Главная страница  |  Описание сайта  |  Контакты
ФРАГМЕНТ ДНК PCG 12, КОДИРУЮЩИЙ СИНТЕЗ β-ГАЛАКТОЗИДАЗЫ PENICILLIUM CANESCENS, И ШТАММ ГРИБОВ PENICILLIUM CANESCENS - ПРОДУЦЕНТ b-ГАЛАКТОЗИДАЗЫ
ФРАГМЕНТ ДНК PCG 12, КОДИРУЮЩИЙ СИНТЕЗ β-ГАЛАКТОЗИДАЗЫ PENICILLIUM CANESCENS, И ШТАММ ГРИБОВ PENICILLIUM CANESCENS - ПРОДУЦЕНТ b-ГАЛАКТОЗИДАЗЫ

ФРАГМЕНТ ДНК PCG 12, КОДИРУЮЩИЙ СИНТЕЗ β-ГАЛАКТОЗИДАЗЫ PENICILLIUM CANESCENS, И ШТАММ ГРИБОВ PENICILLIUM CANESCENS - ПРОДУЦЕНТ b-ГАЛАКТОЗИДАЗЫ

Патент Российской Федерации
Суть изобретения: Использование: относится к микробиологической промышленности, в частности к генетической инженерии. Сущность изобретения: предлагается фрагмент ДНК PCG12, кодирующий синтез b-галактозидазы, на основе которого сконструирована плазмида pPCG12 и штамм Penicillium canescens ВКПМ F-715, являющийся продуцентом b-галактозидазы. Предлагаемый штамм за 96 ч ферментации на среде со свекловичным жомом и БВК накапливает до 190-220 ед/мл b-галактозидазы в культуральной среде. 2 с. п. ф-лы.
Поиск по сайту

1. С помощью поисковых систем

   С помощью Google:    

   С помощью Яндекс:  

2. Экспресс-поиск по номеру патента


введите номер патента (7 цифр)

3. По номеру патента и году публикации

2000000 ... 2099999   (1994-1997 гг.)

2100000 ... 2199999   (1997-2003 гг.)
Номер патента: 2080387
Класс(ы) патента: C12N9/38, C12N15/56, C12N15/80, C12N1/14
Номер заявки: 94042578/13
Дата подачи заявки: 01.12.1994
Дата публикации: 27.05.1997
Заявитель(и): Государственный научно-исследовательский институт генетики и селекции промышленных микроорганизмов
Автор(ы): Николаев И.В.; Винецкий Ю.П.; Алексенко А.Ю.; Макарова Н.А.; Ломакин И.Б.; Захарова Е.С.
Патентообладатель(и): Государственный научно-исследовательский институт генетики и селекции промышленных микроорганизмов
Описание изобретения: Изобретение относится к микробиологической промышленности и, в частности, генетической инженерии и представляет собой фрагмент ДНК мицелиального гриба Penicillium canescens, кодирующий синтез секретируемой β-галактозидазы, и штамм Penicillium canescens продуцент b-галактозидазы, сконструированный методами генетической инженерии на основе этого фрагмента. Фермент b-галактозидаза используется в пищевой промышленности для гидролиза лактозы, превращая ее в две молекулы моносахаридов глюкозу и галактозу.
В качестве продуцентов b-галактозидазы известны различные виды бактерий, дрожжей, актиномицетов и мицелиальных грибов. Грибные секретируемые b-галактозидазы, проявляющие свою активность при кислых значениях pH среды, используются в молочной промышленности для гидролиза лактозы в молочной творожной сыворотке.
Известны грибные штаммы-продуценты различной видовой принадлежности: Aspergillus niger, Aspergillus oryzae, Alternaris tenuis, Penicillum multicolor, Penicillium canescens. Наибольшей активностью среди известных продуцентов обладают Penicillium multicolor и Penicillium canescens. Продуцент Penicillium multicolor KU-0-132 (FERM-P4375, АТСС 20539) за 72 ч глубинной ферментации образовывает 140 ед/мл b-галактозидазы в культуральной жидкости, измеренной по гидролизу О-нитрофенил-b-D-галактозида (ОНФГ) при 37oC. Штамм Penicillium multicolor KU-0-132 растет на среде с мукой из семян хлопчатника и рисовыми отрубями, т.е. на дорогих и малодоступных субстратах, что является недостатком для его использования. Штамм Penicillium canescens 20171 (ВКПМ F178) (Авт. свид. СССР N 1065476A) за 96 ч глубинного культивирования образовывает 42-70 ед/мл b-галактозидазы (субстрат ОНФГ, 30oC). Наиболее близким аналогом к предлагаемому (прототипом) является штамм Penicillium canescens ДГ-86/18 (ВКПМ F-436) (Авт. свид. СССР N 1738854A1), который за 120-144 часа накапливает b-галактозидазу до 100-130 ед/мл культуральной жидкости (субстрат ОНФГ, 30oC). Недостатками штамма Penicillium canescens ДГ-86/18 являются низкий уровень накопления b-галактозидазы и длительное время ферментации, что в условиях возрастающей стоимости энергоресурсов делает его использование мало перспективным. До настоящего времени неизвестны штаммы-продуценты b-галактозидазы, полученные генно-инженерными методами.
Задача изобретения повысить уровень накопления b-галактозидазы Penicillium canescens в культуральной жидкости и сократить время ферментации.
Задача достигается получением фрагмента ДНК PCG12, несущего ген секретируемой b-галактозидазы и конструированием на его основе с помощью методов генетической инженерии штамма Penicillium canescens PCG12-38, содержащего несколько копий гена секретируемой b-галактозидазы. Этот штамм за 96 ч ферментации на среде со свекловичным жомом и БВК накапливает b-галактозидазу до 190-220 ед/мл культуральной жидкости (субстрат ОНФГ, 30oC).
Конструирование штамма состояло из нескольких этапов: Этап 1 выделение из природного изолята- штамма Penicillium canescens 20171 (ВКПМ F178), фрагмента ДНК PCG12, кодирующего ген секретируемой b-галактозидазы;
Этап 2 включение фрагмента ДНК PCG12 с геном b-галактозидазы в состав векторной молекулы pTZ19R;
Этап 3 получение путем многоступенчатой селекции с применением мутагенных факторов и отбора на селективных средах штамма-реципиента Penicillium canescens PCA10, неспособного к росту на неорганических источниках азота вследствие мутации в гене нитратредуктазы;
Этап 4 трансформация штамма-реципиента PCA10 векторной молекулой с включенным геном b-галактозидазы и плазмидой с гетерологичным геном нитратредуктазы из Aspergillus niger;
Этап 5 отбор наиболее продуктивного трансформанта, его генотипический, фенотипический и физиолого-биохимический анализ.
Новый штамм Penicillium canescens PCG12-38 депонирован во Всероссийской коллекции промышленных микроорганизмов под номером ВКПМ F715.
По сравнению с известными грибными продуцентами Penicillium canescens PCG12-38 характеризуется более высоким уровнем накопления b-галактозидазы и более коротким временем ферментации. Отличия предлагаемых технических решений заключаются в том, что наблюдаемый эффект достигается за счет введения в геном гриба Penicillium canescens 20171 (ВКПМ F178) дополнительных копий впервые клонированного нами гена секретируемой b-галактозидазы.
Штамм Penicillium canescens PCG12-38 обладает следующими культурально-морфологическими и физиолого-биохимическими признаками.
Морфологические признаки на различных питательных средах после 10 сут роста при 30oC:
Сусло-агар. Диаметр колоний 6,5-7,5 см. Колонии различной степени пушистости, состоящие из более плотного базального мицелия и более рыхлого воздушного мицелия. Колонии радиальнобороздчатые, с обильным спороношением, дымчатозеленовато-серые с растущим краем (2-4 мм). Обратная сторона оранжево-темно-коричневая. Конидиеносцы 430-450 х 3.0-3.2 мкм отходят от войлочного мицелия, четко-шероховатые. Конидии 2.0-2.2 мкм шаровидные, в молодом возрасте гладкие, в старом шероховатые, образуются в цепочках, соединяются в колонки, со временем распадающиеся.
Агаризованная среда Ролена-Тома с сахарозой. Диаметр колоний 38-48 мм. Колонии войлочные или слабопушистые в центре, слабовыпуклые, с радиальными бороздками, белого цвета, по краям окрашены в серо-голубоватый тон, края неровные, лопастные, обратная сторона серо-бежевого тона.
Та же среда, но с добавлением кукурузного экстракта. Диаметр колоний 5.8-6,5 см. Колонии светло-серые, бархатистые, по краю слабопушистые. Край ровный, ширина зоны роста 2-7 мм. Радиальнобороздчатые, слабовыпуклые. Конидиеобразование скудное. Обратная сторона колоний темно-коричневая.
Агаризованная среда Чапека с глюкозой. Диаметр колоний 2,8-4,0 см. Колонии серые, слегка вогнутые, складчатые, с ровным выпуклым краем. Конидиеобразование интенсивное, цвет конидий светло-серый. Обратная сторона колоний с радиальными складками слабо-кремового тона.
Та же среда, но с добавлением кукурузного экстракта. Диаметр колоний 5,5-6,0 см. Колонии светло-серые, радиальнобороздчатые, слабовыпуклые, с широким растущим краем, слабопушистым. Колонии бархатистые, обратная сторона радиальноскладчатая, коричневого оттенка. Конидиеобразование умеренное.
Физиолого-биохимические признаки.
Мезофил, растет при 25-37oC,оптимальная температура роста 29oC. Оптимум роста при значениях pH среды 4,1-5,8. Желатину разжижает слабо.
Отношение к источникам углерода. Хорошо усваивает моно-, ди- и полисахариды, за исключением арабинозы, которую утилизирует слабо. При росте на глюкозе, фруктозе, сахарозе, мальтозе, маннозе, глицерине образует ярко-желтый или коричневый пигмент.
Отношение к источникам азота. Хорошо усваивает аммонийный и нитратный азот, пептон, мочевину.
У заявляемого штамма Pinecillium canescens PCG12-38 избирательно увеличена активность секретируемой b-галактозидазы, доля которой составляет 70% от суммарного внеклеточного белка.
Генотипические признаки. Основной генотипический признак заявляемого штамма заключается в увеличенном числе (3-4 копии) генов секретируемой b-галактозидазы, тандемно интегрированных в составе рекомбинантной плазмиды pPCG12 в геном гриба Penicillium canescens PCA10 в результате гомологичной рекомбинации. Кроме того, штамм Penicillium canescens PCG12-38 дополнительно содержит плазмиду pSTA10 с геном нитратредуктазы Aspergillus niger (Unkles et al. 1989). При пересевах конидий утраты селективного маркера (плазмиды pSTA10) и значительного снижения активности b-галактозидазы не наблюдается, что свидетельствует о стабильности плазмид.
Изобретение иллюстрируется следующими примерами:
Пример 1. Получение фрагмента ДНК PCG12, кодирующего синтез b-галактозидазы, из фаговой библиотеки генов мицелиального гриба. Penicillium canescens 20171 (ВКПМ F178).
Для получения банка генов ДНК гриба Penicillium canescens 20171 (ВКПМ F178) обрабатывают рестриктазой Sau 3a в условиях неполного расщепления, фракционируют при центрифугировании в градиенте плотности сахарозы, выделяя рестрикты размером 20 тыс. пар оснований (п.о.), и включают путем лигирования с ДНК-лигазой в ДНК фагового вектора lEMBL4. Далее готовят упаковочную смесь (белки фаговых головок и белки хвостов по отдельности), проводят упаковку в оптимальных соотношениях компонентов смеси и полученные фаговые частицы с рекомбинатными ДНК рассеивают на чашки Петри с питательной средой и индикаторными бактериями. Полученные негативные колонии (независимые клоны) в количестве 3·104 в совокупности представляют собой банк генов Penicillium canescens. Далее из этого банка генов выделяют фрагмент ДНК PCG12, кодирующий ген секретируемой β-галактозидазы.
Для решения этой задачи синтезируют олигонуклеотидный зонд 1 с нуклеотидной последовательностью 5ʹTCAGTCCCAIGTIACAGTATCCCTCTG 3ʹ, который комплементарен участку, кодирующему с 4-й по 11-й аминокислотный остаток β-галактозидазы. Этот зонд в количестве 10 нг смешивают с 10 мкг мРНК, выделенной из гомогенизированных клеток мицелия гриба Penicillium canescens 20171 (ВКПМ F178), активно растущих на среде с свекловичным жомом и БВК, инкубируют 3 мин при 80oC, а затем 1 ч при 50oC и определяют нуклеотидную последовательность мРНК гена b-галактозидазы по направлению от праймера к 5'-концу. На основе этой последовательности РНК синтезируют олигонуклеотид 2 для гибридизационного скрининга фаговой библиотеки генов Penicillium canescens 20171 (ВКПМ F178): 5' GATGGTGAAGCCATCCAACTTATG 3'. Этот зонд радиоактивно метят до высокой специфической активности (1х1010 имп/мин мг) с помощью терминальной трансферазы в буфере, содержащем 100 мм какодилата К, pH 7,0, 1 мМ дитиотреитола, 100 мкг/мл бычьего сывороточного альбумина, 100 нг зонда, 100 мкКи [α-32p]dATP и 20 ед. фермента в течение 1 ч при 37oC и добавляют в раствор для гибридизации (5х раствор Денхардта, 6х SSC, 0,5% SDS, 0,2 мг/мл ДНК спермы лосося) до конечной концентрации 106 имп/мин мг. Фаговые бляшки переносят на нейлоновые фильтры и инкубируют в указанном растворе в течение ночи, плавно снижая температуру с 65oC до комнатной, после чего отмывают фильтры от неспецифически связавшейся метки в растворе 4х SSC при 37oC. Фильтры экспонируют с рентгеновской пленкой. При анализе геномной библиотеки гриба Penicillium canescens 20171 данным методом из 3·104 рекомбинантных фагов выделено 22 клона, из которых был выбран клон PCG12, который несет фрагмент ДНК PCG12, кодирующий секретируемую β-галактозидазу, что было доказано следующим образом. При введении клонированного фрагмента ДНК PCG12 в геном гриба Aspergillus nidulans с помощью трансформации последний начинает секретировать b-галактозидазу, по признакам (молекулярная масса, иммуннологические тесты) неотличимую от фермента Penicillium canescens 20171. Анализ нуклеотидной последовательности ДНК фрагмента PCG12, определенной методом Сенгера с соавт. (Sanger et al. PNAS (1997), v.74, p.5463), показывает, что аминокислотная последовательность b-галактозидазы, установленная путем транслирования кодирующей рамки считывания совпадает с последовательностью аминокислот N-концевой части молекулы b-галактозидазы.
Далее получают плазмиду pPCG12, несущую фрагмент ДНК PCG12, кодирующий b-галактозидазу. 2 мкг ДНК клона PCG12, содержащего фрагмент ДНК PCG12 с геном b-галактозидазы, обрабатывают в течение 1 ч при 37oC 20 ед. рестриктазы EcoRI и затем образовавшиеся фрагменты лигируют с 0,1 мкг плазмиды pTZ19R (Pharmacia catalog, 1986), предварительно расщепленную той же эндонуклеазой рестрикции. Лигирование проводят в течение ночи при 16oC, добавляя в пробу 2 ед. ДНК-лигазы фага Т4. Клоны, содержащие фрагмент ДНК с данным геном, отбирают путем гибридизации с радиоактивно меченым зондом 2, после чего проверяют ориентацию вставки в полученной плазмиде pPCG12.
Пример 2. Получение штамма Penicillium canescens PCG12-38 с увеличенной активностью секретируемой b-галактозидазы.
Для решения этой задачи требуется система трансформации, позволяющая внедрять в геном штамма Penicillium canescens дополнительные копии гена b-галактозидазы. Штамм-реципиент Penicillium canescens PCA10, необходимый для трансформации, получен селекцией штамма Penicillium canescens F178 после мутагенеза нитрозогуанидином по признаку устойчивости к хлорату, что коррелирует с утратой активности нитратредуктазы. Полученный штамм Penicillium canescens PCA10 обладает способностью к росту на средах с органическими источниками азота, но неспособен утилизировать нитратный азот. Генетический дефект в полученном штамме затрагивает признак niaD, т.к. при трансформации штамма PCA10 плазмидой pSTA10, несущей ген с нитратредуктазой niaD Aspergillus niger (Unkles et al. Gene (1989), v.78, p.157), утраченный фенотип восстанавливается.
Штамм-реципиент PCA10 выращивают в течение 16ч при 30oC на полной питательной среде следующего состава: пептон 3г/л, дрожжевой экстракт 2 г/л, KCl 0,52 г/л, KH2PO4 1,52 г/л, и 10 мМ NH4Cl в качестве источника азота, pH 6,5. Далее мицелий переносят в раствор 1.2 М MgSO4 и 10 мМ NaH2PO4, pH 5,8 и добавляют лизирующие ферменты Trichoderma reesei до концентрации 3 мг/мл. Протопластирование проводят в течение 1ч при 30oC при перемешивании. Протопласты собирают центрифугированием в ступенчатом градиенте плотности 0,6 М сорбитола, промывают 2 раза в стабилизирующем растворе, содержащем 1,2 М сорбитола, 10 мМ Трис, pH 7,5, 10мМ CaCl2 и суспендируют в нем же при концентрации 108 протопластов/мл. Трансформацию проводят следующим образом: в 100 мкл суспензии протопластов добавляют 1 мкг ДНК плазмиды pSTA10 (Unkles et al. 1989), несущей в качестве селективного маркера ген нитратредуктазы Aspergillus niger, и 10-20-кратный избыток плазмиды pPCG12 с геном b-галактозидазы Penicillium canescens, инкубируют при комнатной температуре 20 мин, после чего проводят осмотический шок 5 мин в 50%-ном растворе полиэтиленгликоля и высевают протопласты на среду следующего состава: 1,2 М сорбитола, агаризованная среда Чапека с 10 мМ NaNO3. Через 4-5 сут инкубации при 30oC проводят скрининг полученных контрансформантов, анализируя уровень b-галактозидазной активности в культуральной жидкости при глубинном культивировании на среде со свекловичным жомом и БВК (см. пример 3). Наиболее продуктивным является штамм PCG12-38.
Пример 3. Ферментация штамма Penicillium canescens PCG12-38, и оценка его продуктивности.
Для получения исходного посевного материала культуру штамма PCG12-38 выращивают на агаризованной среде Роулен-Тома при 30oC в течение 5-7 сут. Водной суспензией конидий (107 конидий/мл) инокулируют 100 мл ферментационной среды, содержащей свекловичный жом 30 г/л, белково-витаминный концентрат 50 г/л, KH2PO4 25 г/л, pH 4,5. Культивирование проводят в колбе Эрленмейера при 30oC 96 часов на круговой качалке, при 240-250 об/мин. По окончании ферментации культуральную жидкость отделяют от мицелия и твердых остатков среды центрифугированием (10000g, 15 мин) и в супернатанте определяют активность b-галактозидазы. Реакционную смесь, содержащую 3 мг ОНФГ в 1,9 мл 50мМ Na-ацетатного буфера pH 4,5 и 100 мкл культуральной жидкости соответствующего разведения, инкубируют 15 мин при 30oC, а затем добавляют 1 мл 1М Na2CO3 и измеряют оптическую плотность раствора при 420 нм. За единицу активности b-галактозидазы принимают количество фермента, которое освобождает из субстрата 1 мкмоль О-нитрофенола в 1 мин при данных условиях реакции. Активность фермента за 96 ч ферментации в разных опытах составляет 190-220 ед/мл.
Предлагаемое изобретение позволяет в 3-4 раза повысить продуктивность мицелиального гриба Penicillium canescens в отношении секретируемой b-галактозидазы и пропорционально увеличить ее долю среди всех белков секретируемых этим грибом. Полученный положительный эффект предлагаемого изобретения достигается за счет свойств клонированного фрагмента ДНК PCG12, несущего ген, кодирующий синтез секретируемой b-галактозидазы.
Формула изобретения: 1. Фрагмент ДНК PCG12 размером 4,2 т.н.п. кодирующий синтез β-галактозидазы Penicillium canescens 20171, полученный путем выделения из фаговой библиотеки генов Penicillium canescens 20171 с помощью синтезированных олигонуклеотидных зондов с нуклеотидной последовательностью 5ʹTCAGTCCCAIGTIACAGTATCCCTCTG 3ʹ, и 5'GATGGTGAAGCCATCCAACTTATG 3', с 5'регуляторной областью с нуклеотидной последовательностью 5' концевой части гена β-галактозидазы: (см. стр. 211)
2. Штамм грибов Penicillium canescens ВКПМ F-715 продуцент β-галактозидазы.