√лавна€ страница  |  ќписание сайта  |   онтакты
ћќЋ≈ ”Ћј Ќ” Ћ≈»Ќќ¬ќ…  »—Ћќ“џ (¬ј–»јЌ“џ), ¬≈ “ќ– Ё —ѕ–≈——»» »Ћ»  ЋќЌ»–ќ¬јЌ»я, —»Ќ“≈“»„≈— »… ѕќЋ»ѕ≈ѕ“»ƒ, —ѕќ—ќЅ ѕќЋ”„≈Ќ»я —»Ќ“≈“»„≈— ќ√ќ ѕќЋ»ѕ≈ѕ“»ƒј,  ќћѕќ«»÷»я ¬ј ÷»Ќџ ƒЋя —“»ћ”Ћ»–ќ¬јЌ»я »ћћ”ЌЌќ… –≈ј ÷»» ѕ–ќ“»¬ √≈Ћ№ћ»Ќ“Ќџ’ ѕј–ј«»“ќ¬ ” „≈Ћќ¬≈ ј »Ћ» ∆»¬ќ“Ќџ’, —ѕќ—ќЅ —“»ћ”Ћя÷»» »ћћ”ЌЌќ… –≈ј ÷»» ѕ–ќ“»¬ √≈Ћ№ћ»Ќ“Ќџ’ ѕј–ј«»“ќ¬ ” „≈Ћќ¬≈ ј »Ћ» ∆»¬ќ“Ќџ’, ќЋ»√ќ—ј’ј–»ƒ
ћќЋ≈ ”Ћј Ќ” Ћ≈»Ќќ¬ќ…  »—Ћќ“џ (¬ј–»јЌ“џ), ¬≈ “ќ– Ё —ѕ–≈——»» »Ћ»  ЋќЌ»–ќ¬јЌ»я, —»Ќ“≈“»„≈— »… ѕќЋ»ѕ≈ѕ“»ƒ, —ѕќ—ќЅ ѕќЋ”„≈Ќ»я —»Ќ“≈“»„≈— ќ√ќ ѕќЋ»ѕ≈ѕ“»ƒј,  ќћѕќ«»÷»я ¬ј ÷»Ќџ ƒЋя —“»ћ”Ћ»–ќ¬јЌ»я »ћћ”ЌЌќ… –≈ј ÷»» ѕ–ќ“»¬ √≈Ћ№ћ»Ќ“Ќџ’ ѕј–ј«»“ќ¬ ” „≈Ћќ¬≈ ј »Ћ» ∆»¬ќ“Ќџ’, —ѕќ—ќЅ —“»ћ”Ћя÷»» »ћћ”ЌЌќ… –≈ј ÷»» ѕ–ќ“»¬ √≈Ћ№ћ»Ќ“Ќџ’ ѕј–ј«»“ќ¬ ” „≈Ћќ¬≈ ј »Ћ» ∆»¬ќ“Ќџ’, ќЋ»√ќ—ј’ј–»ƒ

ћќЋ≈ ”Ћј Ќ” Ћ≈»Ќќ¬ќ…  »—Ћќ“џ (¬ј–»јЌ“џ), ¬≈ “ќ– Ё —ѕ–≈——»» »Ћ»  ЋќЌ»–ќ¬јЌ»я, —»Ќ“≈“»„≈— »… ѕќЋ»ѕ≈ѕ“»ƒ, —ѕќ—ќЅ ѕќЋ”„≈Ќ»я —»Ќ“≈“»„≈— ќ√ќ ѕќЋ»ѕ≈ѕ“»ƒј,  ќћѕќ«»÷»я ¬ј ÷»Ќџ ƒЋя —“»ћ”Ћ»–ќ¬јЌ»я »ћћ”ЌЌќ… –≈ј ÷»» ѕ–ќ“»¬ √≈Ћ№ћ»Ќ“Ќџ’ ѕј–ј«»“ќ¬ ” „≈Ћќ¬≈ ј »Ћ» ∆»¬ќ“Ќџ’, —ѕќ—ќЅ —“»ћ”Ћя÷»» »ћћ”ЌЌќ… –≈ј ÷»» ѕ–ќ“»¬ √≈Ћ№ћ»Ќ“Ќџ’ ѕј–ј«»“ќ¬ ” „≈Ћќ¬≈ ј »Ћ» ∆»¬ќ“Ќџ’, ќЋ»√ќ—ј’ј–»ƒ

ѕатент –оссийской ‘едерации
—уть изобретени€: »зобретение направлено на создание вакцины дл€ стимулировани€ иммунной реакции против гельминтных паразитов у человека и животных. ¬акцина содержит фармацевтически приемлемый носитель, а также носитель нуклеиновой молекулы, котора€ способна кодировать гельминтные энзимы аминопептидазы. »спользование изобретени€ позвол€ет получить новые лекарства дл€ борьбы с гельминтами человека и животных. 9 с. и 4 з.п. ф-лы, 21 ил., 4 табл.
ѕоиск по сайту

1. — помощью поисковых систем

   — помощью Google:    

2. Ёкспресс-поиск по номеру патента


введите номер патента (7 цифр)

3. ѕо номеру патента и году публикации

2000000 ... 2099999   (1994-1997 гг.)

2100000 ... 2199999   (1997-2003 гг.)
Ќомер патента: 2140986
 ласс(ы) патента: C12N15/30, C07K9/00, A61K39/00
Ќомер за€вки: 94046017/13
ƒата подачи за€вки: 07.05.1993
ƒата публикации: 10.11.1999
«а€витель(и): Ѕиотекнолоджи энд Ѕиолоджикал —айенсиз –исерч  аунсил (GB)
јвтор(ы): ћаргарет √рэхэм (GB); “ревор —тэнли —мит (GB); Ёдвард јльберт ћанн (GB); ƒэвид ѕатрик  нокс (GB); ƒжоанна ƒжейн ќливер (GB); —ьюзан Ёлизабет Ќьютон (AU)
ѕатентообладатель(и): Ѕиотекнолоджи энд Ѕиолоджикал —айенсиз –исерч  аунсил (GB)
ќписание изобретени€: –екомбинантные молекулы ƒЌ , кодирующие энзимы - аминопептидазы, и их использование дл€ получени€ вакцин против инфекций, вызываемых гельминтами.
Ќасто€щее изобретение относитс€ к получению защитных антигенов с помощью технологии рекомбинантных ƒЌ , дл€ использовани€ в качестве антигельминтных агентов и в качестве защитных иммуногенов дл€ борьбы с заболевани€ми, вызываемыми гельминтными паразитами.
“акие паразиты, как гельминты, ответственны за широкий круг заболеваний и заражений паразитами (инвазий) домашних животных, которые привод€т к потере продуктивности и даже к гибели животных, что имеет существенное экономическое значение. “ак, например, кровососущие нематоды Haemonchus инфицируют выстилку желудочно-кишечного тракта жвачных, что вызывает анемию и потери веса, а если не проводить лечени€, это часто кончаетс€ гибелью животных. јналогично, животные, инфицированные некровососущими нематодами Ostetagia не дают привеса и без лечени€ могут погибнуть. ƒругие рода гельминтов, представл€ющие экономическую важность, включают Trichostrongylus and Nematodirus, которые вызывают энтериты у различных животных, и трематоды.
ѕроблемы создают и такие нематоды, как анкилостомы (например, Necator, Ancylostoma, Uncinaria and Bunostomumbugu) и трематоды (например, Fasciola, Paramphistomum and Dicrocoelium) и их родственники, которые помимо жвачных и домашних животных инфицируют людей, и часто с фатальным исходом.
¬ насто€щее врем€ борьба с паразитами-гельминтами основываетс€, главным образом, на применении антигельминтных препаратов, нар€ду с обработкой пастбищ. “акие способы имеют р€д недостатков, частое введение лекарств и обработка пастбищ обычно непрактична и приводит к усиливающему распространению устойчивых штаммов гельминтов.
ѕоэтому существует необходимость в создании эффективных антигельминтных вакцин, и за последние годы в этой области были сконцентрированы усили€ ученых. ќднако до сих пор не существует коммерчески доступных молекул€рных или субъединичных вакцин против основных видов гельминтов, особенно против желудочно-кишечных нематод жвачных, таких как Haemonchus и Ostertagia.
Ќаиболее обещающие на насто€щее врем€ результаты были получены с новыми протеинами, выделенными из Haemonchus, обладающими потенциалом в качестве защитных антигенов не только против Haemonchus, но и также против р€да других гельминтов. ¬ частности, показано, что протеиновый дублет H110D, обнаруженный на люминальной поверхности кишечника H. contortus, обладает защитным иммунитетом против Haemonchus у овец.
H110D из H. contortus имеет приблизительный молекул€рный вес 110 килодальтон (кд) в восстанавливающих и невосстанавливающих услови€х, что определено с помощью SDS-PAGE и описано в WO 88/00835 и WO 90/11086. “ермин "H110D" в том смысле, как здесь использован, относитс€ к протеиновому дублету Ќ110D, как определено в WO 88/00835 и WO 90/11086.  ак недавно было показано, соответствующие протеины наход€тс€ и в других видах гельминтов, например, Nеcator americanus.
¬ WO 88/00835 был описан р€д способов выделени€ Ќ110D, что достаточно дл€ характеристики протеина, и они могут быть масштабированы, чтобы обеспечить получение протеина в экспериментально и коммерчески подход€щих количествах. ќднако существует необходимость в улучшенных и более удобных источниках, из которых можно получать но только H110D, но также и родственные антигенные протеины, особенно дл€ процессов, основанных на технологии рекомбинантных ƒЌ  и экспрессии протеинов в соответствующим образом трансформированных прокариотических и эукариотических организмах.
Ќасто€щее изобретение посв€щено поискам такого усовершенствованного способа. ќпределение последовательности кƒЌ  дл€ H110D из Haemonchus contortus было осуществлено, и было обнаружено, что предсказанна€ аминокислотна€ последовательность демонстрирует гомологию с семейством интегральных мембранных аминопептидаз (систематическое название: α -аминоацил-пептид- гидролаза/микросомна€).
” млекопитающих интегральные мембранные аминопептидазы расположены в нескольких ткан€х, например, на кра€х щетки микроворсинок кишечника и в почках. »х роль в почках не€сна, но в кишечнике их функцией €вл€етс€ расщепление мелких пептидов, которые представл€ют собой конечный продукт переваривани€ (см. Kenny и Maroux, 1982; Kenny и Turner, 1987; Noren et al, 1986; Semenza, 1986).
¬ одном аспекте насто€щего изобретени€, таким образом, предложены молекулы нуклеиновых кислот, содержащие одну или более из нуклеотидных последовательностей, которые кодируют гельминтные энзимы-аминопептидазы или их антигенные участки, практически соответствующие всей или части нуклеотидных последовательностей, представленных на фиг. 2, 3, 4 или 5 (последовательности ID N 1-15) или последовательностей, кодирующих гельминтные энзимы-аминопептидазы, которые практически гомологичны любой из указанных последовательностей, или гибридизуютс€ с ними.
“аким образом, нуклеинова€ кислота в соответствии с насто€щим изобретением может быть однонитевой или двунитевой ƒЌ , кƒЌ  или –Ќ .
¬ариации нуклеотидных последовательностей, кодирующих аминопептидазы, могут наблюдатьс€ между различными штаммами гельминтов внутри вида, между различными стади€ми жизненного цикла гельминтов (например, между личинками и взрослыми особ€ми), между аналогичными штаммами различного географического происхождени€, а также внутри одного и того же гельминта. “акие вариации также включены в объем насто€щего изобретени€.
“ермин "практически гомологичны" здесь используют в смысле, который включает последовательности, в которых идентичность последовательностей составл€ет приблизительно 50% или более, например 60% или более, а также функционально-эквивалентные аллельные варианты и родственные последовательности, модифицированные замещением одного или нескольких оснований, их добавлением и/или делецией. ѕод "функционально эквивалентными" подразумевают последовательности нуклеиновых кислот, которые кодируют полипептиды, имеющие аминопептидазные активности, которые аналогично иммунореактивны, т.е. те, которые вызывают выработку защитных антител хоз€ина против гельминтов.
ћолекулы нуклеиновых кислот, которые гибридизуютс€ с последовательност€ми, представленными на фиг. 2, 3, 4 или 5 (последовательности ID N 1-15), или любые существенно гомологичные или функционально-эквивалентные последовательности, как указано ранее, также включены в объем изобретени€. “ермин "гибридизаци€" в том смысле, как здесь использован, определ€ет св€зывание последовательностей в нежестких услови€х (6 х SSC/50% формамида при комнатной температуре) (SSC - раствор хлорида и цитрата натри€) и промывку в м€гких услови€х (2 х SSC, комнатна€ температура, более предпочтительно - 2 х SSC, 42oC), или в более жестких услови€х, например 2 х SSC, 65oC), где SSC - 0,15 ћ NaCl, 0,015 ћ цитрата натри€, pH 7,2).
—пособы получени€ таких производных родственных последовательностей, например, сайт-направленным мутагенезом, статистическим мутагенезом или в результате энзиматического расщеплени€, и/или лигировани€ нуклеиновых кислот, хорошо известны специалистам, как и способы определени€ наличи€ значительной гомологии между модифицированной таким образом нуклеиновой кислотой и подлинной последовательностью, например, с помощью гибридизации.
“аким образом, получение молекулы нуклеиновой кислоты по способу насто€щего изобретени€ позвол€ет получать рекомбинантные аминопептидазы, или их иммуногенные фрагменты, в количествах, до сих пор недоступных, и, следовательно, позвол€ет разрабатывать антигельминтные вакцины.
¬ другом аспекте насто€щего изобретени€ предложены молекулы нуклеиновых кислот, содержащие одну или более из нуклеотидных последовательностей, кодирующих один или более из полипептидов, способных вызывать выработку защитных антител против гельминтных паразитов, причем эти последовательности включают один или более из участков, кодирующих антигенную детерминанту, как показано на фиг. 2, 3, 4 или 5 (последовательности ID N 1-15).
Ќасто€щее изобретение относитс€ также к синтетическим полипептидам, содержащим одну или более из аминокислотных последовательностей, составл€ющих энзим-аминопептидазу или его антигенную часть, практически соответствующую всей или части нуклеотидных последовательностей, представленных на фиг.2, 3, 4 или 5 (последовательности ID N 1-15), или их функционально-эквивалентных вариантов, отличных от синтетического полипептида, соответствующего протеиновому дублету Ќ110D, или синтетического полипептида, соответствующего любой из отдельных полипептидных последовательностей, раскрытых в WO 90/11086.
¬ другом варианте в насто€щем изобретении предложен синтетический полипептид, содержащий аминокислотную последовательность, составл€ющую энзим-аминопептидазу или его антигенную часть, практически соответствующую всей или части нуклеотидных последовательностей, представленных на фиг.2, 3, 4 или 5 (последовательности ID N 1-15) или их функционально-эквивалентных вариантов, практически не содержащих других Haemonchus contortus компонентов.
ƒалее насто€щее изобретение относитс€ к композици€м вакцин дл€ стимул€ции иммунных реакций против гельминтных паразитов у людей или животных, содержащим, по крайней мере, один синтетический полипептид, определенный ранее, нар€ду с фармацевтически приемлемым носителем.
¬ WO 90/11086 раскрыт р€д полипептидных или частично полипептидных последовательностей, полученных в результате протеолитического расщеплени€ или химического расщеплени€ протеинового дублета Ќ110D: (в конце описани€).
Ќеопределенности обозначены либо такой формой, как Phe/Gly, где первый трехбуквенный кодон представл€ет, по всей веро€тности, правильную аминокислоту на основании силы сигнала, или знаком вопроса; знак "-" обозначает неизвестный остаток.
—пецифические индивидуальные полипептиды последовательности, которые раскрыты в WO 09/11086, но включены в формулу.
“ермин "полипептид", в том смысле, как использован здесь, включает как протеин полной длины, так и более короткие пептидные последовательности.
“ермин "функциональный эквивалент" используют в отношении полипептидной аминокислотной последовательности, котора€ определ€ет полипептиды, родственные с или полученные из вышеуказанных полипептидных последовательностей, в которых аминокислотна€ последовательность модифицирована одиночным или множественным замещением, добавлением или делецией аминокислоты, а также последовательностей, в которых аминокислоты модифицированы химически, включа€ способы гликозилировани€ или дегликозилировани€, но которые, тем не менее, сохран€ют защитную (иммуногенную) активность. “акие функционально-эквивалентные варианты могут встречатьс€ как природные биологические вариации, или их можно получить, использу€ известные методики, например, функционально-эквивалентные рекомбинантные полипептиды можно получить, использу€ известные методики сайт-направленного мутагенеза, статистического мутагенеза или энзиматическое расщепление и/или лигирование аминокислот.
ќбычно синтетический полипептид насто€щего изобретени€ представл€ет защитные антигенные последовательности.
“ермин "защитный антиген" используют дл€ обозначени€ антигенов, способных вызывать защищающую хоз€ина (иммуногенную) иммунную реакцию, т.е. реакцию хоз€ина, котора€ приводит к выработке иммунных эффекторных молекул, антител или клеток, которые стерилизуют оплодотвор€ющую способность источника поражени€, ингибируют или убивают паразита и тем самым "защищают" хоз€ина от клинического или субклинического заболевани€ и снижени€ продуктивности. “ака€ защитна€ иммунна€ реакци€ обычно может про€вл€тьс€ в виде выработки антител, которые способны ингибировать метаболические функции паразита, привод€ к задержке развити€, отсутствию продуцировани€ €иц и/или к гибели.
—интетические полипептиды в соответствии с этим аспектом насто€щего изобретени€ можно получить за счет экспрессии в хоз€йской клетке, содержащей рекомбинантную ƒЌ  молекулу, котора€ содержит нуклеотидную последовательность, подробно описанную ранее, оперативно св€занную с последовательностью, контролирующей экспрессию, или вектор клонировани€ рекомбинантной ƒЌ , или вектор, содержащий такую рекомбинантную ƒЌ  молекулу. ¬ другом варианте такие полипептиды можно экспрессировать непосредственной инъекцией выделенной молекулы ƒЌ  насто€щего изобретени€ в клетки хоз€ина.
Ёкспрессированный таким образом полипептид может быть полипептидом сли€ни€, содержащим участок, представл€ющий иммуногенность всего или части энзима аминопептидазы, и дополнительный полипептид, кодируемый слитой ƒЌ . “ак, например, может оказатьс€ желательным получить протеин сли€ни€, содержащий синтетическую аминопептидазу или другой полипептид насто€щего изобретени€, соединенный с таким протеином, как β- галактозидаза, фосфатаза, глютатион-S-трансфераза, уреаза, коровий антиген вируса гепатита B (Francis et al. , 1989) и т.п. Ѕольшинство протеинов сли€ни€ получают за счет экспрессии рекомбинантного гена, в котором две кодирующие последовательности соединены вместо в рамке считывани€. ¬ другом варианте полипептиды можно слить in vitro с помощью химических способов. ¬се такие сли€ни€ или производные гибридов аминопептидазу-кодирующих молекул нуклеиновых кислот и их соответствующих аминокислотных последовательностей вход€т в объем насто€щего изобретени€. “акие подход€щие методики экспрессии рекомбинантных ƒЌ  и полипептидов раскрыты, например, у Sambrook et al., 1989. ¬ другом варианте, синтетические полипептидазы можно получить химическими способами, например, хорошо известным способом твердофазного синтеза ћеррифильда.
ƒругие аспекты изобретени€ включают использование молекулы нуклеиновой кислоты, или синтетического пептида, или полипептида, как определено ранее, дл€ получени€ композиции вакцин дл€ стимул€ции иммунных реакций у людей или животных, предпочтительно, млекопитающих, против заболеваний, вызываемых гельминтными паразитами.
¬ другом варианте в насто€щем изобретении предложен способ стимул€ции иммунной реакции у людей или животных, предпочтительно млекопитающих, против инфекций, вызываемых гельминтными паразитами, включающий введение указанному животному композиции вакцины, включающей одну или более из пептидаз, кодируемых указанной ранее нуклеотидной последовательностью.
 омпозиции вакцин можно получить по способу насто€щего изобретени€ способами, известными специалистам в изготовлении вакцин. “радиционные вакцинные композиции могут содержать один или более из синтетических полипептидов по способу насто€щего изобретени€ вместе с подход€щим одним или более из соответствующих адъювантов, например, гидроксида алюмини€, сапонина, Quil A или более очищенных их форм, дипептида мурамила, минеральных масел или Novasomes, в присутствии одного или более из фармацевтически приемлемых носителей или разбавителей. ѕодход€щие носители включают такие жидкие среды, как физиологический раствор, подход€щие дл€ использовани€ в качестве носителей дл€ введени€ пептидов или полипептидов в пациента. ћогут быть включены такие дополнительные компоненты, как консерванты.
јльтернативные композиции вакцин могут содержать вирусы или клетки хоз€ина, например, микроорганизма (например, вирус осповакцины, аденовирус, Salmonella) со встроенной в них молекулой нуклеиновой кислоты (например, молекулой ƒЌ ) по способу насто€щего изобретени€ дл€ стимул€ции иммунной реакции, направленной против полипептидов, кодируемых встроенной молекулой нуклеиновой кислоты.
¬ведение композиции вакцины можно осуществить любым удобным способом, например, орально или парентерально, например, внутривенной инъекцией, необ€зательно с интервалами, например, в виде двух инъекций с интервалом 7-28 дней.
 ак было указано ранее, трансл€ци€ аминокислотных последовательностей, изображенных на фиг. 2, 3, 4 или 5, демонстрирует гомологию последовательностей с семейством интегральных мембранных аминопептидазных энзимов. Ёто было определено при поиске различных баз данных, доступных в пакете анализа последовательностей компьютерной группы генетиков, верси€ 7.01, но€брь 1991 (Devereux et al., 1984), использу€ трансл€ции последовательностей, представленных на фиг. 2, 3, 4 или 5. ƒва из таких сопоставлений представлены на фиг.6.
Ёкспрессию последовательностей, кодирующих аминопептидазу насто€щего изобретени€, можно, как это было указано ранее, осуществить, использу€ различные известные методики и системы экспрессии, включа€ экспрессию в таких прокариотических клетках, как E. coli, и в таких эукариотических клетках, как дрожжи или бакуловирусные системы клеток насекомых, или в трансформированных клетках млекопитающих и в трансгенных животных и растени€х. Ќаиболее выгодно экспрессировать нуклеотидные последовательности, использу€ трансгенные системы нематод, такие как систему дл€ нематод Caenorhabditis, описанную, например, у Fire (1986); Fire et al. (1989); Spieth et al. (1988); Han et al. (1990).
¬ следующем аспекте изобретение предлагает способ получени€ синтетического пептида, описанного ранее, который включает культивирование эукариотических или прокариотических клеток, содержащих молекулу нуклеиновой кислоты, как указано ранее, в услови€х, в которых осуществл€етс€ экспресси€ указанного полипептида, и выделение полученного таким образом указанного полипептида.
¬ дальнейшем аспекте изобретение включает клонирование векторов экспрессии, содержащих нуклеотидные последовательности изобретени€. “акие векторы экспрессии включают такие соответствующие контрольные последовательности, как например, элементы, контролирующие трансл€цию (например, кодоны старта и остановки) и транскрипцию (например, промотор-операторные участки, рибосомные св€зывающие сайты, терминальные стоп-последовательности), св€занные в считывающей рамке с молекулами нуклеиновых кислот насто€щего изобретени€.
¬екторы насто€щего изобретени€ могут включать плазмиды и вирусы (включа€ как бактериофаги, так и вирусы эукариотов), согласно хорошо известным и опубликованным способам, и могут быть экспрессированы в различных экспрессирующих системах, также хорошо известных специалистам. ѕодход€щие вирусные векторы включают, как было указано ранее, бакуловирусы, а также аденовирусы и вирус осповакцины. —пециалистам известно множество других вирусных векторов.
»звестны и могут быть использованы различные методики введени€ таких векторов в прокариотические и эукариотические клетки дл€ экспрессии, или в зародышевые или соматические клетки дл€ создани€ трансгенных животных. ѕодход€щие способы трансформации или трансфекции подробно описаны в литературе.
—ледующий аспект насто€щего изобретени€ составл€ют трансформированные или трансфектированные клетки эукариотических или прокариотических хоз€ев или трансгенные организмы, содержащие молекулы нуклеиновых кислот насто€щего изобретени€.
¬ообще эукариотические экспрессионные системы, и нематодна€ система экспрессии в частности, обладают тем преимуществом, что посттрансл€ционный процессинг и, в частности, гликозилирование, могут осуществл€тьс€ (в случае трансгенных нематодных систем можно ожидать гликолизирование, соответствующее тому, которое происходит в нативном протеине). Ёто составл€ет важный аспект изобретени€, так как во многих случа€х посттрансл€ционный процессинг необходим дл€ того, чтобы рекомбинантный протеин экспрессировал оптимум биологической активности.
—истемы экспрессии клеток млекопитающих также имеют р€д преимуществ.  летки млекопитающих обеспечивают хорошее воспроизведение нативной формы и защитных эпитопов антигена, так как эукариотическа€ экспрессионна€ система приводит к более подобному гликозилированию образцов, дисульфидным св€з€м и другим посттрансл€ционным модификаци€м, нежели E. coli, котора€ может продуцировать нерастворимый протеин, требующий восстановлени€ трехмерной организации и обладающий плохой репродукцией нативной формы.  роме того, гликозилирование у млекопитающих, по-видимому, не индуцирует иммунной реакции, котора€ отличаетс€ от защитной антипротеиновой реакции. ƒл€ защиты людей и домашних животных, таким образом, предпочтительно использовать фибробласты или миеломные клеточные линии человека или животных, такие, как HeLa - клеточна€ лини€ человека; BHK - клетки почек детеныша хом€ка; FR 3T3 - крысиные фибробласты ‘ишера; VERO - клеточна€ лини€ почек обезь€ны; NIH3T3 - клеточна€ лини€ фибробластов мышей; клеточна€ лини€ опухоли молочной железы мышей - C127I; CV-I - фибробласты почек африканской зеленой обезь€ны; 3T6 - фибробласты эмбриона мыши; L клетки - мышина€ клеточна€ лини€; CHO - клеточна€ лини€ €ичников китайского хом€ка; NSO NS1, SP2 и другие мышиные миеломные клеточные линии, и клеточные линии миелом у крыс, такие как YB2/0 и Y3.
—пециалистам хорошо известны векторы, соответствующие различным классам клеточных линий млекопитающих. ќбычно они содержат промотор и/или энхансер, операбельно св€занный с нуклеотидной последовательностью, кодирующей антиген или его фрагмент. ѕодход€щие промоторы включают ранний или поздний промоторы SV40, например, PSVL вектор, промотор цитомегаловируса (CMV), промотор металлотионеина I мыши и длинный терминальный повтор вируса опухоли молочной железы мыши. Ётот вектор, предпочтительно, включает подход€щий маркер, такой как ген дигидрофолатредуктазы или глутамин-синтетазы. ¬екторы этих типов описаны в WO 86/05807, WO 87/04462, WO 89/01036 и WO 89/10404.
“рансфекцию клеток хоз€ев можно осуществить, использу€ стандартные методики, например, использу€ фосфат кальци€, ƒ≈ј≈ декстран, полибрен, протопластное сли€ние, липосомы, пр€мую микроинъекцию, генную бомбардировку или электропорацию. ѕоследн€€ методика предпочтительна и способы трансфекции клеточных линий млекопитающих с использованием электропорации раскрыты Andreason et al., 1980. ¬ообще, линейную ƒЌ  вводить легче, нежели циркул€рную ƒЌ .
¬ случае протеина H110D, было обнаружено, что он имеет уникальную и необычную схему гликозилировани€, котора€, по-видимому, вносит вклад в иммуноактивность, так как многие моноклональные антитела до сих пор полученные против Ќ110D из Haemonchus распознают углеводные эпитопы, которые могут оказатьс€ важными при разработке нужных вакцин.
¬ частности, был продемонстрирован следующий набор гликозилировани€ дл€ Ќ110D из Haemonchus:
i) около 65% олигосахаридов N-св€заны, остальные O-св€заны;
ii) основна€ часть (около 48%) N-св€занных олигосахаридов принадлежит к сложному классу;
iii) практически все (более 95%) олигосахариды не имеют зар€да;
iv) относительное мол€рное содержание составл€ющих моносахаридов таково: N-ацетилгалактозамин 1,0, фукоза 3,6, галактоза 4,1, глюкоза 4,4, манноза 6,2 и N-ацетилглюкозамин 5,2;
v) олигосахариды, отличающиес€ от основного олигосахарида (обозначаемого олигосахарид D), практически устойчивы к деградации в широком интервале экзо-гликозидаз (например, α- D-маннозидазы, β- D-маннозидазы, β- D-глюкозидазы, β- D-галактозидазы, α- D-галактозидазы, α- L-фукозидазы, β- D-ксилозидазы, β- D-N-ацетилглюкозаминидазы).
“акие олигосахариды и гликопротеины, содержащие их, составл€ют следующий аспект насто€щего изобретени€.
ќлигосахарид D из Haemonchus H110D гликопротеина относитс€ к N-св€занному типу и имеет новую структуру, состо€щую из двух фукозных остатков, соединенных через α- 1,3 св€зь и α- 1,2 св€зь с €дром маннозы (N-ацетилглюкозамин).
“аким образом, в другом аспекте насто€щего изобретени€ предложен олигосахарид формулы

и более конкретно формулу

особенно, если св€зан с протеином, например, таким рекомбинантным протеином, как протеин гельминтной аминопептидазы или ее антигенный фрагмент, или если используют дл€ создани€ антиидиопатических антигенов дл€ иммунизации, особенно очень молодых животных.
√ликопротеины животных обычно содержат α- 1,6-фукозную св€зь, и поэтому α- 1,3-фукозна€ св€зь олигосахарида насто€щего изобретени€ представл€етс€ необычной характеристикой.
ƒалее насто€щее изобретение будет более подробно описано дл€ Ќ110D из Haemonchus contortus. ќднако, в результате использовани€ таких методик, как гистохими€ и ƒЌ  гибридизаци€, Ќ110D эквиваленты наблюдались и в других видах паразитов. —читают, что Ќ110D протеин представл€ет собой мультигенный комплекс, и, кроме того, нуклеотидна€ кодирующа€ его последовательность может демонстрировать вариации между различными штаммами и различными жизненными циклами развити€ гельминтов. Ѕолее того, существует множество энзимных форм (изоэнзимы), которые могут по-разному экспрессироватьс€ на различных стади€х или в различных штаммах.
¬ насто€щем исследовании ƒЌ  последовательности и, следовательно, предсказанные аминокислотные последовательности были определены из кƒЌ  клонов и PCR продуктов, полученных из м–Ќ , соответствующих H110D гену, за счет технологии рекомбинантных ƒЌ  из различных источников, и дл€ различных стадий развити€ паразитов H. contortus жизненного цикла.
—еквенирование кƒЌ  и PCR продуктов позволило нам идентифицировать три близко родственные H110D последовательности, которые обозначены H11-1 (последовательность ID N 19), H11-2 (последовательность ID N 20) и H11-3 (последовательность ID N 21). H11-1 содержит три непрерывные и перекрывающиес€ последовательности, кƒЌ  клон Aust B1 (последовательность ID N 6), PCR продукт ј-648 (последовательность ID N 9) и с 3' конца PCR продукт 014-178 (последовательность ID N 12); H11-2 содержит PCR продукты ј-650 и 2,5 кb (последовательность ID N 10 и 7 соответственно); H11-3 содержит PCR продукты 3,5 кb и ј-649 (последовательности ID N 8 и 11 соответственно). —пецифическое взаимоотношение между клонами индивидуальной секвенированной кƒЌ  и PCR продуктов и H11-1, H11-2 и H11-3 суммированы на фиг.1 и детально изображены на фиг.3, 4 и 5.
Ќаблюдаемые различи€ и вариации в последовательност€х, полученных из кƒЌ  клонов и PCR продуктов, которые видны, в частности, на фиг. 2, 3, 4 и 5 (состо€щих из последовательностей ID NN 1-15 и 19-21) представлены в таблице 1.
Ќаблюдаемые различи€ можно приписать различным мƒЌ  (мультигенного семейства).  роме того, вариации могут быть св€заны, по крайней мере, частично, с различными вариантами H110D-кодирующей последовательности или м–Ќ , присутствующей на различных стади€х жизненного цикла или в штаммах различного географического происхождени€.
¬ таблице 2 дополнительно представлены уровни идентичности и сходства дл€ соответствующих предсказанных аминокислотных последовательностей и двух опубликованных последовательностей аминопептидаз млекопитающих.
‘иг.1 демонстрирует карту секвенированных клонов кƒЌ  и PCR продуктов H. contortus H110D и их соотношени€ и относительные положени€ с Ќ110D м–Ќ .
‘иг. 2 представл€ет H110D нуклеотидные последовательности, обозначенные H11-3 (последовательность ID N 21, полученна€ из клонированных PCR продуктов последовательностей ID N 8 и 11 и кƒЌ  клона M1AUS, последовательности ID N 5), H11-2 (последовательность ID N 20, полученна€ из клонированных PCR продуктов последовательностей ID N 7 и 10) и H11-1 (последовательность ID N 19, полученна€ из клонированных PCR продуктов последовательностей ID N 9 и 12 и кƒЌ  клона Aust B1, последовательности ID N 6).
‘иг.3 представл€ет последовательность H11-3 (последовательность ID N 21) (представлена на фиг. 2) с параллельно расположенными кƒЌ  клонами M1 и M1AUS (последовательности ID N 1 и 5).
Ќа фиг. 4 представлена последовательность H11-2 (последовательность ID N 20, представлена на фиг.2) и выравненный кƒЌ  клон B2 (последовательность ID N 4).
Ќа фиг.5 представлена последовательность, обозначенна€ H11-1 (последовательность ID N 19) и выравненный кƒЌ  B1A и Aust B1 (последовательности ID N 2 и 6 соответственно).
Ќа фиг. 6 представлены: а) предсказанные аминокислотные последовательности (последовательности ID N 22, 23 и 24), полученные из ƒЌ  последовательностей H11-1, H11-2 и H11-3, представленных на фиг.2; bi) и ii) представл€ют предсказанную аминокислотную последовательность H11-3 в сравнении с опубликованной аминокислотной последовательностью микросомной аминопептидазы крыс ћ (Watt et al., 1989) и микросомной аминопептидазы мышей A (Wu et al., 1990) соответственно; идентичные части заключены в пр€моугольники, пунктиром обозначены участки, введенные дл€ максимизации уровн€ гомологичности сравниваемых последовательностей. »спользован обычный однобуквенный код дл€ аминокислот. √оризонтальна€ лини€ над последовательностью указывает положение трансмембранного участка, а звездочки указывают положение цинк-св€зывающего фрагмента. ”ровни сходства указаны в таблицах 1 и 2.
Ќа фиг. 7 представлены выравнивание аминокислотных последовательностей (обозначенных Pep A, Pep ¬, Pep C, Pep D и Pep ≈), полученных из C NBr и Lys-C фрагментов H110D, как было ранее описано (международна€ патентна€ за€вка WO 90/11086 и как перечислено ранее, полипептидных последовательностей (a), (b), (e) (k) и (aa) соответственно) и трех новых последовательностей (последовательности ID N 16, 17 и 18), полученных из H110D после переваривани€ эластазой или термолизином с трансл€ци€ми a) H11-1, b) H11-2 и с) H11-3.
¬ следующем аспекте изобретени€ предложены молекулы нуклеиновых кислот, содержащие одну или более из нуклеотидных последовательностей, которые практически соответствуют или которые практически комплементарны одной или более из последовательностей, выбранных из клонов M1, B1A, B1A-3', B2, M1AUS, Aust B1, 014-015 (2,5PCR), 014-872 (3,5PCR клон 2), A-648 (5' конец B1), A-650 (5'конец 2,5PCR), A-649 (5' конец 3,5PCR), 014-178 (3' конец Aust B1 клона 2), 014-178 (3' конец Aust B1 клонов 3 и 6), 014-872 (3,5PCR клона 10) и 014-872 (3,5PCR клона 19), H11-1, H11-2 и H11-3, последовательности ID N 1-15 и 19-21 соответственно, как представлено на фиг.2, 3, 4 и 5 или последовательности, которые практически гомологичны с любой из этих последовательностей или гибридизуютс€ с ними.
 ак указано ранее было, сравнение последовательностей различных указанных ранее клонов с компьютерными базами данных известных последовательностей вы€вл€ет существенную гомологию с семейством микросомных аминопептидазных энзимов (EC.3.4.11. -). »сследовани€ энзиматической активности и ингибирующей способности, осуществленные дл€ Ќ110D протеина и его субфракций, подтверждают, что протеин на самом дело €вл€етс€ микросомной аминопептидазой ( α -аминоацил-пептид-гидролазой (микросомной)). Ёти исследовани€ показали далее, что про€вл€ютс€ как аминопептидаза A-подобные, так и аминопептидаза N-подобные активности, и что каждый из компонентов Ќ110D дублета отдельно демонстрирует энзиматическую активность.
»сследовани€ протеолитического расщеплени€ Ќ110D также проводились. »спользу€ энзим-эластазу, удалось обнаружить, что Ќ110D может быть расщеплен частично, образу€ при этом две фракции, детергент-растворимую фракцию (котора€ остаетс€ с мембраной) и водорастворимую фракцию (котора€ обозначаетс€ Ќ11S). Ќ11S существует в виде протеинового димера, который можно разделить на два компонента. »нтересно, что было обнаружено, что только подобна€ аминопептидазе ћ активность св€зана с водорастворимой Ќ11S фракцией, тогда как аминопептидаза A-подобна€ активность св€зана только с детергент-растворимой фракцией.
¬ следующих далее примерах приводитс€ описание исследований, которые привели к определению последовательностей, представленных на фиг.1-7, со ссылкой на следующие дополнительные фигуры.
Ќа фиг. 8 представлены результаты ¬естернблоттинга интегральных мембранных протеинов, присутствующих в детергентном экстракте Haemonchus contortus взрослых особeй, зондированных аффинно-очищенными антителами, элюированными из потенциальных H110D клонов; а) антигены в детергентном экстракте Haemonchus, распознаваемые антисывороткой к экстракту; b) антитела, элюированные из полоски так, как показано в a), тестированные снова против блота детергентного экстракта, подтверждают успех стадии элюировани€; с) антитела, что и в b), которые св€зываютс€ с клоном M1 экспрессированного протеина, четко распознают участок 110 кb (и относительно узкую полосу около 205 кb; d) св€зывани€ антител не происходит, если дл€ абсорбции сыворотки используют не рекомбинанты;
Ќа фиг. 9 представлен Ќозернблоттинг м–Ќ  выделенных из 11-, 15- и 23-дневных Haemonchus contortus зондированных a) кƒЌ  клоном M1 (последовательность ID N 1); b) кƒЌ  клоном M1 AUS (последовательность ID N 5); c) кƒЌ  клоном B1A (последовательность ID N 2 и 3); d) кƒЌ  клоном Aust B1 (последовательность ID N 6); е) клонированным PCR продуктом 014-872 (3,5-2, последовательность ID N 8); и f) клонированным PCR продуктом 014-015 (последовательность ID N 7). Ќомера 11, 15 и 23 указывают возраст Haemonchus из которых были получены м–Ќ .
Ќа фиг.10 представлен —аузернблоттинг Haemonchus contortus геномной ƒЌ , зондированной кƒЌ  клонами M1AUS (последовательность ID N 5), ¬1ј (последовательность ID N 2 и 3) и Aust B1 (последовательность ID N 6) и PCR продуктами 014-872 (3,5-2, последовательность ID N 8) и 014-015 (последовательность ID N 7); а) блоты промывают в услови€х умеренной жесткости, b) блоты промывают в существенно жестких услови€х; дл€ каждого зонда дорожка 1 содержала Hind III -гидролизат ƒЌ  в качество маркера, или оставлена без маркера, дорожки 2 и 3 содержали EcoR1 и Hind III гидролизаты, соответственно, геномной ƒЌ  Haemonochus.
Ќа фиг. 11 представлены ¬естернблотты рекомбинантных GST-ћ1 и GST-B1A протеинов сли€ни€, зондированных аффинно-очищенными антителами к электрофоретически очищенным Ќ110D (Ќ110D≈).
Ќа фиг.12 представлен ¬естернблоттинг Con A Ќ110D антигена, зондированного антисывороткой к Con A H110D и к рекомбинантным GST-M1 и GST-B1A протеинам сли€ни€.
Ќа фиг. 13 представлены а) результаты анализа Ќ110D протеина и аминопептидазных активностей во фракци€х, полученных с помощью ионообменной хроматографии Con A Ќ110D на Mono Q колонке;
b) SDS-PAGE фракций, представлен на фиг.13a).
Ќа фиг. 14 представлены а) pH значени€, при которых были получены фракции в эксперименте с изоэлектрическим фокусированием в свободном потоке;
b) SDS-PAGE в восстанавливающих услови€х фракций из 14a), где нижн€€ полоса H110D дублета обнаружена во фракции 6, а верхн€€ полоса во фракции 16, с варьируемыми количествами каждой из них в перекрывающихс€ фракци€х;
c) ¬естернблоттинг фракций представлен в 14b) зондированных
i) моноклональными антителами, обозначенными TS 3/19.7, и
ii) аффинно-очищенными поликлональными анти-MI антителами; контрольные антитела но дают детектируемой реакции.
Ќа фиг. 15 представлены а) pH значени€, при которых получают фракции в другом эксперименте изоэлектрического фокусировавани€ в свободном потоке; b) SDS-PAGE в восстанавливающих услови€х дл€ фракций от 15a), использованного в энзиматическом анализе, где нижн€€ полоса H110D дублета найдена во фракци€х 4-6, а верхн€€ полоса - во фракци€х 16-18, с варьируемыми количествами каждой полосы в перекрывающихс€ фракци€х; с) микросомные аминопептидазные специфические активности фракций, представленных в 15 b).
Ќа фиг. 16 представлена защита овец с помощью вакцинации отдельно верхней (U), нижней (L), рекомбинантной (U + L) и промежуточной дублетной (D) полосами из H110D; а) количество откладываемых паразитами €иц, выраженное как количество €иц на г фекалий, b) погибших червей относительно контрол€.
Ќа фиг. 17 представлена защита овец в результате вакцинации водорастворимым фрагментом (H11S), полученным из H110D в результате переваривани€ эластазой и H11ј, остаточным детергент- растворимым H110D; а) количество €иц паразитов, выраженное в единицах €иц на г фекалий, b) погибших червой по отношению к контрольным значени€м (C).
Ќа фиг. 18 представлены примеры соотношени€ между ингибированием Ai), Bi) аминопептидаза M-подобной и Aii), Bii) аминопептидаза A-подобной активност€ми H110D за счет антисыворотки отдельных овец, вакцинированных H110D с уровн€ми защиты, достигнутыми за счет Ai, ii) % уменьшени€ погибших червей, и Bi, ii) % уменьшени€ количества €иц в фекали€х; - анти-H110D, - антилошадиный ферритиновый контроль.
Ќа фиг. 19 представлена гистохимическа€ локализаци€ активности энзима аминопептидазы у взрослых особей Haemonchus contortus - световые микрофотографии криосекций взрослых самок Haemonchus contortus демонстрируют активность аминопептидазы (красный продукт реакции по€вл€етс€ как темна€ полоса (отмечена стрелкой) на этих черно-белых фотографи€х), св€занную только с микроворсинками (mv) кишечника (i). Ќи одна из других тканей (например, кутикул (c), гиподермиса (h) генитального тракта (gt), мускулов стенок (wm)) не демонстрирует активности. ¬ а) субстратом был L-лейцин-4-метокси -β- нафтиламид, в b) субстратом был α- (4-метокси -β- нафтиламид) L-глутаминовой кислоты;
Ќа фиг. 20 представлена карта 3,5PCR продукта (клон 2) (последовательность ID N 8), субклонированного в бакуловирусный вектор экспрессии pBlue Bacll.
Ќа фиг. 21 представлен ¬естернблоттинг экстрактов из бакуловирус-инфицированных Spodoptera frugiperda (Sf) 9 клеток, зондированных анти-H110DN антителами. ƒве клонированнные бл€шки, –3A и P4A, экспрессируют полной длины иммунопозитивный H110D (указан стрелкой), а контроль - нет.
ѕример
ћетоды
 онструирование U.K. λ GTII библиотеки
¬ыделение м–Ќ 
¬зрослых Haemonchus contortus (0,5 г) из ¬еликобритании (U.K.), замороженных в жидком азоте, измельчают в жидком азоте, использу€ предварительно охлажденную ступку и пестик. »з измельченной массы экстрагируют –Ќ  10 объемами 4 ћ гуанидингидрохлорида в 25 мћ цитрате натри€, содержащем 0,5% вес. /об. саркосила и 0,7% вес./об. 2-меркаптоэтанола, с последующей экстракцией фенолом и хлороформом, использу€ способ Chomczynski и Sacchi (1987). »нформационную –Ќ  (м–Ќ ) получают из этого с помощью аффинной хроматографии на олиго-dT- целлюлозе (дважды) по способу Maniatis et al. (1982) и качество определ€ют за счет in vitro трансл€ции, использу€ набор лизатов ретикулоцитов кролика и 35S-метионин от Amersham International plc в соответствии с рекомендаци€ми изготовителей. ќпредел€ют полипептиды длиной вплоть до 120 кb.
ѕолучение комплементарной ƒЌ 
ѕервую нить комплементарной ƒЌ  (кƒЌ ) синтезируют из 1 мкг м–Ќ , использу€ статистическое праймирование и птичью обратную транскриптазу, а вторую нить синтезируют, использу€ реакцию замещени€ RNase H и E. coli ƒЌ  полимеразу 1 с последующей репарацией 3' выступа, использу€ T4 ƒЌ  полимеразу по способу Gubler и Hoffman (1983). ¬ыход двунитевой (ds) кƒЌ  составл€ет приблизительно 400 нг из 1 мкг м–Ќ . ƒвунитевую кƒЌ  исследуют электрофоретически в 1% агарозном геле с последующей авторадиографией. ƒвунитева€ кƒЌ  имеет размер в интервале 0,2-9,4 килооснований (кв), причем основна€ часть имеет длину 0,5-2,3 кb.
 лонирование кƒЌ  в λ gt II
Ќеселектированную по размерам кƒЌ  используют дл€ конструировани€ библиотеки в λ gt II, использу€ систему клонировани€ кƒЌ  Amersham (набор N RPN 1280. Amersham International plc и in vitro упаковывающие экстракты (набор N 334, Amersham) в соответствии с указани€ми изготовителей, а также Eco RI линкерные олигонуклеотиды (5'GGAATTCC). ѕолученную библиотеку помещают в E. coli штамм Y1090 в присутствии изопропилтио -β- D-галактозида (IPTG) и 5-бром, 4-хлор, 3-индолил- -β- D-галактозида (X-gal), в таких услови€х, в которых рекомбинантные λ gt II про€вл€ютс€ как чистые ("белые") бл€шки, а дикого типа не рекомбинантные λ gt II - как голубые бл€шки. Ѕиблиотека содержала 90% белых бл€шек и эффективность клонировани€ была оценена как 4 · 107 бл€шкообразующих единиц (plaque forming units = pfu) на мкг кƒЌ , и титр библиотеки составл€ет 2 · 106 бл€шкообразующих единиц на мл. јнализ ƒЌ  из 20 рекомбинантов, вз€тых произвольно, дает средний размер вставки 0,51 кb. ќднако это значение нарушаетс€ одним клоном, вставка в котором составл€ет 3,5 кb. ќсновна€ часть вставок имеет более 300 пар оснований (bр). «атем эту неамплифицированную библиотеку, полученную из м–Ќ  червей из ¬еликобритании, подвергают иммуноскринированию.
ѕолучение антительных зондов
јнтисыворотка к интегральным протеинам.
 ишечник взрослой особи Haemonchus contortus (из ¬еликобритании) иссекают и гомогенизируют в лед€ном фосфатном буфере (PBS), pH 7,4, содержащем 1 мћ этилендиаминтетрауксусной кислоты (≈ƒ“ј) и N1 мћ фенилметилсульфонилфторида (PMSF). ѕолученный гомогенат центрифугируют в течение 10 минут, использу€ микроцентрифугу, и полученный осадок снова суспендируют в том же буфере, содержащем 0,1% об./об. “вина 20 (“вин - торгова€ марка). ѕосле повторного центрифугировани€ осадок суспендируют в том же буфере, содержащем 2% об./об. Trion X-100, и экстрагируют в течение 2 часов при 4oC. Ётот экстракт центрифугируют как указано ранее до получени€ надосадочной жидкости, содержащей интегральный мембранный протеин (IMP).
ќвцу гипериммунизируют IMP в полном адъюванте ‘рейнда (FCA) с помощью внутримышечной инъекции 50, 50, 120 и 130 мкг IMP, который ввод€т в 0, 7, 11 и 15 неделю. —пуст€ 6 недель после последней инъекции, собирают сыворотку и обозначают ее как сыворотка ≈≈-068.
ѕолучение интегральных мембранных протеинов за счет детергентной экстракции Haemonchus contortus
Ёкстракт приготавливают, гомогенизиру€ червей в 5-10 объемах PBS, содержащего 1 мћ ≈ƒ“ј и 1 мћ PMSF. —успензию центрифугируют при 10000 g в течение 20 минут при 4oC и осадок промывают тем же буфером, содержащим 0,1% об. /об. “вина 20, а затем экстрагируют 5 объемами 2% об./об. Triton) ’-100, как указано ранее. Ќадосадочную жидкость снова центрифугируют при 100000 g в течение 1 часа, а полученную надосадочную жидкость, котора€ обогащена H110D, но содержит другие IMP, используют в ¬естернблоттинге и дл€ получени€ неденатурированного H110D (см. далее).
ѕолучение H110D и аффинно-очищенной анти-H110DN
ќбогащенный H110D экстракт обрабатывают с помощью аффинной хроматографии на ConA-агарозе, а затем с помощью ионообменной хроматографии на Mono Q (как указано в WO 88/00835 и WO 90/11086. ќчищенный H110D ввод€т внутримышечно €гненку в FCA. — трехнедельными интервалами ввод€т 3 дозы по 100 мкг. —ыворотку у €гненка отбирают спуст€ 4 недели после последней инъекции и очищают с помощью аффинной хроматографии, использу€ абсорбцию на колонке, содержащей очищенный H110D, который был соединен с цианогенбромид-активированной сефарозой (Pharmacia). ѕрисоединение H110D к сефарозе, св€зывание антисыворотки и элюирование анти-H110D антител осуществл€ют в соответствии с инструкци€ми Pharmacia. Ёти аффинно-очищенные антитела обозначают анти-H110DN. Ѕуква "N" отличает эти антитела от тех, которые вырабатываютс€ к денатурированным, электрофоретически очищенным HIIOL, которые обозначают анти-H110DE.
¬естернблоттинг
¬есторнблоттинг осуществл€ют, использу€ стандартную методику - (Johnstone et al., 1982).
¬ыделение и характеристика клонов
»ммуноскрининг λ gt II библиотеки (из ¬еликобритании)
»ммуноскрининг библиотеки осуществл€ют по способу Bowtell et al. (1986). ѕеред использованием сыворотку (≈≈-068) инактивируют на анти-E. coli антитела за счет абсорбции с лизатами и целыми клетками E. coli Y1090. Ѕиблиотеку высевают на клетки E. coli Y1090 плотностью 103 pfu на пластину 90 мм диаметром. ѕластины закрывают нитроцеллюлозными фильтрами, пропитанными IPTG и инкубируют в течение ночи. ‘ильтры промывают TBST (50 мћ Tris, pH 7,4, 150 мћ NaCl, 0,05% об./об. “вин 20), а затем блокируют с 5% об./об. лошадиной сывороткой в TBST в течение 2 часов. ƒобавл€ют сыворотку ≈≈-068, разбавленную 1: 200 в TBST, содержащем 5% лошадиную сыворотку, и полученные фильтры инкубируют в течение 4 часов при осторожном встр€хивании. ‘ильтры снова промывают в TBST, затем инкубируют с пероксидазой хрена (HRP)-конъюгированной с лошадиным антиовечьим IgG, разбавленным 1:500 в TBST, содержащем 5% об./об. лошадиной сыворотки в точение 2 часов. (јнтисыворотку к овечьему IgG вырабатывают в лошад€х, антиовечий IgG очищают с помощью аффинной хроматографии на колонке с сефарозой с овечьим IgG, и антитела конъюгируют с HRP по способу Nakane and Kawaoi, 1974). ‘ильтры промывают далее в TBST, и положительные бл€шки определ€ют, использу€ 0,6 мг/мл 3,3'-диаминобензидин (ƒј¬) и 0,1% об. /об. перекиси водорода. ќтбирают 25 предположительно позитивных и повторно скринируют с помощью аффинно-очищенного анти-H110DN, как указано ранее. ѕосле этого второго скринировани€ 5 рекомбинантов все еще остаютс€ позитивными, причем клон, обозначенный как M1, дает наиболее сильный сигнал.
јффинна€ очистка антител на рекомбинантном фаге
 онфлюэнтные пластины получают на E.coli Y1090 газонах, засева€ 103 pfu каждого из антителоположительных клонов или нерекомбинантных λ gt II негативных контрольных фагов. √азоны инкубируют в течение 4 часов при 42oC, а затем покрывают фильтрами, пропитанными IPTG и продолжают инкубирование в течение ночи при 37oC. ‘ильтры удал€ют с пластин и промывают в TBST перед тем, как блокировать с 5% об./об. лошадиной сывороткой в течение 1 часа. «атем полученные фильтры инкубируют с 1:100 разбавлении антисыворотки ≈≈-068 в точение 6 часов, перед тем, как тщательно промывают TBST. —в€занные антитела элюируют с фильтров, дважды нанос€ по 2 мл элюирующего буфера (5 мћ глицина, 500 мћ NaCl, 0,2% “вин 20, pH 2,3) в течение 2-3 минут каждый, нейтрализуют, добавл€€ 200 мкл 1 ћ трис-HCl, pH 7,4, разбавл€ют 1 в 200 и используют дл€ иммуноскрининга ¬естернблоттов H110D- обогащенного экстракта.
ƒЌ  секвенирование M1 клона
Ћ€мбда ƒЌ  выдел€ют из M1 клона по способу Maniatis et al., (1982). 2,38 кb KpnI-S st1 фрагмент, содержащий 300 bp M1 фрагмент, выдел€ют с помощью гель-электрофореза, очищают, использу€ GENECLEAN набор (Stratagene) (GENECLEAN представл€ет торговую марку B10101), и субклонируют в pBluescriptll SK* (Stratagene). EcoRI фрагмент очищают, использу€ ту же методику, и снова субклонируют в том же векторе.
Ќуклеотидную последовательность M1 вставки определ€ют, использу€ T7 набор дл€ секвенировани€ (Pharmacia, UK), использу€ как пр€мой и обратный праймеры M13.
ѕолучение кƒЌ  библиотек λ GTII и λ ZAP из јвстралии
¬ыделение м–Ќ 
5 г взрослых особей Haemonchus contortus (австралийский McMaster восприимчивый штамм), замороженный в жидком азоте, измельчают в жидком азоте и –Ќ  экстрагируют, использу€ гор€чий фенол по способу Gordingley et al. (1983). ѕолный выход –Ќ  составл€ет 10,35 мг. 1,3 мг этой –Ќ  используют дл€ получени€ м–Ќ  с помощью аффинной хроматографии на олиго-dT- целлюлозе (2 последовательные очистки), использу€ способ, описанный Maniatis et al. (1982). ¬ыход м–Ќ  составл€ет 21,6 мкг.  ачество м–Ќ  оценивают in vitro трансл€цией в лизатах ретикулоцитов кролика в присутствии 35S-метионина (Amersham) в соответствии с инструкци€ми изготовител€. ѕолученные продукты трансл€ции имеют заметно отличающиес€ полосы, включа€ полосы более 200 кb, что продемонстрировал электрофорез на SDS-полиакриламидных гел€х с последующей флюорографией.
—интез кƒЌ  и получение библиотеки
1 мкг м–Ќ  используют дл€ получени€ кƒЌ  за счет затравки с помощью олиго-dT или статистических праймеров, использу€ кƒЌ  набор дл€ синтеза кƒЌ  Amersham International plc в соответствии с рекомендаци€ми изготовителей. ¬ыход 115 нг двунитевой (ds) кƒЌ .  ачество кƒЌ  исследуют с помощью электрофореза 32P-меченных ƒЌ  на щелочном агарозном геле по способу Ametsham инструкций к набору кƒЌ . –азмер кƒЌ  (определенный по сравнению с λ- Hind III маркерами, New England Biolabs) составл€ет от 150 bp до более 10 кb, причем основна€ часть продукта имеет размер 0,6-5 кb. ќлиго-dT-праймированные и статистически-праймированные dS кƒЌ  собирают и лигируют с избытком EcoRI 8-мерными линкерами (5' GGAATT——3' New England Biolabs, Catalogue N 1018), которые были помеченыγ- 32P-ATP и T4 полинуклеотидкиназой. —в€занные кƒЌ  переваривают EcoRI и избыток линкеров удал€ют с помощью хроматографии на сефарозном геле 4B (Pharmacia) по способу Maniatis et al. (1982). ‘ракции из колонки собирают в две порции, одна из которых содержит кƒЌ  с размерами более 2 кb, а друга€ - менее 2 кb. «атем каждую порцию лигируют отдельно с 1 мкг EcoRI отрезками, обрабатывают фосфатазой λ ZapII спейсеры (Stratagene) и упаковывают отдельно, использу€ Gigapack Gold (Stratagene). кƒЌ  большего размера дают 1,3 · 105 рекомбинант, а меньшие кƒЌ  дают 1,4 · 105 рекомбинант, их собирают до получени€ библиотеки из 2,7 · 105. λ Zap библиотеку амплифицируют, помеща€ на клетки XLI-Blue (Stratagene) в количестве 2 · 104 pfu на 135 мм пластины. “итр амплифицированной библиотеки составл€ет 7 · 107 pfu/мл.
ƒополнительно 2 мкг м–Ќ  используют дл€ получени€ кƒЌ  описанным ранее способом, но использу€ в качество праймера только олиго-dT. ¬ыход ds кƒЌ  составл€ет 740 нг. Ёту кƒЌ  обрабатывают EcoRI метилазой по способу Maniatis et al. (1982) перед добавлением ≈соRI линкеров, и в этом случае используют 12-мерные линкеры (5' CCGGAATTCCGG3' New England Biolabs, N по каталогу 1019). ѕосле переваривани€ обработанной линкером кƒЌ  EcoRl, все фракции из колонки с сефарозой 4B, которые содержат кƒЌ , собирают и лигируют с 2 мкг отрезков ≈соRI, обрабатывают фосфатазой λ gtII спейсеры (Stratagene). Ћигирующую смесь раздел€ют надвое и упаковывают с двум€ порци€ми Gigapack Gold (Stratagene); их собирают до получени€ λ gtII библиотеки из 7 · 106 pfu. Ѕиблиотеку амплифицируют, помеща€ на ST9 клетки в количестве 5 · 105 pfu на 135 мм пластины. “итр амплифицированной λ gtII библиотеки составл€ет 4,5 · 1011 pfu/мл.
—кринирование λ gtII библиотеки из јвстралии с помощью антисыворотки к H110D
јнтисыворотку вырабатывают, инъециру€ овце H110D протеин (из ¬еликобритании), который был электроэлюирован из полиакриламида после электрофореза в SDS следующим образом: ConA H110D, полученный по способу WO 88/00835 и WO 90/11086, обрабатывают электрофоретически на SDS-полиакриламидных гел€х (Laemmli, 1970) до получени€ электроэлюированных H110D. ѕосле электрофореза участки полиакриламидного гел€, содержащие отрезки H110D), помещают в электроэлюатер (Atto), и элюирование провод€т в течение 3 часов при мощности 10 ватт. Ёлектроэлюированные H110D (обозначенные H110D≈) концентрируют на Centriprep 10 (Amicon), и буфер обменивают на –ƒ10 колонке (Pharmacia) в 50 мћ аммонийбикарбоната/0,07% SDS, смешанном с адъювантами, а затем ввод€т овце с помощью инъекции. »ммуноглобулины из сыворотки осаждают сульфатом аммони€ (Johnstone and Thorpe, 1982). ќсажденные антитела снова суспендируют в концентрации 60 мг/мл в фосфатном буферированном растворе и разбавл€ют 1:10 в Tris -забуференном физиологическом растворе (TBS), содержащем 5% вес./об. молочного порошка с низким содержанием жира. 10 мг ConA H110D довод€т до 0,5% SDS, нагревают до 100oC в течение 3 минут и сушат на нитроцеллюлозном фильтре. ѕосле промывки TBS, содержащим 0,2% об./об. “вин 20 и 0,5% Triton X-100 (TBSTT) фильтр инкубируют в течение 1-2 часов при комнатной температуре с антителами к H110DE. ѕосле промывани€ фильтра в течение 2 часов TBSTT, св€занные антитела элюируют 3 мл 0,1 ћ глицина, 0,15 ћ NaCl, pH 2,6 в течение 2 минут, и немедленно довод€т до нейтрального pH, добавл€€ 75 мкл 1,5 ћ Tris, pH 8,0. Ёти аффинно-очищенные антитела, обозначаемые анти-Ќ110D≈, используют дл€ скринировани€ 5 · 105 pfu библиотеки кƒЌ  λ gt II из јвстралии описанным ранее способом.
5 · 105 рекомбинантов из библиотеки λ gt II, полученных из австралийских Haemonchus contortus, иммуноскринируют и три позитивных из них отбирают. ѕосле дальнейшего скринировани€ два из этих рекомбинантов остаютс€ все еще положительными, и их обозначают B1ј и B2.
—еквенирование B1ј и B2 клонов
Ёти два клона переваривают EcoRI, получа€ одну вставку приблизительно 500 bp дл€ B1ј, и три фрагмента B2A (около 400 bp) B2B (около 100 bp) и B2C (около 100 bp) дл€ B2. »х субклонируют в BlueScript SK* (Stratagene) и секвенируют, использу€ набор секвеназ 2,0 (United States Biochemicals).
Ёкспресси€ клонов M1 и B1A
M1 (последовательность ID N 1) и B1A (последовательность 1ID N 2 и 3) вставки экспрессируют в ≈.coli, использу€ вектор p GEX (Smith and Johnson, 1988). Ётот вектор экспрессирует протеины C-конца глутатион-S-трансферазы Schistosoma japonicum (GST). M1 и B1A EcoRI-вставки лигируют с EcoRI-гидролизатом, обрабатывают фосфотазой pGEXI и трансформируют в ≈.coli штамм JM101 по способу, описанному Maniatis et al., 1982. ¬осемь экземпл€ров потомства отбирают из каждой трансформации, и 2 мл культур выращивают в течение 6 часов при 37oC. ƒобавл€ют IPTG дл€ индуцировани€ сли€ни€ протеинов, и инкубирование продолжают в течение ночи.  летки собирают центрифугированием, разрушают кип€чением в том же самом буфере (Laemmli, 1974) и полученные экстракты анализируют с помощью SDS-PAGE и провод€т ¬естернблоттинг, использу€ аффинно-очищенные антитела овец, специфические дл€ SDS-денатурированных H110D дублетов (анти-Ќ110DE см. ранее). —в€занные антитела определ€ют, использу€ конъюгат щелочной фосфатазы с кроличьим антиовечьим IgG (Jackson Immunoresearch) с последующим цветовым про€влением с помощью 5-бром, 4-хлор, 3-индолилфосфата (BCIP) и нитроблютетразолиума, (NBT).  ультуры иммунопозитивных клонов выращивают и индуцируют как указано ранее, и разрушают ультразвуком. ѕродукты, полученные в результате этой обработки, раздел€ют на растворимые и нерастворимые фракции за счет центрифугировани€ (Sorval RC-2B центрифуга, HS4 ротор, 7000 об/мин, 30 минут, 4oC). Ќерастворимый осадок снова суспендируют в 8 ћ мочевине с помощью ультразвука и образцы фракций исследуют с помощью SDS-PAGE.
ѕротеины сли€ни€ обнаруживают в нерастворимых фракци€х тел включени€.  аждый из этих препаратов используют дл€ вакцинации 2 овец трижды в количестве 150 мкг протеина сли€ни€ на дозу в адъювантах ‘рейнда. ѕозитивных контрольных овец иммунизуют нативным ConA H110D протеином, а негативных контрольных овец иммунизуют солюбилизированным протеином из E.coli, содержащим p GEX вектор без Haemonchus вставки. —ыворотку от вакцинированной овцы анализируют с помощью ¬естернблоттинга против H110D.
—кринирование λ ZAP библиотеки из јвстралии с помощью ƒЌ  гибридизации с M1 и B1A вставками.
M1 и B1A плазмидные ƒЌ  (клонированные в pBluescript) переваривают EcoRI и вставки выдел€ют электрофорезом в TBE(трис- борат-≈ƒ“ј; 89 мћ трис-борат, 89 мћ борной кислоты, 2 мћ ≈ƒ“ј, pH приблизительно 8,3) буфере в 1% агарозном геле с последующей очисткой с помощью набора GENECLEAN. ¬ыделение и очистку повтор€ют во избежание загр€знений зонда плазмидными ƒЌ  последовательност€ми, которые могли бы гибридизоватьс€ с λ ZAP последовательност€ми, вызыва€ недопустимый уровень фона. ќчищенные вставки ƒЌ  мет€т α- 32P-dCTP, использу€ набор дл€ ник-трансл€ции (Promega Biotech) в соответствии с инструкци€ми изготовителей. ћеченые ƒЌ  выдел€ют от непрореагировавших меток на Spin хроматографической колонке (Maniatis et al. , 1982). ¬осемь 135 мм пластин λ ZAP библиотеки помещают в количество 105 pfu/пластину и бл€шки снимают на нитроцеллюлозные фильтры (Maniatis et al., 1982). ѕосле нагревани€ в вакуумном термостате в течение 2 часов при 80oC фильтры прегибридизуют в течение 2 часов, затем гибридизуют при 42oC в течение ночи (как указано далее в разделе "јнализ по —аузерну"). „етыре фильтра скринируют M1 зондом, а четыре B1A зондом. ‘ильтры дважды промывают в 1 х SSC, содержащем 0,5% SDS, и все это при 50oC, и авторадиографируют. ѕотенциальные положительные бл€шки отбирают и снова скринируют с зондами. ‘аги с высокими титрами приготавливают из подтвержденных позитивов (обозначенных M1AUS дл€ M1-гибридизующего клона и Aust ¬ дл€ B1A-гибридизующего клона) и клоны помещают в pBluescript в соответствии с инструкци€ми изготовителей дл€ λ ZAP (Stratagene), использу€ BB4 штамм ≈.coli в качестве хоз€ина. ѕлазмидные ƒЌ  мини-препараты полученного потомства получают щелочным лизисом (Maniatis et al. , 1982) и перевариванием EcoRI. ѕеревары анализируют электрофорезом на агарозном геле.
—еквенирование вставки M1AUS
—еквенирование ƒЌ  ведут на очищенной pBluescript плазмидной ƒЌ , использу€ набор секвеназ United States Biochemicals, верси€ 2,0, в соответствии с рекомендаци€ми изготовителей. ƒл€ первой реакции секвенировани€ используют праймеры с концов векторной последовательности дл€ праймировани€ реакции. ѕолученные в этих реакци€х данные секвенировани€ используют дл€ конструировани€ второй пары праймеров, а из данных, полученных с этой второй парой праймеров, конструируют третью пару. “аким образом секвенируют ƒЌ , "прогулива€сь вдоль" с обоих концов: 5' и 3'.
—еквенирование вставки Aust B1
≈го провод€т, использу€ секвеназную 2,0 T7 полимеразу (USB Biochemicals) по способу секвенировани€ вставки M1AUS.
ѕолимеразные цепные реакции
ѕолучение кƒЌ 
м–Ќ  (1 мкг) из 11-дневных постинфицированных U.K.H. contortus, полученную как указано дл€ взрослых UK червей, смешивают с T17 адаптор-праймером:
(5'-GACTCGAGTCGACATCGATTTTTTTTTTTTTTTTT 3') в диэтилпирокарбонатом (DEPC)-обработанной воде, затем нагревают до 65oC в течение 5 минут и немедленно помещают на лед. ƒобавл€ют гидроксид метилртути до конечной концентрации 28,6 мћ и полученную смесь инкубируют при комнатной температуре в течение 3 минут. ƒобавл€ют 1-меркаптоэтанол до финальной концентрации 14,2 мћ и полученную смесь помещают на лед.   синтезированной кƒЌ  добавл€ют RNase Guard (Pharmacia) до 1 ед/мкл. Ѕуфер обратной транскриптазы (Life Sciences) до однократной концентрации, dATP, dGTP, dCTP и dTTP каждый до 1 мћ и AMV обратна€ транскриптаза (Life Sciences) до 2 ед/мкл (все указаны как конечные концентрации). –еакционную смесь инкубируют при 41oC в течение 75 минут, затем экстрагируют фенолом и хлороформом и очищают на Spin хроматографической колонке (Maniatis et al, 1982). ќчищенную реакционную смесь разбавл€ют в 2,5 раза и хран€т при 4oC.
PCR амплификаци€ кƒЌ  с использованием MIAUS-специфических праймеров
PCR реакции провод€т, использу€ программируемый термоциклер (M.J. Research Inc.). –еакционную смесь, содержащую 1 мкл из 250 мкл разбавленной кƒЌ , приготовленной как указано ранее, 25 пмолей первой нити T17-адаптор-праймера, 25 пмолей второй нити праймера амплификации (либо на основании положений 865-884 (5' ACGGGTGTTCGGTTTCCGTAT 3'), либо на основании положений 30-49 (5'GCTGAATCTAACTCCAATCC 3') M1AUS последовательности (последовательность ID N 5). 1 · Tag буфер (Northumbria Biologicals Ltd) и 0,5 мћ каждого из dATP, dTTP, dGTP и dCTP в 100 мкл реакционного объема, и покрывают 40 мкл минерального масла во избежание испарени€. «атем эту смесь нагревают в термоциклере до 95oC в течение 2 минут, затем выдерживают при 72oC. ¬се еще при 72oC добавл€ют 2 единицы Tag полимеразы и осторожно смешивают с остальными реагентами. «атем термоциклеру задают следующую программу:
—тади€ 1: отжиг при 50oC, 5 минут
—тади€ 2: удлинение при 72oC, 40 минут
—тади€ 3: денатураци€ при 94oC, 40 секунд
—тади€ 4: отжиг при 50oC, 2 минуты
—тади€ 5: удлинение при 72oC, 3 минуты
—тади€ 6: 39 циклов стадий 3-5
—тади€ 7: окончательное удлинение при 72oC в течение 15 минут
—тади€ 8: хранение при 4oC.
Ёти услови€ заданы Frohman et al. (1988).
 лонирование PCR продуктов
PCR продукты из вышеуказанных реакций выдел€ют электрофорезом в агарозном геле. ѕолосы ƒЌ  приблизительно 2,5 и 3,5 кb электроэлюируют на стекловолокно (Whatman), экстрагируют фенолом и очищают хроматографически на G50 (Pharmacia) (Sambrook et al., 1989). ќчищенную ƒЌ  лигируют в pT 7 Blue T-вектор (Novagene) в соответствии с рекомендаци€ми изготовителей.
—еквенирование 2,5 кb и 3,5 кb продуктов PCR
ƒЌ  секвенирование осуществл€ют с набором секвеназ 2,0 (USBiochemicаls), использу€ "олигонуклеотидную прогулку", методику, описанную в разделе секвенировани€ M1AUS.
–еакции полимеразной цепи дл€ 5' концов
ѕолучение первой нити кƒЌ 
1 мкг м–Ќ  из 11-дневных постинфицированных UK Haemonchus contortus, полученной по способу, описанному дл€ взрослых червей, смешивают с посто€нным праймером (5' AAIGAAAGCGGATGGCTTGAIGC 3'), сконструированным из консервативного участка Aust B1 и 2,5 кb PCR и 3,5 кb PCR продуктами (последовательности ID N 6, 7 и 8 соответственно). ѕолученную смесь нагревают до 65oC в течение 5 минут, помещают на лед и добавл€ют гидроксид метилртути до конечной концентрации 28,6 мћ. ѕолученную смесь инкубируют при комнатной температуре в течение 5 минут, затем добавл€ют 2-меркаптоэтанол до конечной концентрации 14,2 мћ, и полученную смесь помещают на лед. ѕервую нить ƒЌ  получают, использу€ реагенты из 5' RACE системы (Gibco/BRL) при конечной концентрации 20 мћ Tris/HCl pH 8,4, 50 мћ KCl, 2,5 мћ MgCl2, 100 мкг/мл BSA, 0,5 мћ dATP, dCTP, dTTP. ƒобавл€ют 200 единиц Superscript обратной трансферазы и реакционную смесь инкубируют при 42oC в течение 30 минут, а затем нагревают при 55oC в течение 50 минут. ƒобавл€ют RNAse H до конечной концентрации 100 ед/мл и реакционную смесь инкубируют в течение 10 минут, а затем помещают на лед. кƒЌ  очищают, использу€ Glassmax spin колонку (Gibco/BRL) и хран€т при -20oC.
Ќаращивание C-конца кƒЌ 
1/5 первой нити кƒЌ  нагревают при 70oC в течение 5 минут, затем охлаждают на льду в течение 1 минуты. ƒобавл€ют реагенты из 5' RACE системы (Gibco/BRL) до конечной концентрации 10 мћ Tris/HCl, pH 8,4, 25 мћ KCl, 1,25 мћ MgCl2, 50 мкг/мл BSA, 0,2 мћ dCTP, 500 ед/мл терминальной трансферазы добавл€ют и реакционную смесь инкубируют при 37oC в течение 10 минут, затем нагревают при 70oC в течение 15 минут и хран€т на льду.
PCR амплификаци€ с использованием Aust B1, 2,5 кb PCR и 3,5 кb PCR специфических праймеров
PCR реакции осуществл€ют на программируемом термоциклере (M.J. Research Inc.). ƒл€ 3' конца используют один из трех праймеров.
1. ѕраймер, специфический дл€ 2,5 кb PCR продукта, основанный на положени€х 374-394 (5' TGTTGTGGCTAATTTCGTCCA 3').
2. ѕраймер, специфичный дл€ 3,5 кb продукта, основанный на положени€х 1210-1229 (5' CATCTTIAGTTATCTGACCAG 3').
3. ѕраймер, специфический дл€ кƒЌ  клона Aust B1, основанный на положени€х 357-377 (5' GACCATCGCTGATGAAGTCGG 3'). ƒл€ 5'конца реакций используют обычный "€корный праймер"
(5' CUACUACUACUAGGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG3')
 ажда€ реакционна€ смесь содержит 4 мкл из 50 мкл кƒЌ  с C-концом, 25 пмолей соответствующих 2 праймеров, 1 х Tag полимеразный буфер (Boechringer/Mannheim) и 0,5 мћ каждого из dATC, dCTP, dGTP и dTTP до конечного объема 100 мкл. Ёту смесь покрывают 50 мкл минерального масла и нагревают до 95oC в циклере в течение 2 минут. –еакционную смесь выдерживают при 80oC и в это врем€ добавл€ют 0,6 ед. Tag полимеразы, а затем включают следующую программу:
1. ќтжиг при 50oC в течение 5 минут
2. ”длинение при 72oC в течение 10 минут
3. ƒенатураци€ при 94oC в течение 45 секунд
4. ќтжиг при 50oC в течение 1 минуты
5. ”длинение при 72oC в течение 2,5 минуты
6. 39 циклов пунктов 3-5
7. ”длинение при 72oC в течение 15 минут
8. ’ранение при 4oC
 лонирование 5' PCR продуктов
PCR продукты выдел€ют электрофоретически на агарозном геле и полосы ожидаемого размера 1,3 кb, вырезают, ƒЌ  очищают, использу€ GENECLEAN набор, и лигируют в PT7BlueT-вектор (Novagene) в соответствии с указани€ми изготовителей.
ѕолимеразна€ цепна€ реакци€ дл€ получени€ 3' конца Aust B1
ѕервую нить кƒЌ , которую используют, €вл€етс€ нитью, описанной дл€ получени€ кƒЌ  дл€ использовани€ с M1AUS праймерами. »спользуют специфический праймер от 1414 до 1435 (5' TCTTGAAGAAATGAAAAAGCTT 3') в Aust B1 (последовательность ID N 6) с T17 адаптерным праймером, использованным дл€ M1AUS PCR, и реакцию ведут в термоциклере (M.J. Research Inc.). –еакционна€ смесь состоит из 25 пмолей каждого из праймеров, 2 мкл кƒЌ  1 х Tag полимеразного буфера) (Boehringer Mannhein), 0,5 мћ dATP, dCTP, dGTP и dTTP в 100 мкл. ¬се это покрывают 50 мкл минерального масла и нагревают до 95oC в течение 2 минут, добавл€ют 0,6 мкл Tag полимеразы и провод€т тот же самый программируемый цикл, что и дл€ 5' PCR, описанный ранее.
 лонирование и секвенирование 3' продуктов
ѕродукты PCR раздел€ют электрофоретически в агарозном геле и вырезают полосу ожидаемого размера, 1,3 кb, ƒЌ  очищают с помощью набора GENECLEAN и лигируют в PCR-script (Stratagene) в соответствии с рекомендаци€ми изготовителей.
—еквенирование клонированных PCR продуктов
ƒЌ  PCR клонов секвенируют, использу€ набор секвеназ 2,0 (United States Biochemical) в соответствии с инструкци€ми изготовителей. »спользуют олигонуклеотидные праймеры дл€ "прогулки вдоль" ƒЌ  клонов как с 5', так и с 3' концов.
јнализ всех последовательностей ƒЌ 
ѕоследовательности анализируют, использу€ программное компьютерное обеспечение GCG (Genetics Computer Group), Devereux et al., 1984.
Ќорзэрнблоттинг и —аузернблоттинг
ѕолучение Ќорзерн блотов
Ќорзерн блоты получают в формальдегидных гел€х в соответствии с рекомендаци€ми Maniatis et al. , (1982). м–Ќ  образцы (от 11-, 15- и 23-дневных взрослых H.contortus) обрабатывают 17,5% об./об. формальдегида и 50% об./об. формамида в буфере MOPS (20 мћ 3-(N-морфолино)пропансульфоновой кислоты, pH 7,0, 8 мћ ацетата натри€, 1 мћ ≈ƒ“ј) при 65oC в течение 15 минут и охлаждают на льду. √ели обрабатывают электрофоретически в MOPS буфере и получают блоты на дуралоновых мембранах за счет капилл€рного переноса по способу Sambrook et al. (1989).
ѕроведение —аузернблоттинга
2 г взрослых Haemonchus contortus, которые были заморожены в жидком азоте, измельчают в мелкий порошок в жидком азоте. ѕорошок медленно добавл€ют к 25 мл лизисного буфера (0,05 ћ Tris/HCl, pH 8, 0,1 ћ ≈ƒ“ј, 1% вес./об. саркозила, 0,05 мг/мл протеиназы K (Boehringer Mannheim)) и инкубируют в течение 2 часов при 65oC. «атем суспензию дважды экстрагируют одним объемом фенола плюс хлороформ, дважды двум€ объемами хлороформа и осаждают этанолом. ќсадок геномной ƒЌ  ресуспендируют с 20 мл Tris, ≈ƒ“ј буфера (TE, pH 8) в течение ночи при 4oC на качалке, затем провод€т диализ против двух замен одного литра TE. –Ќ  удал€ют, инкубиру€ с DNase, не содержащей RNase A типа 1 (Sigma) в конечной концентрации 20 мкг/мл, при 37oC в течение одного часа, а затем один раз экстрагируют фенол-хлороформом, один раз хлороформом и осаждают этанолом. ќсажденную геномную ƒЌ  дважды промывают 70% об/об этанолом и ресуспендируют в 2 мл TE, как указано ранее.
√еномную ƒЌ  переваривают EcoRI или Hind III (25 мкг ; ƒЌ  в каждом переваре) в течение ночи при 37oC, затем электро-осаждают в 5 мкг порци€х на 1% вес. /об. агарозном геле в Tris-ацетатном буфере. √ель обрабатывают по —аузерну и капилл€рно перенос€т по способу Maniatis et al., (1982) на Hybond-N мембрану (Ametsham International). ƒЌ  фиксируют на мембране, использу€ ультрафиолетовое облучение в соответствии с рекомендаци€ми изготовителей.
ѕолучение зондов
pBluesript плазмиды, содержащие M1AUS, B1A или Aust B1 вставки, переваривают EcoRI. pT7Blue плазмиды, содержащие 3,5 кb PCR продукта вставки переваривают BamHI, и те, которые содержат 2,5 кb PCR вставки, переваривают BamHI и Xbal. ѕеревары обрабатывают электрофоретически, вставки выдел€ют и мет€т радиоактивно α- 32P-dCTP ник-трансл€цией, как описано ранее в разделе скринировани€ библиотеки λ ZAP.
”слови€ гибридизации
ƒл€ —аузернблоттинга
ћембраны нарезают на полоски и прегибридизуют в гибридизационном буфере, как указано ранее, в течение 3 часов при 28oC. ѕолоски —аузерн блотов геномных ƒЌ  гибридизуют с каждым из указанных ранее зондов в течение ночи при 28oC, дважды промывают при комнатной температуре (24oC), затем дважды при 42oC, в 2 х SSC, содержащем 0,1% вес./об. SDS (умеренна€ жесткость) и авторадиографируют. ѕосле про€влени€ авторадиограмм полоски промывают в жестких услови€х (0,1 х SSC, 0,1% вес./об. SDS при 65oC) и снова авторадиографируют.
ƒл€ Ќорзернблоттинга
ƒл€ зондов M1, M1AUS и B1A (последовательности ID N 1, 5 и 2 соответственно).
Ќорзерн блоты м–Ќ  из 11-, 15- и 23-дневных зондируют вначале M1 вставкой. ‘ильтр предварительно гибридизуют в течение 2 часов при 42oC в 2 х SSC (где 20 х SSC = 3 ћ NaCl, 0,3 ћ цитрата натри€, pH 7,2), содержащего 5 х ƒенхардта (0,1% вес./об. Fucoll 400 (Pharmacia), 0,1% поливинилпирролидона, 0,1% бычьего сывороточного альбумина фракции V (Sigma Chemical Corp.)) 0,5% SDS (натрийдодецилсульфат), 10% декстрансульфата, 0,1 мг/мл ƒЌ  икры лосос€ и 50% деионизированного формамида. √ибридизацию с зондом осуществл€ют в том же буфере в течение ночи при 42oC. ‘ильтры дважды промывают в течение 30 минут в 2 х SSC, содержащем 0,5% SDS и 50% формамида, дважды в течение 30 минут в 2 х SSC, содержащем 0,5% SDS, и дважды в течение 30 минут в 2 х SSC. ѕервую промывку осуществл€ют при 42oC, а все остальные промывки ведут при 37oC. ѕосле авторадиографии блоты отпаривают, промыва€ в кип€щем 0,1% SDS и снова авторадиографируют, чтобы убедитьс€ в удалении зондов. «атем те же блоты зондируют M1AUS вставкой, промывают и авторадиграфируют. Ѕлоты снова отпаривают и провер€ют, а затем зондируют B1A вставкой. ѕосле нового отпаривани€ блоты зондируют, как указано далее.
ƒл€ зондов Aust B1, 2,5 кb и 3,5 кb PCR продукты (последовательности ID N 6, 7 и 8)
Ќорзерн блоты гибридизуют с Aust B1 вставками, использу€ услови€ умеренной жесткости, как описано дл€ гибридизации —аузернблоттинга. ѕосле авторадиографии блоты отпаривают кип€щим 0,1% SDS в соответствии с рекомендаци€ми изготовителей (Amersham), затем зондируют 2,5 кb PCR вставкой (клон 2), снова отпаривают и зондируют 3,5 кb PCR (клон 2) вставкой.
ѕереваривание H110D и анализы энзимной активности
ѕолучение H110D
Ќативную H110D (H110DN) получают способом, описанным в WO 88/00835 и WO 90/11086.
ѕолучение эластазного фрагмента (H11S) H110D
¬зрослых Haemonchus гомогенизируют в 10 объемах охлажденного льдом PBS /0,02% азида натри€, а затем центрифугируют в течение 20 минут при 13000 об/мин. ќсадок снова суспендируют в 10 объемах PBS /азида, снова гомогенизируют и повтор€ют центрифугирование. ѕосле повторного суспендировани€ в 50 мћ MOPS буфера, pH 7,4 (объем дл€ суспензии составл€ет 1 мл дл€ каждых 0,17 г червей) и предварительно нагревают при 37oC в течение 30 минут, материал осадка переваривают эластазой (800 мкл/20 мл суспензии; 1 мг/мл свежего исходного раствора, приготовленного в 1 мћ HCl/2 мћ Ca2+) в течение 1 часа. ѕереваривание прекращают, добавл€€ 3,4 дихлоризокумарина (300 мкл исходного раствора 10 мћ в ƒћ—ќ/20 мл перевара). ѕолученную смесь центрифугируют при 13000 об/мин в течение 20 минут, и выпавший материал осадка сохран€ют. Ќадосадочную жидкость обрабатывают в ультрацентрифуге при 100000 g в течение 1 часа 20 минут. ѕолученную надосадочную жидкость ввод€т в ConA колонку и получают св€занные фракции. ƒл€ анализа эту фракцию обрабатывают в SDS-полиакриламидном геле и электрофоретически перенос€т на поливинилиденфторидную мембрану (Immobilon-P, Millipore), слегка подкрашенную  умасси синим, вырезают полосу 105 кb и анализируют в газофазном аминокислотном секвенаторе. ƒл€ исследовани€ вакцинации ConA св€зывающие фракции очищают далее, концентриру€ и ввод€ в гель-фильтрационную колонку Sperose 12 (Phatmacia), и собирают те фракции, которые содержат аминопептидазную активность.
“ермолизиновое переваривание H110D
H110D дублет очищают электроэлюацией из препаративного 8% SDS-полиакриламидного гел€ до получени€ H110D≈, как указано в WO 90/11086, и электроэлюированием димерной формы, выход€щей как раз над 200 кb (котора€ дает характерный дублет на 110 кb, если повторить обработку на SDS-PAGE), до получени€ H110DE. –астворы H110D≈ концентрируют до 200 мкл, добавл€ют хлорид кальци€ до 5 мћ и полученную смесь нагревают до 37oC. —вежеприготовленный раствор 1 мг/мл термолизина (в 1 мћ HCl, 2 мћ CaCl2) добавл€ют в отношении 0,1 мкг термолизина на мкг H110D≈. ѕолученную смесь инкубируют при 37oC в течение 120 минут и затем реакцию останавливают, добавл€€ 5 мкл 0,5 ћ ≈ƒ“ј.
ѕротеиновые фрагменты раздел€ют электрофоротически в 15% SDS-полиакриламидном геле и электрофоретически перенос€т на поливинилиденфторидную мембрану (Immobilon-P, Millipore). ѕосле окрашивани€  умасси синим наиболее интенсивные дискретные полосы вырезают и анализируют в газофазном аминокислотном секвенаторе.
ѕолучение H110D фракции (H11A), обогащенной аминопептидазной A активностью
ќсадок, полученный после эластазной обработки центрифугированием на 17000 g в течение 20 минут (см. ранее), ресуспендируют в PBS при 4oC и снова осаждают центрифугированием, затем снова суспендируют в 1% “вин 20 в PBS /азиде и оставл€ют (при перемешивании) на 1 час. —успензию центрифугируют при 17000 g в течение 20 минут и надосадочную жидкость удал€ют. ќсадок повторно экстрагируют 1% Thesit в PBS /азиде. Ќадосадочные жидкости после центрифугировани€ при 17000 g в течение 20 минут комбинируют и ультрацентрифугируют в течение 1 часа 20 минут при 100000 g. Ќадосадочную жидкость ввод€т в ConA аффинную колонку (Affigel, Biorad) и св€занный материал элюируют и далее фракционируют с помощью ионообменной хроматографии на MonoQ колонке.
јнализ энзиматических активностей
α- аминоацилпептидгидролазные (микросомные) аминопептидазные активности в H110D препаратах характеризуют в анализах, использу€ L-лейцин, метионин, фeнилaлaнин, α- глутaминoвую кислоту и лизин-р- нитроанилиды (pNA). ¬се аминокислотные р-нитроанилидные субстраты (за исключением α- глутаминовой кислоты) получают от Sigma, Poole, Dorset UK, α- глутаминова€ кислота от Fluka, Dorset, UK. ќтдельные гидрофобные (лейцин- или фенил-аланин-) и зар€женные (α- глутаминова€ кислота-) аминокислотные pNA, как известно, €вл€ютс€ субстратами дл€ аминопептидаз-ћ(ApM) и -A(ApA) млекопитающих, соответственно, были выбраны как мера действи€ ингибиторов энзимов и сывороточного ингибировани€ на активность H110D аминопептидазы.
а) анализ микропластин
ячейки микро-ELISA пластины (Dynatech Immulon 1, Vitginia, USA) заполн€ют (каждую) 250 мкл либо 50 мћ HEPES, либо MOPS pH 7 плюс 10 мкг подлежащей анализу фракции. «атем плаcтины преинкубируют при 37oC в течение 10 минут перед тем, как добавить 10 мкл 25 мћ аминокислотного р-нитроанилидного субстрата на €чейку. «атем определ€ют оптическую плотность (ќƒ) в момент 0 на 405 нћ, использу€ ELISA считывающее устройство, а затем пластины инкубируют при 37oC в течение 15-30 минут.  оночное значение регистрируют, как и раньше, и рассчитывают ќƒ изменение в минуту на мг протеина.
b) ингибиторна€ чувствительность
—пособ, использованный дл€ анализа энзимов, тот же, что и в а), за исключением того, что ингибиторы добавл€ют к 250 мкл буфера плюс 10 мкл 1 мг/мл ConA H110D и предварительно инкубируют в течение 10 минут при 37oC перед добавлением субстратов (лейцин-pNA или α- глутаминова€ кислота-pNA). ѕроцент ингибировани€ рассчитывают следующим образом:

где x - Δ ќƒ/мин энзима без добавлени€ ингибитора, а
y - Δ ќƒ/мин энзима плюс ингибитор.
ƒев€ть соединений с различными классами энзимов тестируют отдельно: Amastatin, Bestatin (металлопротеаза, аминопептидаза), 1,10 фенантролин, ≈ƒ“ј (металлопротеаза), фосфорамидон (металлопротеаза, термолизин, коллагеназа), Aprotinin (серин-протеаза), Pepstatin (аспарагин протеаза), PMSF (серин- и цистеин-протеазы) и E64 (цистеин-протеаза). Amastatin, bestatin, 1,10 фенантролин, PMSF и пепстатин были получены от Sigma Dorset, UK. ¬се остальные ингибиторы были получены от Boehringer-Mannheim.  аждый ингибитор используют в двух концентраци€х, равных или больше, чем максимальные концентрации, рекомендованные Boehringer-Mannheim.
с) анализ ингибировани€ энзима антисывороткой
јнализ осуществл€ют по способу, описанному в а), за исключением того, что используют две микро-ELISA пластины. Ќа одной пластине 10 мкл ConA H110D (1 мл/мл) плюс 10 мкл антисыворотки от каждой овцы на €чейку предварительно инкубируют при 37oC в течение 15 минут. ¬торую пластину с 250 мкл HEPES/бикарбонатный буфер плюс 10 мкл либо фениланин-pNA, или α- глутаминова€ кислота-pNA субстрата на €чейку также предварительно инкубируют при 37oC в течение 15 минут. —меси ConA-сыворотки добавл€ют к смес€м буфер-субстрат на второй пластине с помощью мультипипетки ќпредел€ют Δ ќƒ/мин. ƒл€ внесени€ поправок процент ингибировани€ рассчитывают по формуле, приведенной ранее в разделе b), где х представл€ет среднее Δ ќƒ/мин дл€ €чеек, которые содержат энзим плюс сыворотку от негативных контрольных овец (вакцинированных ферритином селезенки лошади), а у Δ ќƒ/мин дл€ €чеек, которые содержат энзим плюс сыворотку от овец, вакцинированных H110D. ƒл€ внесени€ поправок (фиг.18) процент защиты рассчитывают, использу€ формулу в разделе b), где x - либо среднее количество €иц в фекали€х на грамм, либо среднее количество червей в контроле, а y - либо количество €иц в фекали€х на грамм во врем€ эксперимента, либо количество червей у отдельной овцы, вакцинированной H110D.
Ћокализаци€ активности энзима гистохимически
јминопептидазную активность демонстрируют на 10 мкм криостатированных отрезках Haemonchus contortus, использу€ L- лейцин-4-метокси -β- нафтиламид и L-глутамин -α- 4-метокси -β- нафтиламид в качество субстратов по способу Nachlas et al. (1957), Nakane et al., (1974) и Lojda et al. (1980).
Ёкспресси€ рекомбинантных H110D в эукариотической системе бакуловирусклетки насекомых
 онструирование плазмид экспрессии
3,5 кb PCR фрагменты, описанные ранее, создают за счет амплификации между олиго-dT-адаптером (который содержит Sal I сайт) и олиго-872, который представл€ет основани€ N 30-49 в M1AUS последовательности, и клонируют в pT 7 Blue вектор.  лон pT 73.5-2 ориентирован векторным полилинкерным BamHI сайтом с 5' конца и Hind III, XbaI и Sal I сайтами с 3' конца. ѕоследовательность с 5' конца имеет вид:

«вездочки указывают 3' dT/dA выступ, используемый дл€ клонировани€ в pT 7 Blue вектор.
3,5 PCR клон 2 переваривают Hind III (отдельный сайт в полилинкерной векторной последовательности с 3' конца 3,5 K гена) и концы дополн€ют деоксинуклеотидами, использу€ ƒЌ  полимеразу (фрагмент  ленова), по способу Maniatis et al. (1982). Ћинкер BamHI (5' CGGATCCG 3', New Ehgland Biolabs Catalog N 1021) лигируют с тупыми концами, и клоны с дополнительным BamHI сайтом, который позвол€ет вырезать полной длины последовательность H110D гена, как BamHI фрагмент, отбирают. ‘рагмент BamHI выдел€ют электрофоретически на 0,6% вес. /об. агарозном геле в трис-ацетатном буфере, а затем очищают, использу€ (GENECLEAN (B10101). Ёту процедуру провод€т дважды. «атем этот очищенный фрагмент лигируют с BamHI-отрезком, фосфатазируют pBlue Bac II (Invitrogen Corp.), и клоны, содержащие фрагмент в правильной ориентации (т. е. с 5' концом 3,5 PCR клона 2) помещают под контроль бакуловирусного полиэдринового промотора, определенного перевариванием Nhel и XBal. ѕолученную плазмиду частично переваривают BamHI и концы дополн€ют, как указано выше. NcoI линкер, содержащий ATG (5' CCC GG 3'; New England Biolabs Catalog N 1040), добавл€ют и смесь лигируют.  лоны, содержащие линкер, лигированный по 5' концу BamHI сайта 3,5 PCR клона 2, а но 3' сайт, определ€ют, переварива€ Ncol. ѕолученна€ плазмида, обозначенна€ pBB 3,5-2 (N), схематически изображена на фиг.19.
Ёта конструкци€ приводит к встраиванию в рамке ATG на 5' конце вставки 3,5 PCR клона 2 дл€ инициации трансл€ции. ѕоследовательность, окружающа€ этот инициирующий ATG, представл€ет собой:

¬ экспрессированном протеине не хватает аминокислот 2-9, соответствующих H110D последовательности, и в ней содержатс€ 3 аминокислоты линкерной последовательности, непосредственно после ATG.
—оздание рекомбинантных бакуловирусов, содержащих H110D последовательности
ѕлазмиду pBB 3,5-2 (N) трансформируют в Spodoptera frugiperda (Sf 9) клетках (полученных от Invitrogen Corp.), использу€ линейную ƒЌ  вируса €дерного полиэдроза Autographica californica (ACNPV) и катионные липосомы (Invitrogen Corp. трансфекционный модуль), в соответствии с указани€ми изготовителей.  летки культивируют в TC-100 среду (SIGMA), дополненную сывороткой плода теленка (CSL Ltd; термоинактивирована при 56oC в течение 45 минут) и антибиотиками (пенициллин/стрептомицин, гентамицин CSL Ltd).  онтрольную трансфекцию, использу€ pBB 3,5-2 (N) плазмиду с ATG вставкой по 3' концу 3,5 PCR клона 2 последовательности, также осуществл€ют. –екомбинантные бл€шки отбирают на том основании, что вектор Blue Bac II также кодирует E. coli β- галактозидазу (β- gal), включа€ X-gal в агарозный слой при рекомендуемых уровн€х. ѕровод€т отбор синих бл€шек и подвергают двум циклам дополнительной очистки бл€шек, после чего инфицированные монослои уже не демонстрируют свидетельств содержани€ дикого типа вируса (что про€вл€етс€ наличием €дерной полиэдры). ќчищенные вирусы обозначают 3,5-2-P2A, -P3A и P4A и амплифицируют двум€ последовательными инфицировани€ми Sf 9 клетками перед использованием. Ѕл€шки, выделенные из контрольной трансфекции, обозначают 3,5-2-rev.
ќценка экспрессии H110D в клетках насекомых, инфицированных рекомбинантным бакуловирусом
ћонослои Sf 9 клеток (1 · 106 клеток в 25 см2 скл€нках) инфицируют 3,5-2 вирусами, дикого типа вирусом (wt), контрольным вирусом, экспрессирующим β- gal, или не инфицируют. ѕосле 4 дней выращивани€ при 26oC монослои отдел€ют осторожным встр€хиванием, клетки выдел€ют центрифугированием (2000 об/мин, 10 минут) и клеточный осадок разрушают трем€ циклами замораживание - оттаивание. ѕолученные лизаты снова суспендируют в 500 мкг PBS и аликвоты по 25 мкл анализируют на ApM активность с помощью анализа в микро€чейках.
15 мкл аликвоты (3 · 104 клеток эквиваленты) вышеуказанных лизатов обрабатывают электрофоретически на денатурированных 7,5% SDS-полиакриламидных гел€х. «атем один гель подкрашивают  умасси синим дл€ оценки уровн€ экспрессии. ќстальные гели подвергают ¬естернблоттингу и блоты зондируют анти-H110D (как было указано ранее).
–езультаты
јнализ иммуноположительных клонов
јнализ антител, аффинно-очищенных на клоне M1
јффинно-очищенные антитела, специфические дл€ каждого из 5 антителоположительных клонов, получают и используют дл€ зондировани€ ¬естерн блота H110D-обогащенных экстрактов.  ак показано на фиг. 8, все 5 клонов, по-видимому, распознают H110D дублет. ќднако реакци€ с клоном M1 дает более сильный сигнал (фиг.8d) по сравнению с λ gt II негативным контрольным блотом. ѕоэтому этот клон исследуют далее.
Ќорзернблоттинг клона M1
–езультаты Ќорзернблоттинга Haemonchus contortus м–Ќ , зондированной M1 вставкой, представлены на фиг.9. –аспознаетс€ отдельна€ м–Ќ  полоса приблизительно 3,5 кb. Ёто достаточный размер дл€ кодировани€ протеина около 110 кb.
јнализ последовательности клона M1
јнализ рестрикционных переваров ƒЌ  с помощью EcoRI демонстрирует M1 вставку приблизительно 300 bp. ƒЌ  последовательность M1 фрагмента определена и представлена на фиг.3. ‘рагмент содержит 295 bp и открытую считывающую рамку, начинающуюс€ с основани€ номер 3.
Ќорзернблоттинг клона B1A
Ќорзернблоттинг Haemonchus contortus м–Ќ , зондированной B1A вставкой, представлен на фиг. 9c.  ак и дл€ M1, распознаетс€ отдельна€ м–Ќ  полоса приблизительно 3,5 кb.
—еквенирование клонов B1A и B2
 лоны B1A были секвенированы (последовательности ID N 2 и 3) и полна€ последовательность (последовательность ID N 2) представлена в сопоставлении с H11-1 (последовательность ID N 19) и Aust B1 (последовательность ID N 6) на фиг. 5. ¬ставка составл€ет 484 bp и имеет полную ORF от первого основани€. 3 фрагмента B2, полученные в результате переваривани€ EcoRI, секвенируют, и полна€ последовательность дл€ B2 (последовательность ID N 4) имеет 581 bp. ќна представлена в сопоставлении с H11-2 на фиг. 4. ѕоследовательность имеет ORF от положени€ 3 до 213 bp, стоп кодон и нетранслируемый участок, совместимый с участком 2,5 кb полученной в PCR последовательности (последовательность ID N 7).
Ёкспресси€ M1 и B1A в E. coli
¬ результате субклонировани€ в вектор экспрессии GST получают клоны, которые экспрессируют протеины сли€ни€ 38-40 кb дл€ M1 и 45 кb дл€ B1A. Ёто согласуетс€ с предсказанными дл€ вставок размерами, обеспечива€ молекул€рный вес глутатион -S- трансферазы. ќба протеина сли€ни€ очень интенсивно реагируют в ¬естернблоттинге с аффинно-очищенными антителами к H110DE (фиг. 11). ѕротеины сли€ни€ экспрессируютс€ как нерастворимые тела включений.
–еакци€ антител у овец, вакцинированных M1-GST и B1A-GST протеинами сли€ни€
јнтисыворотку овец, инфицированных протеинами сли€ни€, тестируют в ¬естернблоттинге против H110D препаратов.  ак GST-M1, так и GST-B1A привод€т к выработке антител, которые специфически распознают H110D дублет (фиг. 12). —ыворотка от негативно контрольных овец не распознает H110D дублет.
¬ыделение и характеризаци€ клонов, селектированных за счет гибридизации с ƒЌ  вставок M1 или B1A
ѕодтвержденные позитивные клоны, гибридизованные с M1 зондом, обозначают M1AUS (последовательность ID N 5), а клон, гибридизованный с B1A, обозначают AustB1 (последовательность ID N 6). –естрикционное переваривание очищенных плазмидных ƒЌ  EcoRI вы€вл€ет размер вставки около 900 bp дл€ M1AUS и около 1,6 кb дл€ Aust B1.  ак представлено на фиг. 9b) и 9d), при Ќорзернблоттинге M1AUS и Aust B1 гибридизуютс€ с того же размера м–Ќ  (около 3,5 кb), что и M1 и B1A.
јнализ последовательности M1AUS
ѕолное секвенирование M1AUS фрагмента выполн€ют, использу€ "прогулку" синтетических олигонуклеотидов вдоль ƒЌ  с каждого конца. јнализ полученной последовательности вы€вл€ет M1AUS вставку в 948 bp, что представлено на фиг. 3. ѕоследовательность (последовательность ID N 5) начинаетс€ с ATG (который кодирует метионин) и содержит открытую считывающую рамку (ORF) по всей длине его. ѕоследовательность на 19 пар оснований длиннее, чем M1 последовательность, с 5' конца, и на 634 bp длиннее с 3' конца. ѕоследовательности, общие дл€ двух клонов (основани€ 20- 314), идентичны, за исключением двух нуклеотидных различий в положении третьего кодона. —равнение всех возможных считывающих рамок в различных базах данных показывают, что считывающа€ рамка, начинающа€с€ с ATG у основани€ номер один, обеспечивает гомологичность с членами семейства микросомных аминопептидаз.
ѕоследовательность AustB1
ѕолное секвенирование Aust B1 фрагмента выполн€ют, использу€ "прогулку" синтетических олигонуклеотидов вдоль ƒЌ  с обоих концов. ƒЌ  последовательность (последовательность ID N 6) представлена на фиг. 5. Ётот клон имеет длину 1689 bp и имеет ORF с остатка 2. Ёта последовательность образует часть H11-1, как видно на фиг. 1. “рансл€ци€ аминокислот этой последовательности демонстрирует фрагмент сайта св€зывани€ цинка, характерный дл€ аминопептидаз.
PCR амплификаци€ кƒЌ  м–Ќ  H110D
PCR с использованием M1AUS праймеров
кƒЌ  синтезируют из Haemonchus contortus м–Ќ , использу€ в качестве праймера олиго-dT, содержащий адапторную последовательность, дл€ облегчени€ последующего клонировани€ и манипул€ций с ƒЌ . «атем эту ƒЌ  используют дл€ амплификации M1AUS последовательности в PCR, использу€ в качестве праймера 5' конца синтетический олигонуклеотид, основанный на положени€х 965-885. PCR фрагмент около 2,5 кb амплифицируют. ќн имеет размер, приблизительно соответствующий ожидаемому на основании известного размера м–Ќ  и последовательностей кƒЌ  аминопептидазы млекопитающих.
ќсуществл€ют второй набор PCR реакций, использу€ праймер вблизи 5' конца M1AUS (основани€ 30-49). Ќа агарозном геле детектируют четыре полосы. Ќаибольша€ из них, при 3,5 кb, соответствует предсказанному размеру PCR продукта.
 лонирование и секвенирование 2,5 кb и 3,5 кb PCR продуктов из M1AUS праймеров
2,5 кb и 3,5 кb PCR продукты клонируют и обозначают 2,5 PCR (последовательность ID N 7) и 3,5 PCR (последовательность ID N 8, 14 и 15 дл€ клонов N 2, 10 и 19 соответственно). ¬ Ќозернблоттинге 2,5 PCR и 3,5 PCR (клоны 2, 3.5 PCR-2) гибридизуютс€ с м–Ќ  около 3,5 кb (фиг. 9e, 9f) таким же образом (по отношению к возрасту Haemonchus, использованных дл€ получени€ м–Ќ ), что и M1, B1A, M1AUS и Aust B1.
ѕолное секвенирование клонов осуществл€ют в "олигонуклеотидной прогулке".  ак видно на фиг. 1, последовательность дл€ 2,5 кb продукта (последовательность ID N 20) и последовательность дл€ 3,5 кb продукта (последовательность ID N 8) €вл€етс€ основной частью H11-3 (последовательность ID N 21). “рансл€ци€ аминокислот обоих этих последовательностей (представленных на фиг. 6) содержит фрагмент св€зывани€ цинка His Glu Xaa His Xaa Trp (HEXXHXW), характерный дл€ микросомных аминопептидаз.
—еквенирование 5' конца PCR клонов
кƒЌ  синтезируют, использу€ праймерное типирование консервативной последовательности в кƒЌ  клона Aust B1, 2,5 PCR и 3,5 PCR (последовательности ID N 6, 7 и 8), которые гибридизуютс€ с м–Ќ  дл€ этих последовательностей около 1,3 кb с 5' конца кƒЌ  завершают C-хвостом с 5' конца, а затем провод€т PCR реакции с универсальным Anсhor (A) праймером дл€ 5' конца и трем€ праймерами, специфическими дл€ каждой из последовательностей Aust B1, 2,5PCR и 3,5 PCR-клона 2 (последовательности ID N 6, 7, 8) дл€ 3' конца. ¬ каждой реакции получаетс€ продукт предсказанного размера, а именно 1,3 кb : 1301 bp (последовательность ID N 9), 1280 bp (последовательность ID N 10) и 1292 (последовательность ID N 11) соответственно. ¬се три последовательности имеют нетранслируемый участок с 5' конца (фиг.2). ¬се начинаютс€ с одной и той же 22 bp последовательности (5'GGTTTAATTACCCAAGTTTGAG 3'), котора€ известна как сплайсированна€ лидерна€ последовательность I (SLI) и присутствует в нетранслируемом 5' участке широкого круга нематод Huang et al., 1990. ¬ последовательност€х ID N 9 и 10 SLI последовательность следует непосредственно перед инициирующим ATG. ¬ последовательности ID N 11 существуют 13 bp между SLI и инициирующим ATG. ¬се три последовательности имеют полную ORF.
—еквенирование Anst B1 3' конца PCR клона
»спользу€ специфический праймер, соответствующий положени€м 1414-1438 в Aust B1 (последовательность ID N 6), PCR продукт дает полосу предсказанного размера около 1,3 кb. —еквенирование клонированной полосы приводит к получению последовательностей ID N 12 и 13. ќни дают ORF из 1-615 bp и практически нетранслируемый участок.
јнализ последовательностей клонированных PCR продуктов
—оставы последовательностей, описанных ранее и обозначенных H11-1, H11-2 и H11-3, представлены на фиг.2. јминокислотные последовательности, предсказанные дл€ них, представлены на фиг. 6a. «начени€ предсказанных трансл€ций представленных ƒЌ  последовательностей совершенно подтверждаютс€ соответствием с аминокислотными последовательност€ми, определенными деградацией Ёдмана из CN Br и протеолитическим расщеплением фрагментов (фиг.7). “ак, 27 остатков из 29 остатков N-терминальной последовательности H11S (последовательность ID N 16) соответствуют H11-2 из остатков 61-90 (фиг.7b). —оответстви€ валина (V) в положении 78 и глицина (G) в положении 90 €вл€ютс€ характеристическими дл€ H11-1, тогда как H11-3 имеет аспарагин (N) в положении 90 и H11-1 имеет лейцин (L) в положении 86 (что соответствует положению 78 в H11-2). ƒва остатка H11S N-конца аминокислотной последовательности (последовательность ID N 16) не соответствуют ни одной из трех представленных H110D последовательностей. ќсобо следует отметить точное соответствие очень близких, но различающихс€ послодовательностей Pep A и B (ранее описанных в WO 90/11086) с H11-2 и H11-1, соответственно на участке остатков 540-555. јналогично, на участке остатков 450-470 Pep D точно соответствует H11-2, тогда как аналогична€, но различающа€с€ Pep E более близко соответствует H11-3.
¬ качестве примера транслированную аминокислотную последовательность одной из полной длины последовательностей (H11-3) сравнивают на фиг. 6b с двум€ последовательност€ми микросомных аминопептидаз млекопитающих. √омологичность H110D трансл€ции с этими аминопептидазами представлена как заключение в пр€моугольник идентичных аминокислот. ’арактеристическим фрагментом микросомных аминопептидаз €вл€етс€ аминокислотна€ последовательность HEXXHXW, котора€ функционирует как сайт св€зывани€ цинка (Jongeneel et al., 1989; Vallee et al., 1990); это показано звездочками на фиг. 6. Ёта последовательность, котора€ должна присутствовать в трансл€ци€х H11-1, H11-2 и H11-3, €вл€етс€ консервативной во всех микросомных аминопептидазах. ƒругими характеристиками, общими дл€ микросомных аминопептидаз Haemonchus и млекопитающих, €вл€ютс€ присутствие сравнительно коротких внутриклеточных участков, отдельной трансмембранной последовательности, соседней с N-концом, и несколько потенциальных сайтов гликолизировани€. ”ровни гомологии (сходства в 52-55%, идентичности в 30-32%) H11-1, -2 и -3 с микросомными аминопептидазами млекопитающих представлены в таблице 2.
—аузернблоттинг
–езультаты —аузернблоттинга H. contortus геномной ƒЌ , зондированной различными H110D кƒЌ  клонами и PCR продуктами, представлены на фиг. 10. ¬се зонды демонстрируют множество полос гибридизации; это типично дл€ мультигенного семейства.  ак и ожидалось, B1A и Aust B1 демонстрируют аналогичный ход гибридизации друг с другом, так же, как и M1AUS и 3,5 кb PCR. ќднако эти схемы заметно отличаютс€ друг от друга и от того, что наблюдаетс€ дл€ 2,5 кb PCR зонда, даже в услови€х умеренной жесткости (фиг. 10а), что отражает различные уровни гомологичности между этими трем€ кƒЌ .
ƒемонстраци€ активностей аминопептидаз, св€занных с H110D
Ѕыло обнаружено, что активность микросомной аминопептидазы св€зана с теми фракци€ми, которые содержат H110D, т.е. надосадочна€ жидкость после ультрацентрифугировани€ Thesit экстрактов, ConA св€зывающих фракций (ConA H110D) и фракций, содержащих H110D, полученных ионообменной хроматографией на Mono Q колонке (таблица 3). —пецифические активности со всеми тестированными субстратами повышаютс€ с повышением чистоты H110D.
¬ли€ние ингибиторов аминопептидаз млекопитающих на активности аминопептидазы H110D
ƒобавление ингибитора бестатина (который ингибирует микросомную аминопептидазу млекопитающих) к ConA H110D в концентраци€х, рекомендуемых изготовителем (Boehriger Mannheim), снижает активность против лейцин-р-нитроанилида приблизительно на 70%. ѕроведена сери€ экспериментов дл€ определени€ активности ингибировани€ дл€ р€да протеазных ингибиторов. “е ингибиторы, которые не специфичны дл€ металлопротеаз или аминопептидаз, но обладают ингибирующим эффектом на скорость реакции. “е ингибиторы, которые, как известно, вли€ют на металлопротеазу или аминопептидазу, оказывают вли€ние на скорость реакции, как видно из данных таблицы 4. Ќаиболее эффективным ингибитором оказалс€ 5 мћ фенантролин (см. таблицу 4).
—убфракционирование H110D
–аспределение активностей, св€занных с фракци€ми после ионообменной хроматографии ConA H110D на Mono Q, представлено на фиг. 13a, а SDS-PAGE фракций - на фиг. 13b.
ƒалее, энзиматическа€ активность св€зана с субфракци€ми H110D, разделенными рециклизацией изоэлектрического фокусировани€ свободного потока (фиг. 14 и 15). ѕри низких значени€х pI (pH 4,5) эти субфракции содержат только более крупные из полос, составл€ющих H110D дублет, видный на SDS-PAGE, а при более высоких значени€х (pH 6,5) они содержат только меньшие полосы, которые составл€ют H110D дублет. ѕромежуточные фракции содержат все эти полосы. ћеньшие полосы можно также получить как отдельную фракцию с помощью ионообменной хроматографии на Mono Q, использу€ Pharmacia SMART® аппарат. ¬се эти субфракции св€зывают антитела овец с H110D аффинно-очищенных на протеине, экспрессированном λ gt II клоном M1, тогда как антитела, элюированные из λ gt II без вставки, не св€зывают (фиг. 14c). ¬се субфракции св€зывают мышиные моноклональные антитела, обозначаемые TS«/19,7 (фиг. 14c), которые также св€зываютс€ с рекомбинантным протеином, экспрессируемым клоном M1. ¬се субфракции демонстрируют микросомную антипептидазную активность (фиг. 15c), хот€ эта активность сравнительно ниже дл€ фракций, полученных при наиболее высоких и наиболее низких значени€х pI. Ёта более низка€ активность может быть приписана более низкой концентрации протеинов, эффектам крайних значений pH во врем€ субфракционировани€ или требовани€ми наличи€ как наибольших, так и наименьших полос дл€ максимальной активности.
¬акцинаци€ выделенными компонентами H110D
¬ыделенные высшие и низшие полосы, полученные изоэлектрическим фокусированием свободного потока или ионообменной хроматографией, индуцируют образование защитных антител, когда их инъецируют в овец, что иллюстрируетс€ следующим экспериментом. 30 овец возраста примерно 6 мес€цев раздел€ют на 5 групп по 6 овец так, чтобы вес овец в каждой группе был одинаковым.  аждому животному инъецируют по 150 мкг протеина в трех равных дозах по способу Munn et al. (1992) и Tavernor et al. (1992a, b) за промежуток времени 54 дн€. ∆ивотным в группе L ввод€т нижние (меньшие) полосы H110D дублета, группе U верхнюю полосу, L+U - снова объединенные верхнюю и нижнюю полосы, D - две (неразделенные) полосы, полученные изоэлектрическим фокусированием свободного потока при промежуточных значени€х pH, и в качество контрол€ (группа C) ферритин селезенки лошади (антигенный неродственный протеин). ќвец заражают 10000 инфекционных личинок спуст€ три недели после третьей инъекции, и эксперимент заканчивают на 29-31 день после инфицировани€.
–езультаты эксперимента суммированы на фиг. 16. ¬ведение любой из субфракций снижает количество €иц паразитов в эксперименте на 90% и уменьшает полное количество червей на 63-84%, причем все демонстрируют существенное отличие (p < 0,05) по сравнению с контрол€ми, использу€ непараметрический статистический анализ. ”меньшение количества червей-самок (70-88%) оказываетс€ больше, чем уменьшение количества червей-самцов, и (за исключением уменьшени€ количества самцов-червей у овец, которым вводили рекомбинантные верхнюю и нижнюю полосы, составл€ло p < 0,07) дл€ обоих полов уменьшение было значительным (p < 0,05).
¬акцинаци€ H11S и H11A
”сеченную, водорастворимую форму H110D (H11S, котора€ сохран€ет энзиматическую активность) можно получить из нативной молекулы, обработанной эластазой. ќбнаружено, что эта форма содержит преимущественно ApM-подобную активность, a Thesit экстракт эластазного перевара (H11A) обогащен ApA-подобной активностью.
ќтношение
јминопептидаза-M (лейцин-pNA): - јмиропептидаза-A (α- глутаминовой кислоты-pNA)
H110D - 1,44:1
H11S - 26,0:1
H11A - 0.48:1
Ќижеследующий эксперимент показывает, что вакцинаци€ овец либо H11S, либо Ќ11A обеспечивает защиту против Haemonchus заражени€ или инфицировани€. 18 овец (примерно восьмимес€чных) дел€т на 3 группы по 6 так, чтобы в каждой группе вес овец был примерно одинаков.  аждому животному ввод€т всего 100 мкг протеина в двух равных дозах по способу Munn et al. (1992) и Tavernon et al. (1992a, b) за 23 дн€. ∆ивотным в группе A ввод€т H11A, группе S ввод€т H11S, а группе C - ферритин селезенки лошади (антигенно неродственный протеин) в качество негативного контрол€. «атем овец заражают 10000 инфекционных личинок спуст€ 25 дней после второй инъекции, и экcперимент заканчивают через 34-36 дней после инфицировани€. –езультаты эксперимента приведены на фиг. 17. ¬ведение H11S снижает количество €иц паразитов за врем€ эксперимента на 89% и снижает полное количество червей на 76%. ¬ведение H11A уменьшает количество €иц паразитов за врем€ эксперимента на 84%. Ёто показывает заметное различие (p < 0,05) от контрольных значений по данным непараматрического статистического анализа.
»нгибирование H110D аминопептидазной активности антителами
–астворы, содержащие H110D, инкубируют сывороткой от отдельных овец, которым были введены фракции, содержащие H110D от контрольных овец. «атем растворы анализируют на активность аминопептидазы с использованием фенилаланина и α- глутаминовой кислоты pNA в качестве субстратов. —тепень ингибировани€ активности (максимально 80%) коррелирует с уровнем защиты, демонстрируемым отдельными овцами, у которых отбирали сыворотку (см. фиг. 18).
Ћокализаци€ энзиматической активности
«амороженные отрезки взрослых Haemonchus contortus исследуют на активность аминопептидазы.  ак видно на фиг. 19, активности энзима аминопептидазы локализованы в люминальной поверхности кишечника. H110D протеин также специфически обнаружен в этом место.
Ёкспресси€ H110D (3,5 PCR клон. 2) с использованием эукаротической системы бакуловирус-клетки насекомого
Ёкспресси€ аминопептидазной активности в клетках насекомого
»нфицированные клетки собирают и оценивают на аминопептидазную активность, использу€ phe-, leu-, met- и lys -pNA в качество субстратов. јнализ осложн€етс€ наблюдением, что клетки насекомых обладают аминопептидазной активностью с заметным преимуществом дл€ lys-св€звнных амидных св€зей. ќднако клеточные экстракты, содержащие экспрессированный H110D дополнительно расщепл€ютс€ leu-, met- и phe-pNA в пор€дке предпочтительности.
ћолекул€рный вес и иммунореактивность экспрессированного H110D (3,5 PCR клона 2) протеина
ќбразцы инфицированных или контрольных клеточных экстрактов обрабатывают электрофоретически на 7,5% SDS-полиакриламидном геле, который затем окрашивают  умасси синим. 3,5-2-–3ј и 3,5-2-P4A инфицированные клеточные лизаты оба содержат полосу того же размера, что и H110D, 110 кb, котора€ мигрирует непосредственно под совместно-экспрессированным β- gal, который имеет молекул€рный вес 120 кb. Ёта полоса 110 кb не присутствует ни в одном из негативных контрольных лизатов. (ќна также отсутствует в P2A лизате, который не экспрессирует энзимную активность).
ƒубликатный гель подвергают ¬естернблоттингу и зондируют анти-H110DN (фиг. 21). ќчень сильна€, специфически позитивна€ иммунореакци€ наблюдаетс€ дл€ 110 кb полосы, экспрессированной 3,5-2-P3A и 3,5-2-P4A, и дл€ нативного H110D дублета в контрольной полосе, содержащем ConA H110D, тогда как реакци€ не наблюдаетс€ ни дл€ одной из контрольных негативных полос.
‘ормула изобретени€: 1. ћолекула нуклеиновой кислоты, содержаща€ не менее одной последовательности, принадлежащей к набору последовательностей JD N 1 - 15 и JD N 19 - 21, представленных на фиг.2, 3, 4 или 5, кодирующих антигенные части, соответствующие по меньшей мере частично указанным последовательност€м, или гельминтные энзимы аминопептидазы, или последовательност€м, кодирующим гельминтные энзимы аминопептидазы, идентичные им не менее, чем на 50%, или которые гибридизируютс€ любой из указанных последовательностей в услови€х 2 SSC при комнатной температуре, причем SSC соответствует 0,15 M раствору хлорида натри€, 0,015 M раствору цитрата натри€ при pH 7,2.
2. ћолекула нуклеиновой кислоты, содержаща€ не менее одной нуклеотидной последовательности, способной кодировать полипептид, вызывающий выработку защитных антител против гельминтных паразитов, причем нуклеотидна€ последовательность включает не менее одного участка, кодирующего антигенные детерминанты из последовательностей JD N 1 - 15 и JD N 19 - 21, кодирующих аминопептидазу и представленных на фиг. 2, 3, 4 и 5.
3. ћолекула нуклеиновой кислоты, содержаща€ не менее одной нуклеотидной последовательности, соответствующей или комплементарной не менее чем одной последовательности, выбранной из последовательности клонов MI, BIA, BIA-3', B2, MIA US, Aust B1, 0,14 - 0,15 (2,5 PCR), 014 - 872 (3,5 PCR2), A-648 (5' конец B1), A-650 (5' конец 2,5 PCR), A-649 (5' конец 3,5 PCR), 014 - 178 (3' конец Aust B1 2), 014 - 178 (3' конец Aust B1 3 и 6), 014 - 872 (3,5 PCR 10) и 014 - 872 (3,5 PCR 19), HII-1, HII-2 и HII-3, SEQ ID NOS: 1 - 15 и 19 - 21 соответственно, которые содержат последовательность, идентичную на 50% и более, представленной на фиг.2, 3, 4 и 5, или последовательностей, которые имеют идентичные им последовательности на 50% или более, или которые гибридизуютс€ с любой из указанных последовательностей в услови€х 2 SSC, при комнатной температуре, где SSC соответствует 0,15 M раствору хлорида натри€, 0,015 M цитрата натри€ при pH 7,2.
4. ¬ектор экспрессии или клонировани€, содержащий молекулу нуклеиновой кислоты по любому из пп.1 - 3.
5. —интетический полипептид, содержащий не менее одной аминокислотной последовательности, представл€ющей энзим-аминопептидазу или ее антигенную часть, соответствующие всей части нуклеотидной последовательности JD N 1 - 15 и JD N 19 - 21, приведенной на фиг. 2, 3, 4 и 5 или их функционально эквивалентные варианты, отличающиес€ от синтетического полипептида, соответствующего протеиновому дублету H 110 или его синтетическому полипептиду, выбранному из:
6. ѕолипептид по п. 5, отличающийс€ тем, что он €вл€етс€ очищенным и содержит аминокислотную последовательность, состо€щую из энзима аминопептидазы или его антигенной части, соответствующей всей или части нуклеотидной последовательности JD N 1 - 15 и JD N 19 - 21, представленной на фиг.2, 3, 4 или 5, или их функционально эквивалентных вариантов.
7. ѕолипептид по п.5 или 6, отличающийс€ тем, что он существует в форме полипептида сли€ни€, содержащего дополнительный полипептид, слитый с указанной аминокислотной последовательностью, определенной в п.5 или 6.
8. —пособ получени€ синтетического полипептида по любому из пп.5 - 7, отличающийс€ тем, что культивируют прокариотические или эукариотические клетки, содержащие молекулу нуклеиновой кислоты по любому из пп.1 - 3 в услови€х, обеспечивающих экспрессию указанного полипептида, и выдел€ют указанный полипептид.
9.  омпозици€ вакцины дл€ стимулировани€ иммунной реакции против гельминтных паразитов у человека или животных, отличающа€с€ тем, что она содержит по крайней мере один синтетический полипептид по любому из пп.5 - 7, или вирус или клетку-хоз€ина, содержащие встроенную молекулу нуклеиновой кислоты по любому из пп.1 - 3 дл€ стимул€ции иммунной реакции полипептидами, кодируемыми встроенной молекулой нуклеиновой кислоты, и фармацевтически приемлемый носитель.
10. —пособ стимул€ции иммунной реакции против гельминтных паразитов у человека или животных, отличающийс€ тем, что осуществл€ют введение вакционной композиции по п.9.
11. ќлигосахарид общей формулы

12. ќлигосахарид по п.12, отличающийс€ тем, что он соответствует формуле

13. ќлигосахарид по п. 11 или 12, отличающийс€ тем, что он св€зан с синтетическим полипептидом по любому из пп. 5 - 7.