Главная страница  |  Описание сайта  |  Контакты
СПОСОБ ВЫДЕЛЕНИЯ ФРАГМЕНТА НУКЛЕИНОВОЙ КИСЛОТЫ С ЗАДАННОЙ ПОСЛЕДОВАТЕЛЬНОСТЬЮ НУКЛЕОТИДОВ
СПОСОБ ВЫДЕЛЕНИЯ ФРАГМЕНТА НУКЛЕИНОВОЙ КИСЛОТЫ С ЗАДАННОЙ ПОСЛЕДОВАТЕЛЬНОСТЬЮ НУКЛЕОТИДОВ

СПОСОБ ВЫДЕЛЕНИЯ ФРАГМЕНТА НУКЛЕИНОВОЙ КИСЛОТЫ С ЗАДАННОЙ ПОСЛЕДОВАТЕЛЬНОСТЬЮ НУКЛЕОТИДОВ

Патент Российской Федерации
Суть изобретения: Использование: изобретение относится к молекулярной биологии, в частности к способу выделения конкретного фрагмента нуклеиновой кислоты из смеси нуклеиновых кислот. Сущность изобретения: способ извлечения конкретного фрагмента нуклеиновой кислоты, содержащего представляющую интерес последовательность нуклеиновой кислоты, из нуклеиновой кислоты или смеси нуклеиновых кислот характеризуется тем, что включает следующие стадии: гидролиза нуклеиновой кислоты или смеси нуклеиновых кислот ферментами рестрикции с получением смеси фрагментов нуклеиновой кислоты, причем ферменты рестрикции состоят из: (А) двух различных ферментов, способных образовывать конкретный фрагмент нуклеиновой кислоты, имеющий заданные и различные концы рестрикции у 5ʹ и 3ʹ окончаний, и (В) одного или нескольких ферментов рестрикции, отличных от ферментов (A), для которых конкретный фрагмент нуклеиновой кислоты не имеет сайтов рестрикции; получения двух различных линкеров, способных связываться с соответствующими концами рестрикции конкретного фрагмента нуклеиновой кислоты; проведения реакции между линкерами и смесью фрагментов нуклеиновой кислоты; проведения первой гибридизации действием на полученную реакционную смесь иммобилизованного зонда, комплементарного одному из линкеров; выделения гибридизованного фрагмента нуклеиновой кислоты из зонда; проведения второй гибридизации действием на выделенный фрагмент нуклеиновой кислоты иммобилизованного зонда, комплементарного второму линкеру; выделения целевого фрагмента нуклеиновой кислоты. 1 ил.
Поиск по сайту

1. С помощью поисковых систем

   С помощью Google:    

   С помощью Яндекс:  

2. Экспресс-поиск по номеру патента


введите номер патента (7 цифр)

3. По номеру патента и году публикации

2000000 ... 2099999   (1994-1997 гг.)

2100000 ... 2199999   (1997-2003 гг.)
Номер патента: 2060278
Класс(ы) патента: C12Q1/68
Номер заявки: 4895422/13
Дата подачи заявки: 16.05.1991
Дата публикации: 20.05.1996
Заявитель(и): Сумитомо Электрик Индастриз Лтд. (JP)
Автор(ы): Тосихико Кисимото[JP]; Син-итиро Нива[JP]; Атсуси Уно[JP]
Патентообладатель(и): Сумитомо Электрик Индастриз Лтд. (JP)
Описание изобретения: Изобретение относится к способу выделения конкретного фрагмента нуклеиновой кислоты из нуклеиновой кислоты или смеси нуклеиновых кислот.
В настоящее время с развитием генной инженерии возникла насущная необходимость в выделении или отделении конкретного фрагмента нуклеиновой кислоты или смесей нуклеиновых кислот в различных областях, в том числе медицине и сельском хозяйстве. Способ выделения конкретного фрагмента нуклеиновой кислоты, содержащего известную последовательность оснований, из нуклеиновой кислоты или смеси нуклеиновых кислот уже известен (Cell Engineering, 8, N 7, 1989). Согласно этому способу на основе последовательности оснований представляющего интерес фрагмента нуклеиновой кислоты получают два или три различных зонда, каждый из которых включает 20-30 оснований. Такие зонды прикрепляют концами к носителю, такому как гель или мембрана с помощью ковалентной связи с образованием в результате иммобилизованных зондов. С другой стороны из клеток отбирают нуклеиновую кислоту, содержащую целевой фрагмент нуклеиновой кислоты, вместе с другими нуклеиновыми кислотами и подвергают при нагревании денатурированию. С целью гибридизации денатурированные нагреванием нуклеиновые кислоты смешивают с иммобилизованными зондами, после чего иммобилизованные и гибридизованные зонды выделяют центрифугированием. Выделенные иммобилизованные зонды нагревают, после чего с помощью электрофореза выделяют нуклеиновую кислоту, содержащую целевой фрагмент нуклеиновой кислоты.
Вышеприведенному способу присущи следующие недостатки: имеется возможность того, что иммобилизованные зонды будут гибридизоваться с нежелательными фрагментами, поскольку их получают использованием части последовательности целевого фрагмента нуклеиновой кислоты. Соответственно эффективность отбора низка. Кроме того, данный способ не отличается простотой и доступностью, поскольку ограничен извлечением нуклеиновой кислоты с известной последовательностью; гибридизацию собранных ДНК с иммобилизованными зондами проводят всего лишь раз с применением только одной целевой последовательности, т.е. комплементарной последовательности, вследствие чего точность низка; выделение фрагмента нуклеиновой кислоты электрофорезом требует сложных операций и много времени.
В предлагаемом изобретении преодолены недостатки охарактеризованного выше обычного способа, и предлагаемое изобретение создано на основе того открытия, что фрагмент нуклеиновой кислоты, содержащий целевую последовательность нуклеиновой кислоты, может быть извлечен с высокой эффективностью путем гидролиза нуклеиновой кислоты или смеси нуклеиновых кислот ферментами рестрикции, подобранными таким образом, что нуклеиновая кислота или кислоты гидролизуются с получением целевого фрагмента нуклеиновой кислоты, несущего целевые различные концы рестрикции у 5' и 3' окончаний, затем к каждому из таких концов рестрикции лигируют два различных ДНК-линкера и осуществляют двухкратную гибридизацию использованием иммобилизованных зондов, комплементарных соответствующим линкерам.
Заявлен способ выделения фрагмента нуклеиновой кислоты с заданной последовательностью нуклеотидов, включающий получение зонда, иммобилизацию зонда на носителе, извлечение нуклеиновой кислоты, содержащей целевой фрагмент, гибридизацию нуклеиновой кислоты с иммобилизованным зондом и выделение целевого фрагмента, отличающийся тем, что извлеченную нуклеиновую кислоту вначале обрабатывают двумя рестриктазами для получения смеси фрагментов нуклеиновой кислоты с предопределенными различными 3' и 5' концами, затем рестриктазами, для которых целевой фрагмент нуклеиновой кислоты не содержит соответствующих сайтов рестрикции, в качестве зонда используют линкеры, способные связываться с концами полученных фрагментов, а гибридизацию осуществляют последовательно с зондом, комплементарным 3' концу, и зондом, комплементарным 5' концу.
Далее предлагаемое изобретение описывается более подробно.
Термин ""нуклеиновая кислота или смесь нуклеиновых кислот" относится к собранным из клеток единственной ДНК или смеси ДНК. Термин "нуклеиновая кислота" в первую очередь подразумевает как ДНК, так и РНК, хотя иногда его используют для обозначения ДНК, если из контекста не возникает возможность иного толкования.
Выражение "конкретный фрагмент нуклеиновой кислоты, содержащий представляющую интерес последовательность нуклеиновой кислоты" или "целевой фрагмент нуклеиновой кислоты" относится к фрагменту или фрагментам, состоящим из целевой последовательности нуклеиновой кислоты, а также к фрагменту или фрагментам, содержащим дополнительные последовательности, происходящие из линкеров или подобных источников, а также из целевой последовательности нуклеиновой кислоты, при этом дополнительные последовательности не оказывают неблагоприятного воздействия на целевую последовательность нуклеиновой кислоты.
Термин "конец(ы) рестрикции" относится к 5' и/или 3' концу данного фрагмента нуклеиновой кислоты, образованного путем гидролиза нуклеиновой кислоты ферментом (ами) рестрикции.
Термин "выделять" или "выделение" в настоящем описании означает отделение и выделение целевого фрагмента нуклеиновой кислоты из нуклеиновой кислоты или смеси нуклеиновых кислот или концентрирование целевого фрагмента нуклеиновой кислоты из смеси разнообразных фрагментов нуклеиновой кислоты, полученных гидролизом нуклеиновой кислоты или кислот ферментами рестрикции.
Новый способ выделения нуклеиновой кислоты предлагаемого изобретения включает следующие стадии:
I) определения извлекаемого фрагмента нуклеиновой кислоты;
II) обработки одной или нескольких нуклеиновых кислот, содержащих последовательность целевого фрагмента нуклеиновой кислоты, ферментами рестрикции, подобранными для получения представляющего интерес фрагмента нуклеиновой кислоты, и подбор ферментов рестрикции осуществляют следующим образом: (I) два различных фермента рестрикции выбирают такими, что они дают различные концы рестрикции у 5' окончания и у 3' окончания целевого фрагмента нуклеиновой кислоты; (2) добавляют один или несколько других ферментов рестрикции, для которых целевой фрагмент нуклеиновой кислоты не имеет сайта (ов) рестрикции, с целью уменьшить вероятность того, что нежелательные фрагменты смогут иметь те же концы рестрикции, что и целевой фрагмент.
III) Добавления к полученным на стадии II) фрагментам нуклеиновой кислоты двух различных линкеров, способных специфично связываться с концами рестрикции целевого фрагмента нуклеиновой кислоты.
IV) Лигирования каждого линкера с соответствующим концом рестрикции путем добавления ДНК-лигазы.
V) Иммобилизации на носителе зонда, комплементарного к каждому из двух линкеров, с образованием иммобилизованного зонда.
VI) Денатурирования полученного на стадии IV) раствора.
VII) Добавления к раствору со стадии VI) полученного на стадии V) иммобилизованного зонда, комплементарного к одному из линкеров, и выдерживания смеси с целью гибридизации.
VIII) Выделения и денатурирования фазы иммобилизованного зонда с последующим выделением фрагментов гибридизованной нуклеиновой кислоты.
IX) Использования полученных на стадии VIII) фрагментов нуклеиновой кислоты для воспроизведения вышеприведенных стадий VI), VII) и VIII), но с применением другого иммобилизованного зонда, комплементарного другого полученному на стадии V) линкеру.
Линкеры, применяемые в вышеохарактеризованном способе предлагаемого изобретения, могут представлять собой линкеры одно-или двунитевой нуклеиновой кислоты, имеющие на своих концах специфичную последовательность оснований, способную гибридизоваться с любым из двух концов рестрикции, образованных действием подобранных ферментов рестрикции. Такие линкеры включают природные одно- или двунитевые ДНК или РНК, которые могут быть соответствующим образом обрезаны или денатурированы. Подобные линкеры могут быть также синтезированы одним из способов, хорошо известных специалисту. К примеру, их можно синтезировать с помощью синтезатора ДНК фирмы Эпплайд Биосистемс Инк. В тех случаях, когда ферментами рестрикции, подобранными для обеспечения уникальных концов рестрикции у 5' и 3' окончаний целевого фрагмента нуклеиновой кислоты, являются Eco RI и PstI, тогда применяемыми линкерами могут быть линкеры со следующими последовательностями оснований:
Линкер Есо RI
5'GCAACCATGCCTAAGTTTG 3'
3'CGTTGGTACGGATTCAAACTTAA 5'
Линкер Ps t I
5' TTCCGTATGGCATGCCTCCCTGCA 3'
3' AAGGCATACCGTACGGAGGG 5'
Зондами, применяемыми в способе предлагаемого изобретения, могут служить фрагменты нуклеиновой кислоты, по меньшей мере частично комплементарные линкерам с заданной последовательностью оснований. Подобные фрагменты нуклеиновой кислоты включают природные одно- или двунитевые ДНК или РНК, которые могли быть соответствующим образом обрезаны или денатурированы, а также искусственно синтезированные ДНК или РНК. К примеру, зонды могут быть получены синтезом молекулы ДНК, полностью или частично комплементарной последовательности ДНК линкера. Применяемые в качестве зондов фрагменты ДНК могут представлять собой одно- или двунитевую молекулы. В случае использования в качестве зонда двунитевой ДНК она после иммобилизации может быть денатурирована. У 5' окончания зонд обладает ДНК последовательностью, позволяющей зонду легко связываться с носителем. Например, соединение Амино-Линк II (поставляется фирмой Эпплайд Биосистемс Инк.), описанное в приведенном ниже примере, относится к типичным представителям таких последовательностей.
Применяемые для получения иммобилизованных зондов носители выбирают из группы, включающей частицы и мембраны. Конкретные примеры мембран включают природные или синтетические органические полимерные мембраны (например, нейлоновую мембрану, нитроцеллюлозную мембрану, политетрафторэтиленовую мембрану, полиэтиленовую мембрану и т.д.). Другие примеры мембран включают неорганические полимерные мембраны (например, графитовую, из пористого стекла, окисно-кремниевую и т. д.), металлические мембраны (например, алюминиевые, апатитовые и т.д.), керамические мембраны (например, из окиси алюминия, из нитрида кремния и т.д.), а также кристаллический NACl, поверхность которых может быть химически или физически модифицирована.
Конкретные примеры применяемых частиц включают: органические полимерные частицы (например, нейлоновые, нитроцеллюлозные, целлюлозные, политетра-фторэтиленовые, полиэтиленовые и т. д. ), неорганические полимеры частицы (например, графитовые из поpистого стекла, окисно-кремневые и т.д.), металлические частицы (например, алюминиевые, апатитовые и т.д.), керамические частицы (например из окиси алюминия). Такие частицы могут использоваться после диспергирования с крепким контактом на поверхности соответствующего объекта.
Вышеупомяныте органические полимеры могут применяться после окисления, восстановления или гидролиза или после физической обработки, например, плазменным облучением. Поверхность неорганических полимерных частиц и керамических частиц может быть химически или физически модифицирована перед использованием, например, электроосаждением ионов.
Кроме того, носителем может служить гель, например гель агарозы, полиакриламидный гель и те же гели в высушенном виде или в высоковязком состоянии.
Рекомендуемый размер вышеприведенных частиц составляет 0,1-500 мкм, наиболее предпочтительно 1-100 мкм, что гарантирует легкость диспергирования в растворе образца и более легкое выделение центрифугированием. Однако вышеуказанный размер частиц не является решающим, если только применяемые частицы не оказывают неблагоприятного воздействия на реакцию между иммобилизованным зондом и образцом и на выделение иммобилизованного зонда.
Способ связывания зонда с носителем хорошо известен, и его осуществляют в известных условиях. Так, способ связывания может быть выбран из нижеперечисленных в зависимости от характера химических модификаций на конкретных используемых зондах и носителях.
1. Гидроксил, предпочтительно диольной группы нуклеиновой кислоты зонда или носителя, активирован, и активированный гидроксил реагирует с аминогруппой носителя или зонда. Средства, применяемые для активации гидроксила, включают трифторэтансульфонилхлорид (далее называемый трезилхлоридом) (К. Nillson и K. Mosbach, Biochem, Biophys, Res. Commen, 102, 449, 1981), CNBr (R. Axen и др. Nature, 214, 1302, 1967), трихлортриазин (T.H.Finlay и др. Anal. Biochem. 87, 77, 1978), эпихлоргидрин (I.Matsumoto и др. I.Biochem. 85, 1091, 1979), бисоксиран (L.Sundberh и I.Porath, I.Chromatogr, 90, 87, 1974), дивинилсульфоновую кислоту I. Porath, Met. Enzymal. 34, 27, 1974), бензохинон (I.Brandt и др. Biochem. Biophys. Acta. 386, 196, 1975) и карбонилдиимидазол (C.Bethell и др. I.Biol. Chem. 254, 2572, 1979).
2. Карбоксил нуклеиновой кислоты зонда или носителя активируют и активированный карбоксил вводят в реакцию с аминогруппой носителя или зонда. Применяемые для активирования гидроксила средства включают карбодиимид, такой как водорастворимый карбодиимид (А.Tengblad, Biochem.I. , 297, 1981; M. Funabashi и др. Anal. Biochem. , 414, 1982) и 2-этокси-1-токсикарбонил-1,2-дигидрохинолин (ЭЭДХ) (G.Saccomani и др. I.Biochem. , 12405, 1981; B. Bellenau и G.Mallk, I.Am. Chem. Soc. , 1651, 1968).
3. Целевой ДНК зонд связывают с помощью ДНК-лигазы с нуклеиновой кислотой, уже неспецифично связанной обычным способом с носителем.
4. Зонд связывают с носителем с помощью реакции между гидразидной группой и альдегидной группой или гидразидной группой и карбоксилом зонда и носителя. Реакция между гидразидной группой и альдегидной группой приводит к гидразону, последующим восстановлением которого образуют ковалентную связь (Ionathan N. Kremsky и др. Nucleic Acid Research 1987, т. 15, с.2891). Реакция между гидразидной группой и карбоксилом может быть осуществлена в присутствии вышеуказанных карбодиимидов.
5. Зонд связывают с носителем введением в один из них определенной группы (например, биотина), а в другой группы, обладающей сродством к первой группе (например, авидина) с последующей реакцией между этими группами (Ionathan N.Kremsky и др.).
6. Тиольные группы как на зонде, так и на носителе активируют, после чего оставляют для реакции друг с другом (K.Bocklhurst et al. Biochem. I.133, 573, 1973).
7. Аминогруппы, как на зонде, так и на носителе оставляют для реакции друг с другом бромацетамидным способом (P.Cuatre- casas, I.Biol. Chem. 245, 3059, 1970).
8. Зонд с носителем связывают путем неспецифической абсорбции или электростатической абсорбции.
Более подробная методика связывания зонда с носителем приводится ниже.
Применение однонитевой ДНК
Если ДНК зонд содержит одну или несколько дополнительных нуклеотидных молекул у окончания или если зонд содержит у окончания химически модифицированную нуклеотидную молекулу (ы), в этом случае дополнительная нуклеотидная молекула(ы) или модифицированная нуклеотидная молекула(ы) могут быть использованы для связывания с носителем. Для этой цели может быть применена следующая методика.
1) Однонитевую ДНК, несущую у окончания функциональную группу, пригодную для иммобилизации, такую как: -NH2 или -СООН, получают следующим образом. В случае искусственно синтезированной ДНК для ее синтеза может быть использован продажный синтезатор ДНК (например, ABI Corp. типа 391, РСR-MATE). Введение функциональной группы может быть осуществлено согласно одному из следующих методов.
1) Гексиламиногруппа может быть введена в концевую молекулу ДНК зонда с помощью синтезатора ДНК в соответствии со следующей схемой реакции (бюллетень пользователя, N 49, август 1988 г. выпущен ABI Crop.):
Однонитевая ДНК-карбонильное окончание-ОН

II) Нижеприведенный линкер может быть введен в окончание ДНК зонда с помощью синтезатора ДНК (например, АВI Corp. типа А-391 ЕР PCR-MATE) и окончание линкера может быть превращено в альдегидную группу или карбоксил. Образованная у окончания линкера альдегидная группа может быть введена в реакцию с гидразидом производного биотина с образованием биотина, способного специфично реагировать с авидином с образованием комплекса (Ionathan N. Kremsky и др.).
III) С помощью синтезатора ДНК к окончанию ДНК зонда может быть присоединено 1-10 нуклеотидов, имеющих аминогруппы.
IV) C помощью концевой трансферазы в окончание ДНК зонда может быть введено основание, пригодное для образования связи с носителем или его реакционноспособным производным (Deug G. и WuR. Методы ферментологии, т. 100, с. 96-1116, 1983).
2) Однонитевую ДНК, комплементарную однонитевой части ДНК зонда вышеприведенной стадии 1), получают с помощью того же синтезатора ДНК, что и на стадии 1), и две ДНК гибридизуют с образованием двунитевой ДНК.
3) Носитель связывают с двунитевой ДНК и получают иммобилизованный двунитевой ДНК зонд.
4) Иммобилизованный двунитевой зонд денатурируют нагреванием (примерно 40оС или выше) или добавлением щелочи в водном солевом растворе, таком как 2,4 М водный раствор тетраэтиламмонийхлорида, соответствующим образом разбавленном в отношении 10 х ННЦ (1,5 М NaCl и 0,15 М цитрат натрия, рН 7) или 0,1-2 М водным раствором NaCl. Смесь центрифугируют и иммобилизованную однонитевую ДНК выделяют в виде твердой фазы.
Применение двунитевой ДНК
Если двунитевая ДНК содержит одну или несколько дополнительных нуклеотидных молекул у окончания одной из своих нитей, то такая ДНК может быть связана по своему окончанию с носителем с применением или без применения химической модификации дополнительных нуклеотидных молекул. Полученный иммобилизованный двунитевой ДНК зонд может быть подвергнут обработке вышеприведенной стадии 4) с получением иммобилизованного однонитевого ДНК зонда.
Вышеуказанная двунитевая ДНК, содержащая дополнительные нуклеотидные молекулы у окончания одной из своих нитей, может быть получена одним из нижеперечисленных методов.
I) С помощью концевой трансферазы в окончание только одной из двух нитей может быть введено основание, пригодное для образования связи с носителем или его реакционноспособным производным.
II) с помощью фермента рестрикции двунитевая ДНК может быть гидролизована с образованием в результате однонитевого участка у окончания.
III) C помощью ДНК-лигазы молекула ДНК, имеющая функциональную группу, может быть связана с двунитевой ДНК. К примеру, двунитевую ДНК гидролизуют с помощью двух различных ферментов рестрикции таким образом, что ДНК может обладать двумя различными концами рестрикции у окончаний. К гидролизованной ДНК добавляют имеющую функциональную группу ДНК, способную специфично связываться с одним из концов рестрикции. Добавление к полученной смеси ДНК-лигазы приводит к целевой двунитевой ДНК, обладающей функциональной группой у окончания.
В вышеизложенном методе 5' окончание одной из нитей, подлежащее последующему удалению, может быть дефосфорилировано. Так получают длинную двунитевую ДНК, одно из окончаний которой характеризуется наличием удлинения одной нити, и затем 5' окончание дефосфорилируют действием фермента дефосфорилирования. Полученную ДНК затем гидролизуют с получением целевого фрагмента с дефосфорилированным 5' окончанием.
IV) Двунитевую ДНК активируют у 3' окончания введением в -ОН группу 3' окончания трихлортриазина. При желании активировать -ОН группу у 5' окончания вначале проводят стадию дефосфорилирования, упомянутую выше в разделе III), с последующей реакцией с трихлортриазином. Поскольку -ОН группу у 5' окончания более реакционноспособна, чем -ОН группа у 3' окончания, первая может быть предпочтительно и исключительно активирована.
После того, как целевой фрагмент нуклеиновой кислоты, связанный с ДНК линкером, гибридизован с иммобилизованным зондом, иммобилизованный зонд может быть выделен обычными методами, такими как: 1) центрифугирование, 2) фильтрование, 3) осаждением и 4) удаление поверхностной жидкости.
Денатурирование, которое проводят с целью отделения целевого фрагмента нуклеиновой кислоты от иммобилизованного зонда, может быть осуществлено: 1) тепловым денатурированием (обычно при температуре 60-95оС), щелочным денатурированием (обычно добавлением NaOH до конечной концентрации примерно однонормальной 1 н.)) и денатурированием с добавлением формальдегида, мочевины и т.п. Может быть использовано и приемлемое сочетание указанных методов.
Как указано выше, сущность способа предлагаемого изобретения заключается в том, что целевой фрагмент нуклеиновой кислоты подвергают двукратной гибридизации использованием двух различных зондов, каждый из которых комплементарен к одному из двух линкеров, связанных с концами рестрикции фрагмента.
Таким образом, согласно способу предлагаемого изобретения эффективность гибридизации очень высока, поскольку применяют зонды, комплементарные предварительно подобранным линкерам. Кроме того, целевой фрагмент нуклеиновой кислоты может быть получен с высокой степенью чистоты, поскольку осуществляют две гибридизации с применением каждый раз различных зондов, при этом зонды комплементарны к одному из двух различных линкеров, связанных с целевым фрагментом. В результате извлечение может быть осуществлено с высокой эффективностью простой процедурой. Более того, поскольку извлечение основано на гибридизации линкеров с зондами, способ не зависит от последовательности оснований представляющего интерес фрагмента нуклеиновой кислоты, и можно также легко установить условия реакции. Все это указывает на возможность использованием способа предлагаемого изобретения извлекать фрагмент ДНК с неизвестной последовательностью оснований.
Кроме того, использованием способа предлагаемого изобретения можно выделить фрагмент нуклеиновой кислоты, не прибегая к сложным и длительным способам, таким как электрофорез.
Нижеследующие подробные примеры приведены с целью иллюстрации некоторых характерных воплощений изобретения.
На фиг. 1 приведена полная карта рестрикции плазмиды pBR 322.
П р и м е р 1. Извлечение из плазмиды рВR 322 фрагменты ЕсоR 1-PstI.
Данным примером иллюстрируется извлечение целевого фрагмента нуклеиновой кислоты (далее называемого фрагментом А) способом предлагаемого изобретения, причем фрагмент А является частью плазмиды рВR 322, происходящей из Е.сoli.
1) Определение сайтов рестрикции по обоим концам фрагмента А и гидролиз рВR322.
Карта рестрикции pBR 322 хорошо известна специалистам и приведена на чертеже, на котором заштрихованной площадью показан целевой фрагмент А. Ферменты рестрикции, используемые для гидролиза pBR 322, указаны в рамочке. Карта рестрикции показывает, что оба конца фрагмента А могут быть гидролизованы ферментами рестрикции Есо RI и PstI, и что во фрагменте А отсутствуют сайты SaI I, BaI I и Pvu II. Таким образом, обработка pBR 322 вышеуказанными ферментами рестрикции не может привести ни к какому другому фрагменту, кроме фрагмента А, характеризующегося на обоих своих концах наличием Есо RI и Pst I концов рестрикции.
Так, pBR 322 обрабатывают Eco RI, Sal I, Pst I, Pvu II и BaI I по нижеприведенной методике с получением смеси фрагментов нуклеиновой кислоты, содержащей фрагмент А. Применяемые ферменты рестрикции все поставлены Такаrа Shuzo Co. Подробная методика приведена ниже.
Вначале реакционную смесь I нижеприведенного состава оставляют для реакции на 1 ч при 37оС с последующим нагреванием 5 мин при 60оС для прекращения реакции. Проводят экстрагирование фенолом и экстракт осаждают этанолом с последующим высушиванием.
Реакционная смесь I
Компоненты Содержание
pBR 322 2 мкл (0,5 мкг/мкл)
ЕсоRI 2 мкл (5 Е/мкл)
Pst I 2 мкл (5 Е/мкл)
Sal I 2 мкл (5 Е/мкл) Высококонцентрированный солевой буфер
(Такаrа Shuzo) 3 мкл (х10 конц.)
Н2О 19 мкл
Всего 30 мкл
Затем с целью дальнейшего гидролиза ферментом рестрикции Pvu II вышеприготовленную сухую ДНК растворяют в 16 мкл воды и оставляют на 1 ч при 37оС в реакционной смеси 2 нижеприведенного состава с последующим нагреванием 5 мин при 60оС для прекращения реакции. Проводят экстрагирование фенолом, полученный экстракт осаждают этанолом с последующим высушиванием.
Реакционная смесь 2
Компоненты Содержание
Раствор ДНК 1 6 мкл Солевой буфер средней концентрации
(Такаrа Shuzo) 2 мкл(х 10 конц.)
Pvu II 2 мкл (5 Е/мкл)
Всего 20 мкл
С целью дальнейшего гидролиза ферментом ВаI I вышеприготовленную высушенную ДНК растворяют в 35 мкл воды и оставляют на 1 ч при 37оС в реакционной смеси 3 нижеследующего состава с последующим нагреванием 5 мин при 60оС для прекращения реакции. Проводят экстрагирование фенолом с последующим осаждением этанолом и высушиванием.
Реакционная смесь 3
Компоненты Содержание
Раствор ДНК 35 мкл
Буфер для BaI I
(Takara Shuzo) 5 мкл (х10 конц.)
BaI I 10 мкл
Всего 50 мкл
2) Получение ДНК линкеров
2а) Получение Есо RI линкера
Синтезируют Есо RI линкер со следующей последовательностью:
Eco RI линкер
5'GCAACCATGCCAAGTTTG 3'
3' CGTTGGTACGGATTCAAACTTAA 5'
Вышеприведенные две однонитевые молекулы ДНК, комплементарные друг другу, синтезируют с помощью ДНК синтезатора (391 PCR-MATE, модель ЕР) производства Эпплайд Биосистемс Инк. Затем синтезированные молекулы очищают методом очистки отсечением.
Очищенные молекулы однонитевой ДНК (каждая в концентрации 1 мкг/мкл, 5 мкл) смешивают друг с другом и оставляют на 1 ч при 30оС для гибридизации с получением в результате молекулы двунитевой ДНК. Затем 5' окончание полученной молекулы двунитевой ДНК фосфорилируют. Фосфорилирование осуществляют 1 ч при 37оС в реакционной смеси 4 нижеприведенного состава, после чего реакцию прекращают нагреванием 5 мин при 65оС.
Реакционная смесь 4
Компоненты Содержание
Двунитевая ДНК
(1 мкг/мкл) 2 мкл
Т4 полинуклеотид-киназа
(10 Е/мкл) 4 мкл
х 10 буфер для Т4 киназы 2 мкл
10 мМ АТФ 2 мкл
(гамма 32Р) АТФ (2 мкМ,
50 мкС) 5 мкл
Н2О 5 мкл
Всего 20 мкл
(0,1 мкг ДНК/мкл)
2b) Получение Pst I линкера
Синтезируют Pst I линкер со следующей последовательностью:
Pst I линкер
5' TTCCGTATGGCATGCCTCCCTCGA 3'
3' AAGGCATACCGTACGGAGGG 5'
Синтез ДНК, очистка и гибридизация молекул однонитевых ДНК, а также фосфорилирование тем же путем, что и на стадии 2а).
3) Связывание линкеров с фрагментов А.
Полученные на стадии 2) линкеры смешивают с полученными на стадии 1) продуктами гидролиза pBR322, в результате чего линкеры могут связываться с целевым фрагментом ДНК. Для этой цели используют набор для лигирования ДНК фирмы Такара (Такаra Shuzo Co). Так смесь фрагментов ДНК растворяют в 20 мкл ТЕ-буфера (10 мМ трис-НСl, рН 8 и 1 мМ ЭДТК), оставляют примерно на сутки при 16оС в реакционной смеси 5 нижеследующего состава, после чего осаждают этанолом и испаряют досуха.
Реакционная смесь 5
Компоненты Содержание
Смесь фрагмен-
тов ДНК 20 мкл
Есо R1 линкер 5 мкл (0,1 мкг/мкл)
Pst I линкер 5 мкл (0,1 мкг/мкл)
Раствор А 240 мкл
Раствор В 30 мкл
Примечание. Растворы А и В реакционные смеси, придаваемые к набору для лигирования ДНК фирмы Такара.
4) Получение иммобилизованных зондов
С помощью синтезатора ДНК (391 РСR-MATE, модель ЕР) фирмы Эпплайд Биосистемс Инк. синтезируют четыре ДНК зонда с нижеприведенными последовательностями оснований. К 5' концу каждого зонда присоединяют Амино-Линк II (т.е. ДНК линкер) для связывания c носителем.
Амино-Линк II производится фирмой АВI Корп. охарактеризован в "Бюллетене пользователя N 49 "фирмы Эпплайд Биосистем Инк. и отвечает следующей формуле:

Зонд 1: H2N-(Амино-Линк II) GCAACCATGCCTAAGTTTG
Зонд 2: CGTTGGTACGGATTCAAACTTAA-(Амино- Линк II)-NH2
Зонд 3: Н2N-(Амино-Линк II)-TTCCGTATGGCATGCCTCCCTGCA
Зонд 4: AAGGCATACCGTACGGAGGG-(Амино-Линк II)-NH2
Зонды 1 и 2 комплементарны к Есо RI линкеру, а зонды 3 и 4 к PstI линкеру. Зонды 1-4 независимо иммобилизуют на отдельных гелях. Иммобилизацию проводят следующим образом.
1) Активирование геля.
Трифторэтансульфонилхлорид (трезилхлорид) (К энд К или Флука), используемый в нижеприведенной методике, имеет тенденцию к разложению при значении рН, равном 3 или выше, поэтому нижеописанные операции проводят в сухой камере, применением стерилизованной упаковки, заполненной сухим азотом, с целью избежать излишнего попадания влаги. Предназначенные для работы пиридин и ацетон обезвоживают молекулярными ситами за три или более дней перед использованием.
В круглодонную колбу на 10 мл с пробкой загружают 1,5 мл безводного ацетона, 100 мкл пиридина и магнитную мешалку.
С другой стороны на стеклянном фильтре (# 5) с отсосом помещают 1 г геля (Шимпак диол 300 (Шимацу), быстро промывают 50 мл безводного ацетона и сразу же переносят в круглодонную колбу. Затем колбу охлаждают в бане со льдом (примерно 0оС) и при интенсивном перемешивании в токе подаваемого в колбу сухого азота в течение примерно 1 мин по каплям прибавляют трезилхлорид.
По окончании прибавления круглодонную колбу закрывают пробкой и реакцию продолжают 20 мин примерно при 0оС и медленном перемешивании, чтобы избежать измельчения геля. После реакции гель переносят на стеклянный фильтр и последовательно промывают ацетоном, смесью ацетона с 5 мМ НСl (1:1) и 5 мМ НСl. Гель дополнительно промывают 30 мл сухого ацетона, после чего фильтр покрывают мешком из поливинилхлорида с сухим азотом, подаваемым через верхнее отверстие мешка, и всю систему отсасывают около 1 ч с целью полного высушивания геля.
2) Иммобилизация зондов на геле.
Синтезированные на носителе ДНК зонды отщепляют концентрированной аммиачной водой и оставляют на 10 ч при 55оС с последующим выдерживанием защитных групп. Зонды концентрируют при пониженном давлении досуха и растворяют в 200 мкл 10 мМ триэтиламинацетата (ТЭАА) в качестве буфера. После удаления защитных групп экстракцией эфиром зонды вновь концентрируют досуха и растворяют в 180 мкл сочетающего буфера (0,2 М NaHCO3 и 0,5 М NaCl, рН 7,5). Затем 100 мг геля со стадии (1) переносят в пробирку Эппендорфа на 1,5 мл и смешивают с ДНК зондами. Смесь выдерживают 24 ч при 25оС при осторожном перемешивании с иммобилизацией в результате зонда на геле. После реакции гель отделяют от жидкой части центрифугированием 5 мин при 2000 об/мин с получением в результате иммобилизованных зондов.
5) Гибридизация целевого фрагмента ДНК с иммобилизованным зондом
а) Смесь фрагментов ДНК, содержащую целевой фрагмент ДНК, связанный с линкерами, полученную на стадии 3), растворяют в 100 мкл 2,4 М тетраэтиламмонийхлорида.
b) Полученный раствор денатурируют нагреванием 1 мин при 70оС.
с) Иммобилизованный зонд 1 (5 мг) добавляют к полученному раствору и смесь оставляют на 10 мин при 20оС.
d) Гибридизованный в результате зонд 1 осаждают центрифугированием 15 с при 2000 об/мин и жидкую часть переносят в другую пробирку Эппендорфа.
е) Иммобилизованный зонд промывают 50 мкл 2,4 М тетраэтиламмонийхлорида и гибридизованный зонд вновь выделяют центрифугированием 15 с при 2000 об/мин. Жидкую часть добавляют в пробирку Эппендорфа стадии d.
f) К выделенному на стадии е) гибридизованному зонду добавляют 2,4 М тетраэтиламмонийхлорид (100 мкл) и полученную суспензию денатурируют нагреванием 10 мин при 70оС, после чего центрифугируют 15 с при 2000 об/мин с отделением гибридизованного фрагмента ДНК от иммобилизованного зонда. Собирают жидкую часть, содержащую фрагмент ДНК.
g) К отделенной на стадии f) жидкой части добавляю иммобилизованный зонд 3 (5 мг) и смесь оставляют на 10 мин при 20оС.
h) Смесь центрифугируют 15 с при 2000 об/мин с отбором жидкости части.
i) К отделенному на стадии h) иммобилизованному зонду добавляют 2,4 М тетраэтиламмонийхлорид (100 мкл) и полученную суспензию центрифугируют 15 с при 2000 об/мин с выделением иммобилизованного зонда.
j) К выделенному на стадии i) иммобилизованному зонду добавляют 2,4 М тетраэтиламмонийхлорид (100 мкл) и полученную суспензию денатурируют нагреванием 10 мин при 70оС, после чего центрифугируют 15 с при 2000 об/мин с отделением содержащей фрагмент ДНК жидкости части от иммобилизованного зонда. Отделенную жидкую часть используют для последующего анализа (образец I).
k) Жидкую часть стадии е) денатурируют 1 мин при 70оС, после чего добавляют иммобилизованный зонд 2 (5 мг). Смесь выдерживают 10 мин при 20оС.
l) Смесь центрифугируют 15 с при 2000 об/мин и жидкую часть удаляют.
m) Иммобилизованный зонд в виде осадка добавляют вместе со 100 мкл 2,4 М тетраэтиламмонийхлорида и смесь вновь центрифугируют 15 с при 2000 об/мин. Жидкую часть удаляют.
n) К выделенному в результате иммобилизованному зонду добавляют тетраэтиламмонийхлорид (2,4 М, 100 мкл) и полученную суспензию денатурируют нагреванием 10 мин при 70оС, после чего центрифугируют 15 с при 2000 об/мин с выделением жидкой части.
о) К выделенной на стадии n) жидкой части добавляют иммобилизованный зонд 4 (5 мг) и смесь оставляют на 10 мин при 20оС.
р) Гибридизованный зонд выделяют центрифугированием 15 с при 2000 об. /мин и промывают 100 мкл 2,4 М тетраэтиламмонийхлорида. Затем снова центрифугируют 15 с при 2000 об./мин. Выделенный в результате зонд суспендируют в 100 мкл 2,4 М тетраэтиламмонийхлорида и полученную суспензию денатурируют нагреванием 10 мин при 70оС, после чего центрифугируют 15 с при 2000 об./мин с отделением жидкой части. Выделенную жидкую часть используют в последующем анализе (образец 2).
6) Идентификация выделенного фрагмента ДНК и определение его чистоты.
Полученные на стадии 5) образцы 1 и 2 смешивают друг с другом, нагревают 10 мин при 70оС и оставляют на 30 мин при 20оС (образец 3).
Образец 3 (2 мкл) подвергают электрофорезу на 2%-ном агарозном геле, в результате которого авторадиографией обнаруживается единственная полоса в области 790-800 п.о.
С другой стороны образец 3 исследуют на количество выделенного фрагмента ДНК. Так, на основе количества исходной плазмиды рВR 322 (1 мкг, реакционная смесь 1) теоретическое количество фрагментов Есо RI-PstI рассчитывают равным 173 нг. В то же время количество выделенного целевого фрагмента ДНК равнялось 145 нг. С учетом этих данных с помощью нижеприведенного уравнения получают выход целевого фрагмента ДНК в 80%
Выделениефрагмента целДНКевого × 100 80%
хПримечание. Цифра 752 означает число нуклеотидов, содержащихся во фрагменте Есо RI-Pst I, а цифра 795 означает число нуклеотидов во фрагменте Есо RI-PstI вместе с линкером.
Полученные результаты показывают, что представляющий интерес фрагмент А успешно извлекается, несмотря на применение на вышеприведенной стадии 1) ферментов рестрикции Sal I, Pvu II и Bal I, дающих другие фрагменты того же размера, что и целевой фрагмент А.
Формула изобретения: Способ выделения фрагмента нуклеиновой кислоты с заданной последовательностью нуклеотидов, включающий получение зонда, иммобилизацию зонда на носителе, извлечение нуклеиновой кислоты, содержащей целевой фрагмент, гибридизацию нуклеиновой кислоты с иммобилизованным зондом и выделение целевого фрагмента, отличающийся тем, что извлеченную нуклеиновую кислоту вначале обрабатывают двумя рестриктазами для получения смеси фрагментов нуклеиновой кислоты с предопределенными, различными 3' и 5' концами, затем рестриктазами, для которых целевой фрагмент не содержит соответствующих сайтов рестрикции, в качестве зонда используют линкеры, способные связываться с концами полученных фрагментов, а гибридизацию осуществляют последовательно с зондом, комплиментарным 3' концу, и с зондом, комплиментарным 5' концу.