Гибридомы, образующие паротоп-специфичные антиидиотипические антитела, могут быть получены иммунизацией животного анти-IgE антителом и скринированием на антитела, которые связывают паротоп-анти-IgE антитело, использованного для иммунизации. Иммунизация приводит к выработке антител против антигенных детерминант анти-IgE антитела, включая идиотип. Антиидиотипические антитела сначала скринируют на их связывание с анти-IgE антителом, но не с другими мышиными антителами. Те, которые являются паротоп-специфичными, скринируются на основании способности антитела конкурировать с человеческим IgE за связывание с анти-IgE моноклональным антителом, использованным для иммунизации.
Фрагменты антител, такие как F(ab')2, Fab и FV могут быть получены стандартными методами ферментативного расщепления. Кроме того, синтетические пептиды, представляющие аналоги Fab и FV, могут быть получены методами генной инженерии.
Химерные анти-IgE антитела состоят из индивидуальных химерных тяжелой и легкой цепей иммуноглобулина. Химерная тяжелая цепь полипептид из двух смежных цепей, имеющих вариабельный район или гипервариабельные районы грызуна (обычно мыши) и константный район тяжелой цепи человека.
Химерные антитела могут быть моновалентны, дивалентны или поливалентны. Моновалентные антитела димеры (HL), образованные из химерной тяжелой цепи, связанной через дисульфидные мостики с химерной легкой цепью. Дивалентные иммуноглобулины тетрамеры (H2L2), образованные из двух ассоциированных димеров. Поливалентные антитела могут быть получены, например, с использованием агрегирующего константного района тяжелой цепи, например, константные районы типа mu.
Вариабельные районы химерных антител происходят из анти-IgE антитела изобретения. Константный район тяжелой цепи может быть выбран из любого из 5 изотипов α δ ε γ или μ. Могут быть использованы тяжелые цепи различных субклассов, таких как субклассы IgG. Различные классы и субклассы тяжелых цепей ответственны за различные эффекторные функции и, таким образом химерные антитела с желаемой эффекторной функцией могут быть получены выбором желаемого константного района тяжелой цепи. Константный район легкой цепи может быть цепью каппа или лямбда.
В общем, химерные антитела вырабатываются путем получения конструкции ДНК, кодирующей каждый из компонентов легкой и тяжелой цепей химерного антитела. Конструкция представляет собой слитый ген, включающий первый сегмент ДНК, который кодирует по крайней мере функциональную часть мышиного вариабельного района, например, функционально перестроенные вариабельные районы со связующим сегментом, связанный со вторым сегментом ДНК, кодирующим по крайней мерке часть человеческого константного района. Каждый слитый ген встраивается или вставляется в вектор экспрессии. Затем реципиентные клетки, способные к экспрессии продуктов гена, трансфецируются генами. Трансфецированные реципиентные клетки культивируют и выделяют экспрессированные антитела.
Гены грызуна, кодирующие вариабельный район легкой и тяжелой цепей, могут быть получены из гибридомных клеток, вырабатывающих анти-IgE антитела. Например, мышиные гибридомные линии клеток, образующие мышиные анти-IgE антитела, являются источником генов вариабельного района.
Гены константных районов могут быть получены из человеческих клеток, продуцирующих антитела, стандартными методами клонирования. С другой стороны, поскольку гены, представляющие 2 класса легких цепей и 5 классов тяжелых цепей, клонированы, константные районы человеческого происхождения легко доступны из этих клонов.
Предпочтительно слитые гены, кодирующие легкую и тяжелую химерные цепи, встроены в вектора экспрессии, которые могут быть использованы для ко-трансфекции реципиентной клетки. Удобные векторы для генных конструкций включают плазмиды типа рВР322, pε MBL и pUC. Каждый вектор содержит два селектируемых гена один для селекции в бактериальной системе и один для селекции в эукариотической системе, причем каждый вектор имеет отличающуюся пару генов. Эти векторы позволяют получение и амплификацию слитых генов в бактериальных системах и последующую ко-трансфекцию эукариотических клеток и селекцию ко-трансфецированных клеток. Примерами селектируемых генов для бактериальной системы являются гены, которые придают устойчивость к ампициллину и ген, который связан с устойчивостью к хлорамфениколу. Примерами селектируемых генов для эукарист являются gpt и neo.
Предпочтенные линии клеток реципиентов клетки миеломы. Клетки миеломы могут синтезировать, собирать и секретировать иммуноглобулины, кодированные трансфецированными генами антител. Они обладают механизмом гликозилирования иммуноглобулинов. Предпочтенные реципиентные клетки это клетки, не продуцирующие Ig клетки миеломы SPL/O. Shulman et. al. Nature, 276:269 (1978). Клетки продуцируют лишь иммуноглобулин, кодированный трансфецированными генами иммуноглобулинов. Клетки миеломы могут быть выращены в культуре или в брюшной полости мыши, где секретированный иммуноглобулин может быть получен из асцитной жидкости. Другие лимфоидные клетки, такие как В-лимфоциты или клетки гибридомы, могут служить подходящими реципиентными клетками.
Лимфоидные клетки могут быть трансформированы векторами, содержащими гены, кодирующие иммуноглобулины, различными путями. Они включают электропорацию, слияние протопластов и метод кальций-фосфатного осаждения. Образовавшиеся трансфецированные клетки дают длительные, стабильные линии клеток, вырабатывающих химерные антитела.
Химерные антитела могут быть получены в большом количестве в системах культивирования тканей в большом объеме, таких как различные системы непрерывной перфузии, системы с полыми волокнами, системы поддерживания стационарной культуры и другие системы.
Около человеческие антитела или фрагменты антител могут также быть получены изменением генных последовательностей человеческих антител, кодирующих гипервариабельные (определяющие комплементарность) районы для получения подходящей анти-IgE специфичности.
Выработка антител к mb/ec сегменту.
ε mb/ec пептид может быть использован для иммунизации животных с целью получения поликлональных и моноклональных антител. Они могут быть также использованы для скринирования на специфические моноклональные антитела или для характеристики специфических поликлональных антител. Они могут быть также использованы для очистки моноклональных и полуклональных антител.
В процессе получения моноклональных антител, специфичных к ε.mb/ec пептиду, не необходимо использовать εmb/ec пептид как для иммунизации, так и для идентификации антитела. Например, при иммунизации мыши для получения иммунных клеток селезенки для слияния с клетками миеломы, иммуногеном может быть мембраносвязанный IgE, выделенный из плазматической мембраны IgE-образующих клеток миеломы, таких как клетки SK007. Иммуногеном могут также бытьк IgE-образующие клетки миеломы.
Для использования синтетического ε.mb/ec пептида как иммуногена, более эффективно конъюгировать пептид с белковым носителем. Предпочтенный белковый носитель геомоцианин моллюска (Keyhole). Если в пептидном сегменте отсутствует остаток Лиз или если остаток Лиз есть в середине сегмента, желательно добавить остаток Лиз-С-концу. Поскольку N-конец всегда имеет α-аминогруппу, модифицированный синтетический пептид может иметь две аминогруппы для связывания.
Множество молекул пептида может быть конъюгировано с каждой молекулой белкового носителя. При использовании предпочтенное молярное соотношение пептид / KLH-10. Способ конъюгации очень хорошо устоялся. Используются сшивающие агенты, такие как глютаровый альдегид, или биск-(сульфосукцинимидил)-суберат или дисульфосукцинимидилтартрат. Предпочтительный сшивающий агент последний.
Иммуноген такой как конъюгат KLH может быть использован для иммунизации кроликов, коз, крыс или мышей для получения поликлональных антител, специфичных к ε.mb/ec пептиду. Лимфоциты из селезенки или лимфотических узлов иммунных мышей и крыс также могут быть взяты для получения гибридов, секретирующих моноклональные антитела, специфичные к ε.mb/ec пептиду. Предпочтенный протокол получения моноклональных антител слияние иммунных клеток селезенки мыши с несекретирующими клетками миеломы мыши такими как клетки NS-1 или SP2/0 с использованием полиэтиленгликоля.
Для оптимальной иммунизации мышей для начала в каждую мышь было инъецировано подкожно 50 мкг конъюгата пептид-НL в полной адъюванте Фрейда. Двумя-четырьмя неделями позже то же количество антигена введено подкожно в неполном адъюванте Фрейда. Примерно на 6-й неделе сделана 4-я инъекция антигена внутрибрюшинно в солевом растворе. Мышей забивали через 4 дня после последней инъекции и выделяли селезенки для получения суспензии одиночных клеток для слияния с клетками миеломы. Сходный протокол также может быть использован для иммунизации очищенным природным человеческим мембраносвязанным IgE (имеющим прикрепленный мембранный якорный домен), выделенным из плазматической мембраны IgE-продуцирующих клеток миеломы человека, таких как клетки SK007. Когда в качестве иммуногена используются IgE-продуцирующие клетки, 1 х 107клеток инъецируют внутрибрюшинно с двухнедельными интервалами.
Скрининг гибридом на моноклональные антитела или идентификация поликлональных антител, реактивных с ε.mb/ec пептидом, могут быть проведены при помощи ферментативного иммуносорбентного анализа (ELISA) c использованием синтетического пептида в качестве антигена на твердой фазе. Альтернативный антиген на твердой фазе конъюгат εmb/ec пептида с другим белковым носителем, таким как бычий сывороточный альбумин, отличающийся от того, который использован в иммуногене. Дальнейшая характеристика моноклональных и поликлональных антител показана в табл. 6. Также указаны анализы, примененные в этих исследованиях.
Эксперименты с животными моделями.
Вещества и методы проверены на животных модельных системах, две из которых следующие.
Модель астма-макака резус.
Моноклональные антитела, специфичные к εmb/ec пептиду человека и родственные им предлагаемые вещества предназначены для использования в лечении пациентов с различными IgE-опосредованными аллергиями. Среди этих аллергий более серьезная форма экзогенная астма. Экспериментальная модельная система для изучения астмы основана на использовании макак резус.
Небольшая часть макак резус, инфицированных нематодой Ascaris suum развивают чувствительность к экстракту аскарид. Когда эти чувствительные макаки получают аэрозоль, содержащий антиген аскариды, у них развиваются проблемы с дыханием, напоминающие астму.
Различные предлагаемые вещества могут быть проверены в модельной системе астма-макаки резус. Макаки, чувствительные к аксаридам, получали экспериментальное лечение или контрольное лечение и выполнялись измерения для определения исчезновения симптомов астмы, вызванной аскаридами, уменьшения количества циркулирующего IgE, уменьшения количества циркулирующих IgE-продуцирующих В клеток, уменьшения плотности IgE на базофилах.
Мышиная модельная система.
У мышей неизвестно в природе развитие аллергических симптомов. Однако для демонстрации фармакологических механизмов предложенной терапии в отношении истощения IgE-образующих В клеток и IgE мышь может служить великолепной моделью. ε.mb/ec сегмент мыши был секвенирован, ε MBOI. Пептид из 19 аминокислот следующий: Glu-Leu-Asp-Leu-Glu-Asp-Leu-Cys-Ile-Glu-Glu-Val-Glu- Gly-Glu-Glu-Leu-Glu-Glu.
Пептид синтезирован в нескольких формах, включая одну, имеющую дополнительные Лей-Лиз остатки на С-конце.
Пептид и его конъюгат с KLH использованы как антигены для иммунизации кроликов и коз. Антисыворотки собраны. Антиген специфичные антитела очищены с использованием колонки Sepharose 4B конъюгированной с пептидом (с добавлением Лей-Лиз) или с пептидом, связанным с бычьим сывороточным альбумином. Нормальным мышам инъецировали внутривенно или внутрибрюшинно очищенные антитела или родственные им вещества для определения уменьшения общего IgE в циркуляции, уменьшения количества IgE-продуцирующих В клеток, уменьшения плотности IgE на поверхности базофилов, возможность возникновения различных эффектов, вызванных IgM и IgG, специфичных к εmb/ec пептиду.
Цель данного вопроса заключается в отнесении эффектов антителозависимой клеточной цитотоксичности (ADCC) к истощению IgE-образующих В клеток. Известно, что IgG, на не IgM, опосредует ADCC.
П р и м е р 1. Получение гибридов и моноклональных антител.
Получение человеческого IgE.
Человеческий IgE был получен из коммерческого источника и очищен для иммунизации мышей с целью получения иммунных спленоцитов для слияния и скрининга гибридов. IgE был также использован для характеристики различных моноклональных анти-IgE антител. Было использовано 2 препарата человеческого IgE. Один был поликлональным IgE, очищенным из человеческой сыворотки, полученной от Venfrex (Portland, Maine). Этот человеческий IgE был очищен из сыворотки аффинной хроматографией с использованием колонки с Sepharose 4B конъюгированной с IgG кролика, специфичным к человеческому IgE. Загрязняющие человеческий альбумин и трансферрин были удалены аффинной колонкой, конъюгированной с антителами, специфичными к альбумину и трансферрину. Моноклональный человеческий IgE был также получен из супернатантов культуры IgE-продуцирующей линии клеток U 266. IgE был аффинно очищен на колонке с Sepharose 4B, конъюгирован с моноклональным антителом, специфичным к человеческому IgE. Это моноклональное антитело IgG было очищено из асцитных жидкостей мышей, несущих специфические гибридомы, с использованием белок А-конъюгированной колонки.
Поликлональный и моноклональный человеческие IgE были проанализированы DDC-Na-полиакриламидным гель-электрофорезом в восстанавливающих и невосстанавливающих условиях. В обоих случаях отдельные молекулы IgE (при невосстанавливающих условиях) наблюдались в отсутствии других, и лишь следы относительно очень светлых полос каких-то других загрязняющих белков присутствовали в геле. Поскольку линия клеток U 266 росла в свободной от сыворотки определенной среде, можно предположить идентичность загрязняющих белков в препарате моноклонального человеческого IgE.
Процедура иммунизации.
Процедура.
Для иммунизации с целью получения иммунных клеток селезенки для слияния с миеломными клетками для получения гибридов были использованы самцы мышей Balb/c с начальным возрастом 6-8 недель. В качестве иммуногена был использован поли-клональный человеческий IgE, очищенный из сыворотки, поставленной Ventrex. Причиной этого было то, что моноклональный IgE, образованный линией клеток U 266, мог нести некоторые неизвестные аномалии. Кроме того, не желательно получать моноклональные антитела против идиотипов IgE U 266, и намного более вероятно индуцировать антиидиотипические ответы против моноклональных антител. После проведения трех экспериментов по слиянию с мышами, иммунизированными IgE, происходящим от U 266, проводились эксперименты по слиянию с мышами, иммунизированными поликлональными IgE, происходящим из сыворотки человека.
Для иммунизации каждая мышь была инъецирована 50 мкг человеческого IgE на инъекцию. Первая иммунизация была дана в полном адъюванте Фрейда. Мыши были инъецированы подкожно в местах с высокой концентрацией лимфотических узлов, например, нижняя сторона раздела конечности и туловища. Одним месяцем и двумя месяцами позже мыши получили подхлестывающие инъекции в те же места 50 мкг IgE. Подхлесты были приготовлены в основном тем же образом, что и первая инъекция, за исключением того, что для подхлестов эмульгирование было проведено в неполном адъюнте Фрейда.
Через месяц каждая мышь была реиммунизована подкожно последний раз (4-я инъекция) 50 мкг IgE в PBS. Каждая мышь была инъецирована подкожно в границу раздела каждой конечности и туловища и внутрибрюшинно. Через 3 дня после последней инъекции мыши были забиты и их селезенки удалены. Клетки селезенки были затем слиты с клетками миеломы при помощи следующей процедуры.
Слияние.
Были приготовлены суспензии, содержащие клетки селезенки и миеломы в соотношении 5: 1. Выбранные клетки миеломы NS-1. Клетки NS-1 были кондиционированы так, что имели время деления около 17 ч. Они были использованы для слияния в логарифмической фазе. Клетки NS-1 были субкультивированы в бактериологических чашках (100 мм) при концентрации 6 х 104 клеток на мл в 10 мл среды Игла, модифицированной Дальбеко (DMEM), содержащей 5% сыворотки теленка, 100 ед./мл пенициллина и 100 мкг/мл стрептомицина. Среду меняли каждые 3 дня. Альтернативно, клетки субкультивировали при 1,5 х 105 клеток на мл в 10 мл той же среды, среду меняли каждые 2 дня.
Клетки селезенки были получены помещением селезенки в бактериологическую чашку (100 мм) и инъецированием 20 мл свободной от кальция и магния PBS (CMF-PBS) в оба конца селезенки для вымывания клеток селезенки. Клетки селезенки затем переносили в 50 мл центрифужные пробирки.
Клетки селезенки центрифугировали при 200 g 5 мин и затем суспендировали в 5 мл 0,83% NH4Cl (0,155 M) в течение 10 мин при комнатной температуре для лизирования эритроцитов. Для остановки лизиса в пробирку добавляли 5 мл CMF-PBS. Клетки затем осаждали и ресуспендировали в 10 мл CMF-PBS.
Концентрацию лимфоцитов определяли добавлением 40 мкл клеточной суспензии к 10 мл солевого раствора вместе с 3 каплями Zup-oglobin TM. Число лимфоцитов определяли при помощи гемоцитометра и определяли концентрацию клеток.
Клетки NS-1 переносили из бактериологических чашек (100 мм) в 50 мл центрифужные пробирки. Определяли концентрацию клеток. Клетки NS-1 затем суспендировали в 10 мл CMF-PBS и смешивали с клетками селезенки как 1:5 в 50 мл центрифужной пробирке. Обычно получали 2-5 х 108 клеток из одной иммунной селезенки и использовали две селезенки в каждом эксперименте по слиянию.
Пробирки откручивали и клетки один раз промывали 10 мл CMF-PBS. Супернатант отсасывали как можно полнее стеклянной пастеровской пипеткой. Из пробирки аккуратно отсасывали жидкость для освобождения клеточного осадка.
До приготовления клеток смесь для слияния приготовляли следующим образом. 5 г полиэтиленгликоля 1450 (Kodak) смешивали с 5 мл CMF-PBS и 0,5 мл ДМСО. Эту смесь нагревали до 56оС, титровали до конечного рН 7,0 и фильтровали через 0,22 мкм фильтр Millipore для стерилизации. 1,0 мл аликвоты добавляли в bryotubes и хранили их при (-70)оС.
Чтобы получить смесь для слияния, готовую к использованию одну из аликвот в Cryotubes плавили, нагревая ее при 37оС. Отдельно пробирку, содержащую 1,0 мл DMEM (без сыворотки), нагревали до 37оС.
1,0 мл аликвоту полиэтиленгликольной смеси для слияния добавляли к клеточной суспензии и суспензию хорошо перемешивали. Через 45 с после добавления полиэтиленгликольной смеси для слияния 2,0 мл предварительно нагретой DMEM (без сыворотки) добавляли по каплям с перемешиванием. Затем добавляли оставшиеся 8 мл предварительно нагретой DMEM (без сыворотки). Клетки оставляли при комнатной температуре на 10 мин.
2,0 мл телячьей сыворотки (FBS) добавляли к суспензии и суспензию хорошо перемешивали. Сочетание FBS и CMF-PBS может помочь предотвратить прилипание клеток к стенкам пробирки. Суспензию затем центрифугировали при 400 g 4 мин.
После откручивания клетки ресуспендировали в примерно 120 мл модифицированной среды, сдобренной 5% FBS, 100 единиц/мл пенициллина, 100 мкг/мл стрептомицина и гипоксантином, аминоптерином и тимидином (НАТ).
Концентрацию клеточной суспензии доводили до 3,3 х 105 клеток селезенки на 200 мкл суспензии. 200 мкл аликвоты суспензии затем распределяли по всем ячейкам 96-ячеечной микротитровальной платы. После того, как 20-30 таких плат обычно было приготовлено для каждого слияния, платы переносили в инкубатор и содержали при 37оС в 5% СО2.
Клетки растили семь дней в платах, затем убирали среду роста и добавляли новую среду. Четырьмя днями позже проводили ферментативный иммуносорбентный анализ (ELISA) на антителах в ячейках, чтобы определить, которое будет связывать человеческий IgE.
Результаты.
Было проведено четыре эксперимента по слиянию с мышами. Для этих слияний было приготовлено 7, 15, 36 и 15 плат по 96 ячеек слитых клеток, соответственно. Более чем в 98% ячеек был рост клеток и ячейка содержала в среднем 3-5 клонов гибридов. Таким образом было получено около 7000 ячеек и, возможно, 21000-35000 клонов в четырех слияниях.
Процедура ELISA.
Процедура.
Процедура первичного скрининга очень большого числа гибридов, происходящих из ячеек слияния, была ELISA с человеческим IgE в качестве антигена на твердой фазе. В качестве антигена был использован поликлональный IgE, очищенный из человеческой сыворотки (Ventrex).
Важным в процедуре скрининга было скринирование на в общем высокоаффинные антитела среди 1000-4000 ячеек от каждого эксперимента по слиянию. Это было сделано путем покрытия каждой ячейки очень малым количеством человеческого IgE, 50 мкл 0,1 мкг/мл. Если предположить, что весь IgE свяжется с твердой фазой, в каждой ячейке будет только 5 нг. Из-за этого малого количества возможность скринирования гибридов, специфичных к загрязняющим белкам, также была сильно снижена. Другой очень важной стратегической точкой было то, что лишь те ячейки, которые показали высокие значения оптической плотности, были выбраны для дальнейшей характеристики и клонирования.
В процедуре 50 мкл человеческого IgE, 0,1 мкг/мл, добавляли в ячейки 96-ячеечных плат Immulon I. Платы покрывали и инкубировали в течение 18 ч при 4оС, чтобы дать белку связаться с платой.
Жидкое содержимое плат затем убирали и в каждую ячейку добавляли 200 мкл 0,1 М NH4Cl с целью насыщения всех оставшихся мест связывания на платах. Раствор NH4Cl оставляли в ячейках на 30 мин при комнатной температуре.
Раствор NH4Cl затем удаляли и ячейки промывали 3 раза PBS и 0,05% Tween 20. Немного раствора PbS (0,05% Tween) оставляли в ячейках до добавления суспензии антитела, описанной ниже.
50 мкл супернатанта клеточного слияния из каждой ячейки 96-ячеечных плат добавляли к каждой ячейке плат Immulon I и инкубировали 1 ч. После инкубации платы 3 раза ополаскивали PBS 0,05% Tween 20 с целью удаления всех несвязавшихся антител.
Супернатант клеточного слияния должен содержать антитело, выработанное различными гибридомами в 96-ячеечных плашках. Антитело, специфичное к человеческому IgE, будет связываться. Количества антител, связанных с твердой фазой, затем определяли при помощи рутинной процедуры с использованием козлиного антимышиного IgG, конъюгированного с пероксидазой красных кровяных телец лошади, с использованием 3,3,5,5-тетраметилбензидина в качестве субстрата.
Результаты.
Из приблизительно 7000 скринированных ячеек около 4000 ячеек (около 60%) были позитивны в ELISA. Большинство этих позитивных ячеек предположительно содержали гибриды, вырабатывающие моноклональные антитела к человеческому IgE. Из этих приблизительно 4000 ячеек в ELISA были выбраны 53 ячейки с наивысшими значениями оптической плотности для клонирования и дальнейшей характеристики.
53 моноклональных антитела были проверены ELISA c использованием ячеек плат, покрытых человеческой сывороткой в различных разведениях. Все они были негативны в ELISA, что предполагало отсутствие их реактивности с человеческим альбумином, IgE, IgM, трансферрином или другими основными белками сыворотки, которые могли загрязнять препараты IgE, использованные как иммуноген для мышей и как антиген в первичном скрининге ELISA.
Клонирование одиночных клеток.
Клеточные суспензии из каждой из 53 ячеек с наивысшими значениями оптической плотности в ELISA были распределены в ячейки 24 ячеечных плат, клеточные суспензии были разведены до 30, 50 и 100 клеток/мл. 0,1 мл разведенных клеточных суспензий, содержащий в среднем 3, 5 и 10 клеток соответственно, поместили в ячейки 96-ячеечной платы. Ячейки были покрыты гистоном.
Когда клетки выросли до колоний, клетки были проанализированы под микроскопом. Клетки каждой колонии не двигались вокруг и не образовывали колоний. Клоны единственных клеток, демонстрирующие наиболее сильную реактивность в ELISA, были выбраны и выведены в культуру.
Продукция и очистка моноклональных антител.
Для выработки больших количеств желаемых моноклональных антител была проведена следующая процедура.
Некоторые из клонов, демонстрирующих высокие значения оптической плотности в ELISA, которые были выращены в ячейках в 24-ячеечных платах, были затем высеяны в 100 мл платы для культивирования культур. Высеянные культуры выбранных клонов единичных клеток были затем отдельно инъецированы в брюшную полость использованных впервые мышей, используя 5 млн, клеток на мышь. После 7 дн асцитную жидкость каждой мыши собирали и замораживали.
Моноклональные антитела в асцитной жидкости были очищены следующим образом. Замороженную асцитную жидкость размораживали и фильтровали через нейлоновую ткань для удаления мягкого материала. Фенилметилсульфонилфторид добавляли к асцитной жидкости до конечной концентрации 0,1 мм. На каждый миллилитр асцитной жидкости добавляли 0,05 мл 1,2 М ацетатного буфера (рН 4,0). Конечная концентрация ацетатного буфера была 60 мМ, рН доводили до 4,5.
На каждый миллилитр обработанной асцитной жидкости добавляли по каплям 25 мкл капииловой кислоты (М.в. 144,21, плотность 0,91 г/мл) c тщательным перемешиванием. Суспензию держали при комнатной температуре и непрерывно перемешивали в течение 30 мин. Суспензию затем центрифугировали 10 мин при 1500 для удаления преципитата. Супернатант, содержащий IgG, нейтрализовали добавлением объема 1 М буфера Нepes (pH 8,0), равного 0,1 объема супернатанта. Затем осаждали 50% (NH4)2SO4.
Преципитат затем растворяли в солевом буфере Hepes. Этот раствор диализовали ночь против солевого буфера Hepes для удаления от (NH4)2SO4. Солевой буфер Hepes дважды меняли во время диализа. После диализа солевой буфер содержал очищенный растворенный IgG. Очищенный IgG был использован в некоторых анализах для характеристики.
Некоторые моноклональные антитела были очищены из асцитных или культуральных жидкостей методом двойной колоночной хроматографии. Сначала антитела были хроматографированы на анионообменнике DE-52 (Whatman, maidstone, England) с использованием 0,05 М Tris pH 8,0 co ступенчатым увеличением NaCl от 0,01 М до 0,15 М. Фракции, содержащие антитела, были идентифицированы ферментативным иммуноанализом, концентрированы фильтрованием на Amicon (Amicon, Danver, mA, x mio, membrane) и далее очищены на колонке с гидроксиапатитом (Bio-Gel, HT; Riokad, Richmond, CA) c использованием ступенчатого градиента фосфатного буфера (рН 7,4) от 0,01 до 0,3 М. Чистота была оценена изоэлектрофокусированием (13) и DDC-Na акриламидным гельэлектрофорезом с использованием системы (Pharmacia PHAST system (Pharmacia, Piscatway, N.g.) и концентрация определения по OD280 нм (1,5-1 мк/мл).
П р и м е р 2. Характеристика моноклонального антитела изобретения.
Связывание с базофилами с использованием иммунофлюоресцентного анализа и анализа связывания радиоактивности
IgE-реактивные моноклональные антитела были изучены, чтобы определить, связываются ли они с базофилами, выделенными из периферической крови. На этом втором уровне скрининга мы отобрали антитела, имеющие терапевтическую ценность. Антитела не должны связываться с базофилами и тучными клетками и вызывать высвобождение фармакологических медиаторов.
Сначала был выбран анализ с иммунофлюоресцентным окрашиванием, поскольку базофилы составляют очень небольшой процент (0,5-2%) среди лейкоцитов. Было предположено что даже в обогащенных препаратах базофилов изучение клеток на уровне единичных клеток с использованием иммунофлюоресцентного окрашивания или биотинавидин ферментативного иммуноокрашивания возможно даст более точное определение, чем радиосвязывание или ELISA, исследующие целиком клеточные популяции.
Выделение базофилов.
Базофилы были сильно обогащены из периферийной крови нормальных здоровых индивидов с использованием плотностного центрифугирования в Percoll c использованием известной процедуры. Основной раствор Percol был приготовлен смешиванием 90 мл 90%-ного раствора Percol c 8,96 мл 10х сбалансированного по Хэнксу солевого раствора, 0,45 мл 1 Н HCl и 1 мл 10% буфера Hepes (pH 7,6). Требуемые плотности Percoll были получены с использованием следующей формулы (8): плотность Percoll (г/мл) (% основного раствора Percoll x 0,001186) + 1,0041, где 0,001186 константа и 1,0041 плотность физиологической среды. Поскольку плотность Percoll изменяется под действием температуры, его приготовляли заранее до дня эксперимента и выдерживали при комнатной температуре в течение ночи.
Гепаринизированную кровь, свежеполученную от нормальных доноров, разводили 1: 1 основной культуральной средой RPme-1640 и центрифугировали через слой Ficoll (Hypaque) (плотность равна 1,070 г/мл). Моноядерные клетки в интерфазе удаляли для других целей и собирали беловатый слой на верхушке осадка красных клеток. Эти гранулоциты промывали и ресуспендировали в основной среде и затем центрифугировали через два тщательно наслоенных градиента Percoll с плотностью 1,072 и 1,078 г/мл при 600 в течение 15 мин. Клетки собирали на интерфазе слоев Percoll и ниже интерфазы между основной средой и верхним слоем Percoll. Клетки содержали 2-10% базофилов в зависимости от конкретного донора.
Процедура анализа.
50 мкл обогащенной суспензии базофилов с концентрацией 5 х 106клеток/мл добавляли к каждой из 1,5 мл микроцентрифужных пробирок, содержащих специфичные антитела. Затем к каждой пробирке добавляли 50 мкл супернатантов гибридомных клонов, показывающих наибольшие значения оптической плотности в ELISA c использованием человеческого IgE в качестве антигена. С некоторыми клонами были проведены повторные анализы. Когда были доступны очищенные антитела, они были использованы в концентрации 20,5 и 1 мкг/мл, когда были доступны асцитные жидкости, они были использованы в разведениях 1:50.
Пробирки с клетками и антителами затем инкубировали 30 мин при комнатной температуре. После инкубации пробирки откручивали, супернатанты удаляли и клетки промывали два раза смесью RPmI 1640, содержащей 2% телячьей сыворотки и 0,1% азида натрия. Пробирки затем потряхивали для высвобождения клеточного осадка.
10 мкл меченого антитела, козлиного антимышиного IgG, конъюгированного с флуоресцеинизотиоцианатом (FITC) добавляли к каждой пробирке в разведении 1: 200. Это меченое антитело связывается с любыми моноклональными антителами, присоединенными к IgE на базофилах, и обеспечивает возможность идентификации этих моноклональных антител.
Пробирки снова инкубировали 30 мин при комнатной температуре. Пробирки центрифугировали и клетки промывали той же средой, что и раньше. Клетки затем ресуспендировали в 50 мкл PBS, помещали на отдельные стекла и покрывали покровными стеклами. Клетки изучали в флуоресцентном микроскопе.
Когда антитела красили клетки, можно было наблюдать, что некоторые из клеток в каждом поле зрения были ярко окрашены. В зависимости от экспериментов процент позитивно окрашенных клеток составлял 2-10%
Анализы радиосвязывания.
Многие из использованных операций сходны с таковыми для иммунофлуоресцентного окрашивания. Фракцию лейкоцитов, содержащую обогащенные базофилы, инкубировали с мышиным моноклональным антителом и около 10000 cpm125I козлиного антимышиного IgG в присутствии 1% нормальной сыворотки козла в качестве подавителя неспецифического связывания. После 30 мин инкубационная смесь была наслоена на слой телячьей сыворотки (100%) в конической пластиковой центрифужной пробирке. После центрифугирования для осаждения клеток верхний слой и сыворотку удаляли. Пробирки переворачивали для удаления остатков жидкости. Кончики конусов, содержащие осадок клеток, затем отрезали лезвием бритвы. Эти кончики затем помещали в пробирки и считали в сцинтилляционном счетчике на 125I. Позитивное и негативное связывание определяли сравнением количеств связанного 125I между негативным контрольным моноклональным антителом и человеческим IgE-специфичными моноклональными антителами.
Результаты.
Сначала было проведено несколько экспериментов с использованием иммунофлуоресцентных анализов. Позднее анализы были с использованием сходной процедуры, использующей вторичное антитело, меченое биотином (козлиный антимышиный IgG) и конъюгированный с пероксидазой авидин. Результаты двух анализов показали, что фоновое связывание варьируют от одного антитела к другому. Результаты также показали, что чувствительности анализов не выше, чем у анализов с высвобождением гистамина. Основная причина относительно низких чувствительностей в этих анализах та, что процент базофилов среди лейкоцитов крови у нескольких выбранных доноров был всегда очень низок. Для этих экспериментов с иммуносвязыванием предпочтительны индивиды с относительно высоким процентом базофилов. Исходя из лейкоцитов с высоким содержанием базофилов, можно получить обогащенную базофилами фракцию, удобную для этих экспериментов.
Индукция высвобождения гистамина из лейкоцитов крови
Когда моноклональное антитело, специфичное к человеческому IgE, связывается с IgE, связанное в базофилах, оно перекрестно сшивает IgE и агрегирует подлежащие молекулы FcER и вызывает высвобождение гистамина и других фармакологических медиаторов. Различные моноклональные антитела, специфичные к IgE человека, были проверены на способность индуцировать высвобождение гистамина из отмытых лейкоцитов периферической крови человека.
Процедура.
Примененный метод тот же, что описан в деталях Siraganian и Hook. Анализ in vitro количественно оценивает процент общего гистамина в популяции лейкоцитов, который высвобождается в культуральную среду после инкубации с индукторами. Определение гистамина в среде или клеточных лизатах производилось при помощи автоматического инструмента, который экстрагирует гистамин n-бутанолом и приводит его в реакцию с присоединяющимся веществом, о-фталальдегидом, при высоком рН для образования флуоресцентного продукта и измеряющего при помощи флуорометра.
Были проведены эксперименты по индукции высвобождения гистамина и собрана среда от лейкоцитов после инкубации с тестируемыми и контрольными антителами и получены клеточные лизаты для определения общих количеств гистамина.
Кровь была получена от нормальных добровольцев венопункцией. В 50 мл конической пробирке каждые 10 мл крови смешивали с 1 мл 0,1 М ЭДТА и 2,5 мл раствора декстрандекстрозы. Смесь оставляли для осаждения при комнатной температуре на 60-90 мин до тех пор, пока не образовывалась резкая граница между слоями эритроцитов и плазмы. Слой плазмы лейкоцитов кровяных пластинок был слит и откручен при 1000 об/мин в течение 8 мин при 4оС. Супернатанты, содержащие кровяные пластинки, удаляли, добавляли 2-3 мл холодного раствора PIPESA-ЭДТА и ресуспендировали клетки. Добавляли еще 40 мл холодного PIPESA-ЭДТА и откручивали клетки. После удаления супернатантов клетки ресуспендировали в 20 мл PIPESA. Клетки затем откручивали снова и ресуспендировали в PIPES acm при плотности клеток 4 х 106/мл.
Пробирки, содержащие 0,3 мл отмытых лейкоцитов и пробирки, содержащие 0,3 мл культуральной жидкости гибридом нагревали до 37оС в течение 6 мин. Пробирки затем смешивали и инкубировали при 37оС с перемешиванием каждые 10 мин. После 60 мин клетки откручивали и собирали супернатанты. Для общего содержания гистамина 0,3 мл отмытых лейкоцитов смешивали с 6% хлорной кислоты.
Результаты.
Распознав отсутствие связи природы высвобождения гистамина среди доступных доноров крови, был заключен контракт на гистаминовый анализ с лабораторией, рутинно производящий анализ на высвобождение гистамина. Лаборатория доктора Donald MacGlashan в отделении клинической химии Университета Джона Гопкинса определила возможности большинства моноклональных антител, специфичных к человеческому IgE, индуцировать высвобождение гистамина из базофилов. Ключевые результаты, относящиеся к тем моноклональным антителам, которые не вызывают высвобождение гистамина, были затем подтверждены в лаборатории доктора Reuben Siraganian в Национальном Институте Здоровья. Обе эти лаборатории установили стабильную популяцию лиц, у которых высвобождается много гистамина, путем скринирования большого числа доноров крови. Результаты обширных исследований с использованием лейкоцитов от 7 доноров, включая по крайней мере 4 с высоким высвобождением гистамина, проведенных доктором MacGlashan, суммированы в табл. 7. Антитела были разведены в 100, 10000 или 1000000 раз из асцитных жидкостей или очищенных антител (1-5 мг/мл). Данные высвобождения гистамина были от 1 репрезентативного "супервысвободителя". Результаты показали, что среди 41 моноклонального антитела 12 не индуцировали освобождение гистамина.
Связывание моноклональных антител с IgE-секретирующими клетками миеломы.
Некоторые клетки миеломы, которые являются опухолевыми клетками, происходящими из иммуноглобулин-секретирующих клеток плазмы, экспрессируют небольшие количества иммуноглобулинов на своей поверхности сравнимое с таковыми на поверхности покоящихся В клеток. Молекулы IgE связываются с поверхностью базофилов (или тучных клеток) и В клеток при помощи двух различных механизмов. IgE связывается с базофилами и тучными клетками через взаимодействие молекул FcER этих клеток и определенного сайта на Fc IgE. IgE синтезируются В клетками или клетками плазмы и переносятся к поверхности клеток и удерживаются на поверхности дополнительным константным сегментом тяжелой цепи. Этот заякоривающий сегмент найдет лишь в мембраносвязанных иммуноглобулинах, но не в секретированных формах иммуноглобулинов. Дифференциальное связывание моноклонального антитела с IgE на базофилах и на В клетках фундаментальная основа применения антител в лечении аллергии.
Поскольку IgE-образующие В клетки и клетки плазмы весьма редки во фракции моноядерных лейкоцитов и поскольку пространственные и структурные характеристики мембраносвязанных молекул IgE скорее всего одинаковы на плазматических клетках, В клетки или IgE-секретирующих клетках миеломы, было выбрано изучение связывания моноклональных антител с клетками IgE миеломы SK007 (из Американского Коллектора Типов Культур). Также может быть исследовано взаимодействие моноклональных антител с нормальными IgE-образующими клетками плазмы.
Процедура.
Человеческие клетки SKO-007, CCL-156 и CCL-159, экспрессирующие связанные на поверхности человеческие IgE-лямбда, IgM-лямбда и IgG1-каппа соответственно поддерживали в среде RPMI-1640, сдобренной 5% телячьей сывороткой и 2 м М глутамином от GIBCO и 1%-ным раствором антибиотика-антимикотина. Одноядерные клетки периферической крови, полученной венопункцией здоровых доноров, были выделены центрифугированием в градиенте плотности Ficoll-paque (Pharmacia, Riscataway, N.I.). Связывание моноклональных антител с поверхностями клеток изучали, используя 2 типа анализов: связывание антител с живыми клетками с последующим непрямым флуоресцентным анализом жидкостной проточной цитометрии и ферментативным анализом с антителами с клетками, присоединенными к микротитровальным платам.
Связывание антител с живыми клетками проводили, осаждая клетки центрифугированием 5 мин при 300 х g, отмывкой среды поддержания от клеток при помощи PBS-BSA и ресуспендированием клеток при 20 х 106 в PBS-B. 50 мкл клеточной суспензии смешивали с 50 мкл антитела при дважды установленных концентрациях (1-10 мкг/мл) в PBS-B и держали на льду. После 30 мин инкубации в каждую пробирку добавляли 2 мл ледяного PBS-B и клетки собирали центрифугированием 5 мин при 300 х g при 5оС. Cупернатант сливали, осадки клеток ресуспендировали встряхиванием и клетки однократно промывали еще 2 мл PBS-B. После собирания клеток центрифугированием в каждую пробирку 20 мкл аффинно очищенного козлиного F(ab')2 против мышиного IgG(H+L) (Bachringer Mannhein, Lot 52934, code 60529) разведенного 1:20. Пробирки инкубировали 20 мин на льду и промывали PBS-B, как указано выше. Наконец, осадки клеток ресуспендировали в 0,5 мл 1% пара-формальдегида (Polysciences, Ins, Worrington PA) в PBS. Клетки анализировали с использованием ε PIes Profile (Conter, Hialeah. FL), оснащенного 5 Вт-аргоновым лазером, работающим при 488 нм, 0,6 Вт и Cytdogy Technology, Inc (Houston, TX). Интенсивность флуоресценции учитывалась встроенным логарифмическим умножителем после ввода комбинации рассеяния прямого света и рассеяния перпендикулярного света для отличения жизнеспособных клеток. Ферментативный анализ с антителами, связанными на клетках, проводился после связывания Mabs с клетками, фиксированными глутаровым альдегидом, в соответствии с известным методом (Kennett R.H. in Monoclonal Antibodies, eds. Kennett R. H. et. al. pp. 376, Plenum Press, N.-Y. 1980). В микротитровальные платы с плоским дном добавляли поли-L-лизин (100 мкл/лунка, 10 мкг/мл в PBS) (Falcon 3072, Becton Dickinson Labware, Ovnard). Этот раствор вытряхивали их ячеек после 30 мин при 22оС и в каждую ячейку добавляли 50 мкл клеток при 2,5 х 106 клеток/мл свободной от кальция и магния модифицированной PBS (GIBCO). Клетки помещали на дно лунок центрифугированием при 300 х g в течение 5 мин и фиксировали клетки 10 мин при 22оС добавлением 50 мкл глутарового альдегида, разведенного до 0,25% в ледяном PBS. Места неспецифического связывания были блокированы последовательной инкубацией 0,1 М глицина 0,1% ВСА в PBS (200 мкл/ячейку) с последующей инкубацией Blotto 15% нежирное сухое молоко (Carnation, LA, CA) и в PBS с 1 г/л триметозалоа. Блокирующие растворы удаляли аккуратным вытряхиванием из платы. Клетки экспонировали с 50 мкл/ячейку контрольного или тесторного моноклонального антитела в Blotto при 37оС в течение 1 ч. Несвязавшееся антитело удаляли вытряхиванием из плашки и промывали 6 раз 200 мкл ячейку с использованием оборудования (Costar, Cambridge, MA). Затем клетки инкубировали с 50 мкл меченого биотином аффинноочищенного козлиного антимышинного IgG (KPL, Galthersburg, MD) при 0,5 мкг/мл в Blotto при 37оС в течение 1 ч. Все ячейки промывали, как указано выше, и добавляли пероксидазу из красных кровяных телец лошади стрептавидин при 0,5 мкг/мл в Blotto в течение 1 ч при 37оС.
Несвязавшийся конъюгат удаляли промыванием, как указано выше, и добавляли 100 мкл субстрата ТМВ. Платы выдерживали в темноте 30 мин при 22оС и останавливали реакцию добавлением 50 мкл/ячейку 4н H2SO4. Измеряли оптическую плотность при 450 нм с использованием Biotex microtitex plato reader.
Результаты.
Среди 41 проверенного моноклонального антитела в анализе проточной цитометрии 35 окрашивали клетки SK007. Все 29 моноклональных антител, которые индуцировали высвобождение гистамина из базофилов, окрашивали. Среди 12 моноклональных антител, которые не индуцировали высвобождение гистамина, 6 окрашивали и 6 не окрашивали клетки SK007. Результаты с ферментативным иммуноокрашиванием были те же, что и в анализах проточной цитометрии. Таким образом, в анализированной группе моноклональных антител 6 соответствуют критериям, что они не связываются с базофилами и не индуцируют высвобождение гистамина и что они связываются с IgE-образующими В клетками. Было получено 2 мышиных моноклональных антитела (Е14С51В1 и Е11АСЗ11С) против человеческого IgE, которые могли подавлять связывание IgE с базофилами. Эти 2 антитела связываются с клетками SK007 и не индуцируют высвобождение гистамина из базофилов.
Определение сродства связывания с человеческим IgE
Принцип и процедура.
Хорошо известно, что чувствительность иммуноанализов зависит от аффинности антител к измеряемым веществам. В случаях сэндвичных анализов на твердой фазе с использованием двух моноклональных антител, одного в качестве отслеживающего, важны аффинности обоих из двух моноклональных антител. Влияние аффинности антитела на прохождение различных анализов с антителом и с использованием иммунноанализов для вычисления аффинности антитела систематически изучены.
Для определения аффинности моноклонального антитела к антигену можно покрыть антигеном твердую фазу в иммуноанализе, например, микротитровальные ячейки в 26 ячеечной плате ELISA. Аффинность моноклонального антитела относительно таковой эталонного моноклонального антитела к тому же антигену на твердой фазе может быть определена сравнением двух моноклональных антител в иммуноанализе. Аффинность или константа связывания эталонного моноклонального антитела определена каким-либо другим способом или сходным способом. Значение оптической плотности моноклонального антитела с определяемой аффинностью в сравнении с таковым эталонного моноклонального антитела указывает, выше или ниже активность этого моноклонального антитела по сравнению с таковой эталонного моноклонального антитела.
Когда эталонное моноклональное антитело не доступно, анализ может быть проведен против эталонного моноклонального антитела, специфичного к другому антигену. Относительная аффинность двух моноклональных антител может быть определена из значений оптической плотности путем покрытия твердой фазы одинаковым молярным количеством антигена и применением идентичных прочих условий и параметров анализа.
В определении аффинностей несколько моноклональных антител, специфичных к IgE человека, которые связываются с клетками SK007, но не индуцируют высвобождение гистамина из базофилов, сравнивалось связывание различных моноклональных антител с человеческим IgE c таковым моноклонального антитела с человеческим β-HCG, чья аффинность, как было определено, 1 х 1011 л/моль. В анализах покрывали ячейки в плате ELISA 50 мкл 0,1 мкг/мл β-HCG или человеческого IgE и титровали анти-HCG моноклональное антитело и различные моноклональные антитела против соответствующих антигенов на твердой фазе. Процедура была та же, что описана в примере 1. Кривые титрования определяли с использованием конъюгированного с пероксидазой красных кровяных телец лошади козлиного антимышиного IgG и ферментного субстрата.
Сродство моноклональных антител, интересующих исследователя, может быть также определено при помощи 125I-меченого человеческого IgE. Растворы антител и 125I-IgE известных концентраций смешивают и оставляют на время (24 ч), достаточное для связывания их до равновесия. Иммунные комплексы затем легко удаляются аффинной адсорбцией с использованием избытка Sepharose 4B, конъюгированной с козлиным антимышиным IgG. Свободный 125IgE легко отмываeтся. Константа связывания Ка моноклонального антитела может быть вычислена из соотношения свободного 125I-IgE и связанного 125I-IgE. Этот способ особенно удобен для антител с высокой аффинностью.
Результаты.
6 моноклональных антител, которые не вызывают высвобождения гистамина из базофилов и которые связываются с клетками SK007, как было определено, имеют константу связывания Ка равную 3 х 108 5 х x109л/моль.
Формула изобретения: 1. СПОСОБ ОПРЕДЕЛЕНИЯ B-ЛИМФОЦИТОВ, ПРОДУЦИРУЮЩИХ IgE, включающий контактирование смеси лейкоцитов с антителами с последующей регистрацией результата взаимодействия антиген антитело, отличающийся тем, что в качестве антител используют анти-IgE моноклональные антитела, продуцируемые штаммом TlS C-2, депонированным в АТСС под номером CRL 10706.
2. Способ по п.1, отличающийся тем, что определение специфичности связывания антитела проводят методом ELISA и иммунофлуоресценции.