Главная страница  |  Описание сайта  |  Контакты
СПОСОБ ПОЛУЧЕНИЯ САХАРА 1,5-D-АНГИДРОФРУКТОЗЫ (ВАРИАНТЫ), АНТИОКСИДАНТ, ПОДСЛАЩИВАТЕЛЬ
СПОСОБ ПОЛУЧЕНИЯ САХАРА 1,5-D-АНГИДРОФРУКТОЗЫ (ВАРИАНТЫ), АНТИОКСИДАНТ, ПОДСЛАЩИВАТЕЛЬ

СПОСОБ ПОЛУЧЕНИЯ САХАРА 1,5-D-АНГИДРОФРУКТОЗЫ (ВАРИАНТЫ), АНТИОКСИДАНТ, ПОДСЛАЩИВАТЕЛЬ

Патент Российской Федерации
Суть изобретения: Изобретение относится к биотехнологии и пищевой промышленности и может быть использовано для приготовления сахара 1,5-D-ангидрофруктозы. Сахар получают путем ферментативной обработки альфа-1,4-глюкона ферментом альфа-1,4-глюканлиазой. Фермент выделяют из грибков, водорослей или получают рекомбинантным путем. Изобретение позволяет получить большое количество 1,5-D-ангидрофруктозы для использования в качестве антиоксиданта и послащивателя. 4 с. и 13 з.п.ф-лы, 20 табл., 20 ил.
Поиск по сайту

1. С помощью поисковых систем

   С помощью Google:    

2. Экспресс-поиск по номеру патента


введите номер патента (7 цифр)

3. По номеру патента и году публикации

2000000 ... 2099999   (1994-1997 гг.)

2100000 ... 2199999   (1997-2003 гг.)
Номер патента: 2140988
Класс(ы) патента: C12P19/02, C12N15/60, C12N9/88, C07H3/10, A23L1/22, A23L1/236
Номер заявки: 96108929/13
Дата подачи заявки: 15.10.1994
Дата публикации: 10.11.1999
Заявитель(и): Даниско А/С (DK)
Автор(ы): Шукун Ю (CN); Кирстен Бойсен (DK); Карстен Матиас Краг (DK); Майя Бойко (DK); Йохн Нильсен (DK); Ян Маркуссен (DK); Тове Мартель Ида Эльса Кристенсен (DK)
Патентообладатель(и): Даниско А/С (DK)
Описание изобретения: Изобретение относится к использованию фермента, в частности альфа-1,4-глюканлиазы, для получения 1,5-D-ангидрофруктозы из субстратов на основе альфа-1,4-глюкана.
Настоящее изобретение относится также к использованию сахара, в частности 1,5-D-ангидрофруктозы, в качестве антиоксиданта, в особенности антиоксиданта для пищевых продуктов и напитков.
Изобретение относится к использованию 1,5-D-ангидрофруктозы в качестве антиоксиданта в качестве подслащивателя, в частности в качестве подслащивателя для пищевых продуктов и напитков, предпочтительно пищевых продуктов и напитков, употребляемых человеком.
В патенте Франции 261750 и публикации Baute et al., Phytochemistry, Vol. 27, N 11, p. 3401-3403 (1988) сообщается о продуцировании 1,5-D-ангидрофруктозы в Morchella vulgaris, по-видимому, за счет ферментативной реакции. Выход полученной 1,5-D-ангидрофруктозы очень низкий. Несмотря на указание на возможную ферментативную реакцию ни в одной из этих публикаций не приведены какие-либо последовательности аминокислотных остатков, не говоря уже о какой-либо информации о последовательности нуклеотидов. В приведенных публикациях сообщается о том, что 1,5-D- ангидрофруктоза может выступать в роли предшественника при получении пирона микротецина.
Yu et al., Biochimica et Biophysica Acta, Vol. 1156, pp. 313-320 (1993) сообщают о получении альфа-1,4-глюканлиазы из красных морских водорослей и о ее применении для расщепления альфа-глюкана с целью получения 1,5-D-ангидрофруктозы. Выход полученной 1,5-D-ангидрофруктозы очень низкий. Несмотря на указание на возможную ферментативную реакцию в приведенной публикации не приведены какие-либо последовательности аминокислотных остатков для указанного фермента, не говоря уже о какой-либо информации о кодирующей его последовательности нуклеотидов. В этой публикации также указывается, что источником альфа-1,4-глюканлиазы являются водоросли.
Типичным субстратом на основе альфа-1,4-глюкана является крахмал. В настоящее время крахмалы находят широкое применение в промышленности, главным образом потому, что они являются дешевым исходным продуктом.
Ферменты, расщепляющие крахмал, можно разделить на две категории. Гидролазы расщепляют крахмал до глюкозы или олигомеров глюкозы. Вторую группу ферментов, расщепляющих крахмал, составляют фосфорилазы, которые в присутствии неорганического фосфата продуцируют из крахмала глюкозо-1-фосфат.
1,5-D-Ангидрофруктозу можно также получить химически - см. работу Zichenthaler, Tetrahedron Letters, Vol. 21, pp. 1429-1432. Однако химический синтез включает большое количество стадий и не приводит к получению больших количеств 1,5-D-ангидрофруктозы.
По указанной причине синтетический путь получения 1,5-D-ангидрофруктозы является очень дорогим.
Таким образом, необходим дешевый и простой способ получения 1,5-D-ангидрофруктозы, который позволял бы получать 1,5-D-ангидрофруктозу в больших количествах.
Далее антиоксиданты обычно используются для защиты от кислорода, который оказывает вредное воздействие на такие вещества, как пищевые продукты. Двумя широко используемыми антиоксидантами являются GRINDOX 142 и GRINDOX. 1029. Указанные антиоксиданты содержат множество компонентов и их производство является дорогим.
Таким образом, необходимо разработать более простые и дешевые формы антиоксидантов.
Далее в процессе приготовления пищевых продуктов и напитков часто используют подслащиватели. Однако многие подслащиватели дороги и их сложно получать.
Таким образом, необходимы более простые и дешевые формы подслащивателей.
В соответствии с настоящим изобретением заявляется способ получения сахара 1,5-D-ангидрофруктозы, включающий обработку альфа-1,4-глюкана ферментом альфа-1,4- глюканлиазой, отличающийся тем, что фермент применяют практически в чистом виде.
В том случае, если глюкан дополнительно содержит связи, отличные от альфа-1,4-связей, альфа-1,4-глюканлиазу предпочтительно используют в сочетании с реагентом, который может расщепить другие связи, таким как гидролаза, преимущественно в сочетании с глюкангидролазой.
Глюканом преимущественно является крахмал или фракция крахмала, полученная химически или ферментативно. Если фракцию крахмала получают ферментативно, то реакцию можно проводить перед добавлением альфа-1,4-глюканлиазы или же реакции можно проводить одновременно. Подходящим реагентом может быть вспомогательный фермент. Предпочтительными вспомогательными ферментами являются альфа- и бета-амилазы. Преимущественно используют ферменты, которые удаляют ответвления от основной цепи. Более предпочтительно в качестве вспомогательного фермента применяют по крайней мере одну из пулланаз или изоамилаз.
Преимущественно альфа-1,4-глюканлиазу либо иммобилизуют на носителе, либо, что более предпочтительно, применяют в растворенной форме.
Фермент преимущественно выделяют либо из грибков, предпочтительно Morchella costata или Morchella vulgaris, либо из инфицированных грибками водорослей, предпочтитель но Gracilariopsis lemaneiformis, либо из самих водорослей, предпочтительно Gracilariopsis lemaneiformis.
Фермент предпочтительно выделяют и/или затем очищают из грибков, или из инфицированных грибками водорослей, или из самих водорослей, используя гель, который не разлагается под действием фермента.
Предпочтительно используют гель на основе декстрина или его производного.
Гель предпочтительно представляет собой циклодекстрин, а более предпочтительно - бета-циклодекстрин.
Фермент предпочтительно включает последовательность аминокислотных остатков с номером идентификации 1, или последовательность аминокислотных остатков с номером идентификации 2, или последовательность аминокислотных остатков с номером идентификации 5, или последовательность аминокислотных остатков с номером идентификации 6, или любую их разновидность.
В альтернативном предпочтительном варианте осуществления настоящего изобретения фермент включает любую последовательность аминокислотных остатков с номерами идентификации 9-11, или любую их разновидность.
Термин "любая их разновидность" означает любую функционализацию, вариацию, модификацию, замещение, удаление или добавление аминокислоты, входящей в последовательность, при условии, что фермент обладает активностью лиазы.
Фермент предпочтительно применяют в сочетании с амилопектином или декстрином.
Фермент преимущественно получают путем экспрессии нуклеотидной последовательности, кодирующей фермент.
Нуклеотидная последовательность преимущественно является ДНК последовательностью.
ДНК последовательность предпочтительно включает последовательность, которая совпадает, или комплементарна, или в значительной степени гомологична, или содержит любые подходящие замещения в кодоне любой из следующих последовательностей: последовательность с номером идентификации 3 или последовательность с номером идентификации 4, последовательность с номером идентификации 7, последовательность с номером идентификации 8.
В альтернативном варианте осуществления настоящего изобретения ДНК последовательность предпочтительно включает любую последовательность, которая совпадает, или комплементарна, или в значительной степени гомологична, или содержит любые подходящие замещения в кодоне любой их следующих последовательностей с номерами идентификации 12-14.
Выражение "в значительной степени гомологична" подразумевает гомологию по отношению к структуре, и/или нуклеотидным компонентам, и/или биологической активности.
Выражение "содержит любые подходящие замещения в кодоне" подразумевает любое замещение или введение заместителя в кодоне, кодирующем ту же аминокислоту, или ее добавление или удаление, при условии, что полученный фермент обладает активностью лиазы.
Другими словами настоящее изобретение охватывает модифицированные ДНК последовательности, в которых по крайней мере один нуклеотид был удален, замещен или модифицирован, или в который введен по крайней мере один дополнительный нуклеотид с тем, чтобы кодировать полипептид, обладающий активностью глюканлиазы, преимущественно полипептид, обладающий повышенной активностью лиазы.
Крахмал предпочтительно применяют в больших концентрациях - приблизительно до 25% в растворе.
Субстрат преимущественно подвергают воздействию фермента в присутствии буферного раствора.
Еще более предпочтительно субстрат подвергают воздействию фермента в присутствии практически чистой воды.
Субстрат преимущественно подвергают воздействию фермента в присутствии кофактора.
В соответствии с настоящим изобретением заявляется также способ получения сахара 1,5-D-ангидрофруктозы, включающий обработку альфа-1,4-глюкана ферментом альфа-1,4-глюканлиазой, отличающийся тем, что фермент содержит последовательность аминокислотных остатков с номером идентификации 1, или последовательность аминокислотных остатков с номером идентификации 2, или последовательность аминокислотных остатков с номером идентификации 5, или последовательность аминокислотных остатков с номером идентификации 6, или любую последовательность аминокислотных остатков с номерами идентификации 9-11, или любые их разновидности.
В соответствии с настоящим изобретением заявляется также сахар 1,5-D-ангидрофруктоза, полученный по способу, который заявляется в настоящем изобретении.
Структура 1,5-D-ангидрофруктозы, полученной по способу настоящего изобретения, была подтверждена и охарактеризована с помощью 13C ЯМР спектроскопии.
Одно из ключевых преимуществ способа по настоящему изобретению заключается в том, что сахар 1,5-D-ангидрофруктоза может быть получен в значительно больших количествах, чем ранее, при этом данный способ проще и дешевле, чем известные способы. Например, сахар можно получить в количествах, превышающих 100 г, в частности 500 г, по сравнению с известными из области техники способами, в которых были и могли быть получены значительно меньшие количества сахара, в частности микрограммовые количества.
Типичными реакциями, катализируемыми альфа-1,4-глюканлиазой, являются:
1) Амилопектин ---> 1,5-D-ангидрофруктоза + незначительное количество декстрина
2) Амилоза ---> 1,5-D-ангидрофруктоза + незначительное количество декстрина.
3) Декстрин ---> 1,5-D-ангидрофруктоза + глюкоза
В реакции 1) соотношение двух продуктов зависит от структуры амилопектина или распределения альфа-1,6-глюкозидных связей в молекуле амилопектина.
В реакциях 2) и 3) соотношение продуктов зависит от степени полимеризации субстрата. В реакции 3) отношение между 1,5-D-ангидрофруктозой и глюкозой зависит от степени полимеризации. Например, если декстрин содержит 10 единиц глюкозы, то соотношение 1,5-D-ангидрофруктоза:глюкоза составит 9:1.
Другим преимуществом настоящего изобретения является то, что в значительной степени могут быть расщеплены глюканы, содержащие связи, отличные от альфа-1,4-связей, в то время, как ранее достигалось лишь частичное их расщепление. Значительное расщепление предшественника 1,5-D-ангидрофруктозы является одним из факторов, который приводит к повышению выхода 1,5-D-ангидрофруктозы.
Другое преимущество заключается в том, что 1,5-D-ангидрофруктоза представляет собой природное вещество, а потому она пригодна для употребления в пищу человеком. Например, ее можно превратить в антибиотик микротецин, действуя на 1,5-D-ангидрофруктозу дегидразой. Известно использование антибиотиков для биоконсервации пищевых продуктов, которая является важной сферой технологии приготовления пищи. Однако в настоящее время при получении 1,5- D-ангидрофруктозы и микротецина встречаются с рядом трудностей. Например, могут быть получены лишь небольшие их количества. Процесс является также дорогим.
Настоящее изобретение преодолевает эти проблемы путем продуцирования большого количества дешевой 1,5-D-ангидрофруктозы, а также других продуктов, таких как микротецин. Могут быть получены количества 1,5-D-ангидрофруктозы от одного грамма до одного килограмма.
Еще одно преимущество заключается в том, что лиаза устойчива при температуре 4oC в течение года и ее можно лиофилизировать без потери активности.
Другим преимуществом является то, что лиаза продуцирует 1,5-D-ангидрофруктозу непосредственно из крахмала и не требует присутствия какого-либо кофактора.
Еще одно преимущество заключается в том, что фермент можно использовать в чистой воде. Этот результат является весьма удивительным.
На основе простых свойств лиазы по настоящему изобретению можно было бы ожидать, что стоимость получения 1,5- D-ангидрофруктозы будет сравнима со стоимостью получения глюкозы. Особое преимущество настоящего изобретения заключается в том, что лиаза по настоящему изобретению не требует присутствия каких-либо кофакторов, которые обычно очень дороги.
В общем случае субстратами для фермента могут быть альфа-1,4-глюканы.
В качестве субстрата предпочтительно использовать крахмал.
В предпочтительном способе осуществления настоящего изобретения используют растительный или желатинизированный крахмал или гидролизат крахмала. Гидролизат крахмала может быть получен как химически, так и ферментативно.
Если фермент используют для частичного расщепления крахмала, то фермент может добавляться либо до введения лиазы, либо можно применить другой дополнительный расщепляющий крахмал реагент (такой, как фермент глюканогидролаза), который может добавляться одновременно.
Лиаза превращает глюкан в 1,5-D-ангидрофруктозу. Фермент присоединяется к субстрату с невосстанавливающего конца и оставляет без изменения лишь восстанавливающий сахар. Остаточную глюкозу можно удалить известными способами, некоторые из которых приводятся в настоящем описании.
Используя приведенную здесь реакцию, можно получить 1,5-D-ангидрофруктозу в больших количествах.
В одном из способов осуществления настоящего изобретения альфа-1,4-глюканлиазу выделяют из инфицированных грибком водорослей, таких как Gracilariopsis lemaneiformis, и очищают методом аффинной хроматографии на колонке с бета-циклодекстрин-сефарозой, ионообменной хроматографией на колонке с Mono Q HR5/5 и гель- фильтрацией на колонке с Superose 12. Очищенный фермент продуцирует 1,5-D-ангидрофруктозу из альфа-1,4-глюканов.
Для грибковой лиазы, выделенной из инфицированной грибком Gracilariopsis lemaneiformis, оптимальный интервал pH при использовании амилопектина составляет 3,5-7,5, оптимальная температура составляет 50oC, а величина pI составляет 3,9.
В еще одном варианте осуществления настоящего изобретения альфа-1,4-глюканлиазу выделяют из грибков Morchella costata методом аффинной хроматографии на колонке с бета-циклодекстрин-сефарозой, ионообменной хроматографией на колонке с Mono Q HR 5/5 и гель-фильтрацией на колонке с Superose 12. Очищенный фермент продуцирует 1,5-D-ангидрофруктозу из альфа-1,4- глюканов.
Значение pI для выделенной из грибков лиазы по данным изоэлектрического фокусирования на гелях с градиентом pH от 3 до 9 составляет приблизительно 5,4. Молекулярный вес, определяемый методом электрофореза в полиакриламидном геле с додецилсульфатом натрия (SDS - PAGE) в градиенте 8-25% геля, составляет 110 кДа. Оптимальная величина pH для фермента составляет 5-7. Оптимальная температура равна 30-45oC.
В другом варианте осуществления настоящего изобретения альфа-1,4-глюканлиазу выделяют из грибков Morchella vulgaris и очищают методом аффинной хроматографии на колонке с бета-циклодекстрин-сефарозой, ионообменной хроматографией на колонке с Mono Q HR 5/5 и гель-фильтрацией на колонке с Superose 12. Очищенный фермент продуцирует 1,5-D-ангидрофруктозу из альфа-1,4-глюканов. Еще в одном из способов осуществления настоящего изобретения альфа-1,4-глюканлиазу выделяют из водорослей, таких как Gracilariopsis lemaneiformis, и очищают методом аффинной хроматографии на колонке с бета-циклодекстрин-сефарозой, ионообменной хроматографией на колонке с Mono Q HR 5/5 и гель-фильтрацией на колонке с Superose 12. Очищенный фермент продуцирует 1,5-D-ангидрофруктозу из альфа-1,4-глюканов.
Типичные оптимальные значения pH и температуры для катализируемых лиазой реакций для ряда ферментов альфа-1,4-глюканлиаз по настоящему изобретению приведены далее (см. табл. 1).
Ферменты по настоящему изобретению превращают амилозу и амилопектин в 1,5-D-ангидрофруктозу.
Проводя испытания с мальтозасахаридами, мы обнаружили, что лиаза обладает низкой активностью по отношению к мальтозе и еще меньшей активностью по отношению к мальтотриозе и мальтогептозе, а наибольшую активность проявляет по отношению к мальтотетрозе и мальтопентозе. Для указанных мальтозасахаридов фермент не ингибирует субстрат вплоть до концентрации 10 мг/мл.
Определяют первичную структуру фермента из одного из предпочтительных источников, а последовательность аминокислотных остатков будет представлена позднее. Также позднее будет представлена ДНК последовательность, кодирующая ферменты.
Таким образом, в настоящем изобретении описывается новый расщепляющий крахмал фермент, а именно новая альфа-1,4-глюканлиаза. Она представляет собой фермент, который был очищен и охарактеризован впервые.
Как указано ранее, настоящее изобретение также относится к специфическим способам использования 1,5-D-ангидрофруктозы.
В частности, настоящее изобретение относится к использованию 1,5-D-ангидрофруктозы в качестве антиоксиданта, в частности антиоксиданта для пищевых продуктов и напитков.
Таким образом, в соответствии с настоящим изобретением заявляется использование 1,5-D-ангидрофруктозы в качестве антиоксиданта.
Преимущественно 1,5-D-ангидрофруктозу применяют вместе с употребляемыми в пищу веществами.
Преимущественно 1,5-D-ангидрофруктозу употребляют в пищевых продуктах и напитках.
Предпочтительно 1,5-D-ангидрофруктозу применяют в сочетании с другим антиоксидантом.
Предпочтительно 1,5-D-ангидрофруктозу получают в соответствии со способом по настоящему изобретению.
Основное преимущество при использовании 1,5-D-ангидрофруктозы заключается в том, что она является природным продуктом, не участвует в обмене веществ, легко получается, растворима в воде и в целом не является токсичной.
Таким образом, предпочтительный вариант осуществления настоящего изобретения относится к ферментативному получению 1,5-D-ангидрофруктозы, которая может применяться в качестве полезного растворимого в воде антиоксиданта для использования в пище и для других целей. Примеры приведены для использования 1,5-D-ангидрофруктозы в качестве антиоксиданта в пищевых композициях.
Из приведенных примеров следует, что 1,5-D-ангидрофруктоза сравнима по своим свойствам с имеющимися на рынке высококачественными антиоксидантами для пищевых продуктов.
Из не связанных с пищевыми продуктами применений можно назвать использование в полимерах в качестве поглотителя кислорода в процессе синтеза полимеров. Кроме того, 1,5-D-ангидрофруктозу можно использовать при синтезе биоразлагаемых пластических масс.
Эксперименты показывают, что 1,5-D-ангидрофруктоза может быть эффективным восстановителем (антиоксидантом), поскольку она может легко восстанавливать 3,5-динитросалициловую кислоту в 3-амино-5-нитросалициловую кислоту.
1,5-D-Ангидрофруктоза представляет собой вещество природного происхождения, а потому она обладает большим потенциалом при использовании в качестве приемлемого антиоксиданта. 1,5-D-Ангидрофруктозу можно также превратить в антибиотик микротецин действием на 1,5-D-ангидрофруктозу дегидразы. Известно использование антибиотиков для биоконсервации пищевых продуктов, которая является важной сферой биотехнологии пищи.
Другой аспект настоящего изобретения относится к использованию 1,5-D-ангидрофруктозы в качестве подслащивателя, в частности в качестве подслащивателя для пищевых продуктов и напитков, преимущественно пищевых продуктов и напитков, употребляемых человеком.
Таким образом, в соответствии с настоящим изобретением заявляется использование 1,5-D-ангидрофруктозы в качестве подслащивателя.
1,5-D-Ангидрофруктозу предпочтительно используют в качестве подслащивателя в пищевых продуктах и напитках, употребляемых человеком.
1,5-D-Ангидрофруктоза может использоваться в любом требуемом количестве, таком как 5%-ный раствор, или от 100 мг/кг до 500 мг/кг.
Преимущество использования 1,5-D-ангидрофруктозы в качестве подслащивателя заключается в том, что она является природным продуктом, в целом не токсична, растворяется в воде, не участвует в обмене веществ и легко получается.
Таким образом, в настоящем изобретении заявляется также новое использование 1,5-D-ангидрофруктозы в качестве подслащивателя.
Предпочтительно 1,5-D-ангидрофруктозу получают в соответствии со способом по настоящему изобретению.
Другие аспекты настоящего изобретения включают:
- способ получения фермента альфа-1,4-глюканлиазы, включающий выделение фермента из водорослей, инфицированных грибками, из грибков и из самих водорослей;
- фермент, содержащий последовательность аминокислотных остатков с номером идентификации 1, или последовательность аминокислотных остатков с номером идентификации 2, или последовательность аминокислотных остатков с номером идентификации 5, или последовательность аминокислотных остатков с номером идентификации 6, или любую их разновидность;
- фермент, содержащий последовательность аминокислотных остатков с номером идентификации 9, или последовательность аминокислотных остатков с номером идентификации 10, или последовательность аминокислотных остатков с номером идентификации 11, или любая их разновидность;
- последовательность нуклеотидов, кодирующую фермент альфа-1,4-глюканлиазу, в которой последовательность преимущественно не находится в своем природном окружении (т.е. она не является частью природного генома клеточного организма, способного экспрессировать фермент) и в которой нуклеотидная последовательность преимущественно является ДНК последовательностью;
- последовательность нуклеотидов, в которой ДНК последовательность содержит по крайней мере одну последовательность, которая совпадает, или комплементарна, или в значительной степени гомологична, или содержит любые подходящие замещения в кодоне любой из следующих последовательностей: последовательности с номером идентификации 3, или последовательности с номером идентификации 4, последовательности с номером идентификации 7, последовательности с номером идентификации 8, где последовательность преимущественно находится в изолированной форме;
- последовательность нуклеотидов, в которой ДНК последовательность содержит по крайней мере одну последовательность, которая совпадает, или комплементарна, или в значительной степени гомологична, или содержит любые подходящие замещения в кодоне любой из следующих последовательностей: последовательности с номером идентификации 12, или последовательности с номером идентификации 13, последовательности с номером идентификации 14, где последовательность преимущественно находится в изолированной форме; и
- использование бета-циклодекстрина для очистки фермента, предпочтительно альфа-1,4-глюканлиазы.
Другие предпочтительные варианты осуществления настоящего изобретения включают любые из следующих: трансформированный организм-хозяин, способный продуцировать 1,5-D-ангидрофруктозу в результате введения приведенной в настоящем описании ДНК последовательности; такой трансформированный организм-хозяин, который является микроорганизмом - преимущественно организм-хозяин выбирают из группы, включающей бактерии, плесени, грибки и дрожжи, организм-хозяин преимущественно выбирают из группы, включающей Saccharomyces, Kluyveromyces, Aspergillus, Trichoderma, Hansenula, Pichia, Bacillus, Streptomyces, Eschericia, таких как Aspergillus oryzae, Saccharomyces cerevisiae, Bacillus subtilis, Bacillus amyloliquefascien, Eschericia coli; способ получения 1,5- -ангидрофруктозы, включающий использование трансформированного организма-хозяина, экспрессирующего нуклеотидную последовательность, кодирующую фермент альфа-1,4-глюканлиазу, где нуклеотидная последовательность является ДНК последовательностью, где ДНК последовательность является одной из приведенных последовательностей; вектор, включающий приведенную в данном описании последовательность нуклеотидов, где вектор преимущественно является вектором репликации, преимущественно вектором экспрессии, содержащим нуклеотидную последовательность в прямом направлении от последовательности промотора, где вектор включает маркер (такой как маркер резистентности); клеточный организм или клеточная линия, трансформированная таким вектором; способ получения продукта альфа-1,4-глюканлиазы или любой последовательности нуклеотидов или ее части, кодирующей альфа-1,4-глюканлиазу, который включает выращивание указанного организма (или клеточной линии), трансформированного указанным вектором, и выделение продукта.
В частности, в системе экспрессии фермент должен преимущественно секретироваться так, чтобы облегчить его очистку. С этой целью ДНК, кодирующую готовый фермент, сливают с сигнальной последовательностью, промотором и терминатором из выбранного хозяина.
Для экспрессии в Aspergillus niger промотор gpd A (из гена глицеральдегид-3-фосфатдегидрогеназы из Aspergillus nidulans) и сигнальную последовательность сливают с 5'-концом ДНК, кодирующей готовую лиазу. Последовательность терминации trpC из A.niger помещают 3'-концом к гену (P.J. Punt et al. , J. Biotech., Vol. 17, pp.19-34 [1991]). Полученную генетическую конструкцию помещают в вектор, содержащий сайт инициации репликации для E.coli и маркер селекции для A.niger. Примерами маркеров селекции для A.niger является ген amdS, ген arg B, ген pyr G, ген hyg B, ген BmlP, которые все используются для селекции трансформантов. Эту плазмиду можно трансформировать в A.niger и готовую лиазу можно выделить из среды с культурой, содержащей трансформанты. В конечном счете конструкцию можно трансформировать в лишенную протеазы цепочку, чтобы уменьшить протеолитическое расщепление лиазы в среде с культурой (D.B. Archer et al., Biotechnol. Lett. 1992, Vol. 14, pp. 357-362).
Вместо Aspergillus niger в качестве организма-хозяина могут использоваться другие играющие важную роль в промышленности микроорганизмы, для которых известны хорошие системы экспрессии, такие как Aspergillus oryzae, Aspergillus sp., Thicgoderma sp., Saccharomyces cerevisiae, Kluyveromyces sp., Hansenula sp. , Pichia sp., Bacillus subtilis, Bacillus Amyloliquefasciens, Bacillus sp., Streptomyces sp., или E. coli.
Следующие образцы 10 июня 1994 г. депонированы в соответствии с Будапештским соглашением в признанный депозитарий The National Collections of Industrial and Marine Bacteria Limited (NCIMB) по адресу 23 St. Machar Drive, Aberdeen, Scotland, United Kingdom, AB2 1RY:
E. coli, содержащая плазмиду pGL1 (NCIMB 40652) - [номер для ссылок DH5alpha-pGL1] и
E. coli, содержащая плазмиду pGL2 (NCIMB 40653) - [номер для ссылок DH5alpha-pGL2].
Следующий образец 11 октября 1984 г. был принят на депонирование в соответствии с Будапештским соглашением в признанный депозитарий The Culture Collection of Algae and
Prozoa (CCAP) по адресу Dunstaffnage Marine Laboratory PO Box 3, Argyll, Sotland, United Kingoton, PA34 4AD:
Gracilariopsis lemaneiformis, инфицированный грибком (CCAP 1373/1) - [номер для ссылок (GLC-1 (Хиндао)].
Наиболее предпочтительные варианты осуществления настоящего изобретения включают фермент альфа-1,4-глюканлиазу, которая может быть получена экспрессией кодирующей альфа-1,4-глюканлиазу последовательности, присутствующей в плазмиде, депонированной под номером NCIMB 40652 или NCIMB 40653; или фермент альфа-1,4-глюканлиазу, которая может быть получена из инфицированных грибками водорослей, депонированных под номером CCAP 1373/1.
Следующие образцы 3 октября 1994 г. депонированы в соответствии с Будапештским соглашением в признанный депозитарий The National Collections of Industrial and Marine Bacteria Limited (NCIMB) по адресу 23 St. Machar Drive, Aberdeen, Scotland, United Kingdom, AB2 1RY:
E. coli, содержащая плазмиду pMC (NCIMB 40687) - [номер для ссылок DH5alpha-pMC];
E. coli, содержащая плазмиду pMV1 (NCIMB 40688) - [номер для ссылок DH5alpha-pMV1]; и
E. coli, содержащая плазмиду pMV2 (NCIMB 40689) - [номер для ссылок DH5alpha-pMV2].
Плазмида pMC представляет собой pBluescript 11 KS, содержащий фрагмент размером в 4100 оснований, выделенный из геномной библиотеки, полученной из Morchella costata. Фрагмент содержит ген, кодирующий альфа-1,4-глюканлиазу.
Плазмида pMV1 представляет собой pBluescript 11 KS, содержащий фрагмент размером в 2450 оснований, выделенный из геномной библиотеки, полученной из Morchella vulgaris. Фрагмент содержит 5'-конец гена, кодирующего альфа-1,4-глюканлиазу.
Плазмида pMV2 представляет собой pPU C19, содержащий фрагмент размером в 3100 оснований, выделенный из геномной библиотеки, полученной из Morchella vulgaris. Фрагмент содержит 3'-конец гена, кодирующего альфа-1,4-глюканлиазу.
Как указано ранее, кодирующая альфа-1,4-глюканлиазу последовательность из Morchella vulgaris содержится в двух плазмидах. На фиг. 15 показано, что pMV 1 содержит нуклеотиды от позиции 454 до позиции 2902; а pMV 2 содержит нуклеотиды в прямом направлении от (в том числе) позиции 2897. Как показано на фиг. 12 и 13, для присоединения кодирующей последовательности можно подвергнуть pMV 2 расщеплению действием ферментов рестрикции EcoRI и BamHI, а затем вставить нужный фрагмент в плазмиду pMV 1, подвергнутую ферментации действием ферментов рестрикции EcoRI. и BamHI.
Таким образом, наиболее предпочтительные варианты осуществления настоящего изобретения включают фермент альфа-1,4-глюканлиазу, полученную экспрессией кодирующих альфа-1,4-глюканлиазу последовательностей, входящих в состав плазмид, депонированных под номером NCIMB 40687, или под номером NCIMB 40688, или под номером NCIMB 40689.
Следующий образец 11 октября 1984 г. был принят на депонирование в соответствии с Будапештским соглашением в признанный депозитарий The Culture Collection of Algae and Protozoa (CCAP) по адресу Dunstuffnage Marine Laboratory PO Box 3, Oban, Argyll, Scotland, United Kingdom, PA34 4AD:
Gracilariopsis lemaneiformis, инфицированный грибком (CCAP 1373/2) - [номер для ссылок GLC-1 (Калифорния)].
Таким образом, наиболее предпочтительный вариант осуществления настоящего изобретения включает фермент альфа-1,4-глюканлиазу, которая может быть получена из инфицированных грибками водорослей, депонированных под номером CCAP 1373/2.
Изобретение далее поясняется на примере возможных вариантов его осуществления.
В приведенных примерах даются ссылки на прилагаемые чертежи, на которых:
Фиг. 1 показывает окрашенные водоросли, инфицированные грибком.
Фиг. 2 показывает окрашенные водоросли, инфицированные грибком.
На фиг. 3 приведен разрез грибковой гифы.
На фиг. 4 приведен разрез водорослей, инфицированных грибком.
На фиг. 5 приведен разрез водорослей, инфицированных грибком.
На фиг. 6 приведена карта плазмиды pGL1.
На фиг. 7 приведена карта плазмиды pGL2.
На фиг. 8 приведена последовательность аминокислотных остатков с номером идентификации 3 и показано расположение пептидных фрагментов, первичная структура которых определялась.
Фиг. 9 показывает соотнесение последовательности с номером идентификации 1 и последовательности с номером идентификации 2.
Фиг. 10 представляет собой микрофотографию.
На фиг. 11 приведена карта плазмиды pMC.
На фиг. 12 приведена карта плазмиды рМV1.
На фиг. 13 приведена карта плазмиды рМV2.
На фиг. 14 изображена последовательность, кодирующая альфа-1,4-глюканлиазу, и часть 5'- и 3'-концевых нетранслируемых участков для геномной ДНК, полученной из Morchella costata.
На фиг. 15 изображена последовательность, кодирующая альфа-1,4-глюканлиазу, и часть 5'- и 3'-концевых нетранслируемых участков для геномной ДНК, полученной из Morchella vulgaris.
На фиг. 16 проводится сравнение последовательностей, кодирующих альфа-1,4-глюканлиазу, и нетранслируемых участков из Morchella costata и Morchella vulgaris.
На фиг. 17 представлена последовательность аминокислотных остатков с номером идентификации 5 и показано расположение пептидных фрагментов, первичная структура которых определялась.
На фиг. 18 представлена последовательность аминокислотных остатков с номером идентификации 6 и показано расположение пептидных фрагментов, первичная структура которых определялась.
На фиг. 19 приведены графики поглощения кислорода в присутствии и в отсутствии 1,5-D-ангидрофруктозы.
На фиг. 20 представлена пластинка для тонкослойной хроматографии.
Если более конкретно, то фиг.1 показывает окрашивание с помощью Calcoflour White, выявляющее грибки в верхней части и в нижней части Gracilariopsis lemaneiformis (108х и 294х).
Фиг. 2 показывает окрашивание Gracilariopsis lemaneiformis вместе с грибком с помощью PAS/Anilinblue Black. Грибки содержат значительно большее количество углеводов.
Фиг. 3 представляет собой микрофотографию, на которой показаны продольные и поверхностный срезы двух тонкостенных гиф грибков (f), растущих между толстыми стенками (w) клеток водорослей. Отмечены тилакоидные мембраны в хлоропласте водорослей (стрелки).
Фиг. 4 показывает, что обнаруженные с помощью пробы клона 2 (верхняя стрелка) десенсибилизированные участки ограничены грибками, которые для наглядности окрашены с помощью Calcoflor White на нижнем срезе (нижняя стрелка) (46х и 108х).
Фиг. 5 показывает, что обнаруженные с помощью пробы клона 2 интенсивные десенсибилизированные участки наблюдаются над грибками в Gracilariopsis lemaneiformis (294х).
На фиг.6 приведена карта плазмиды pGL1, которая представляет собой pBluescript 11 KS, содержащую фрагмент размером в 3800 оснований, выделенный из геномной библиотеки, которую получают из Gracilariopsis lemaneiformis, инфицированной грибками. Фрагмент содержит ген, кодирующий альфа-1,4-глюканлиазу.
На фиг. 7 приведена карта плазмиды pGL2, которая представляет собой pBluescript 11 КS, содержащую фрагмент размером в 3600 оснований, выделенный из геномной библиотеки, которую получают из Gracilariopsis lemaneiformis, инфицированной грибками. Фрагмент содержит ген, кодирующий альфа-1,4-глюканлиазу.
На фиг. 9 приведено соотнесение последовательности аминокислотных остатков с номером идентификации 1 (GL1) и последовательности аминокислотных остатков с номером идентификации 2 (GL2). Общее количество аминокислотных остатков для GL1 составляет 1088, а общее количество аминокислотных остатков для GL2 составляет 1091. При проведении сравнения используют структурно-генетическую матрицу (значение открытого разрыва: 10; значение единичного разрыва: 2). На фиг. 9 указанием на идентичность двух сравниваемых остатков является значок ":", а значок "." указывает на то, что сравниваемые последовательности похожи. "Похожими" считаются аминокислоты A, S, T; D, E; N, Q; R, K; I, L, М, V; F, Y, W. Всего отмечена идентичность по 845 аминокислотам (т. е. 77,67%); и схожесть по 60 аминокислотам (5,51%). Количество разрывов, вставленных в 1, составляет 3, а количество разрывов, вставленных в GL2, составляет 2.
На фиг. 10 приведена фотография гифы грибка (f), растущей между стенками водорослей (w). Отмечены окрашенные зерна крахмала (s) и тилакоиды (стрелки) в клетках водорослей.
На фиг. 14 общее количество оснований составляет 4726; Состав ДНК последовательности: 1336 A; 1070 C; 1051 G; 1269 T. Стартовый кодон ATG показан жирным шрифтом. Интроны подчеркнуты. Кодон остановки указан курсивом.
На фиг. 15 общее количество оснований составляет 4670; состав ДНК последовательности: 1253 A; 1072 C; 1080 G; 1265 T. Стартовый кодон ATG показан жирным шрифтом. Интроны подчеркнуты. Кодон остановки указан курсивом.
На фиг. 16 двумя сравниваемыми последовательностями являются последовательности, полученные из Morchella costata (общее количество остатков: 1066) и из Morchella vulgaris (общее количество остатков: 1070). При проведении сравнения используют структурно-генетическую матрицу (значение открытого разрыва: 10; значение единичного разрыва: 2). На этом чертеже указанием на идентичность двух сравниваемых остатков является значок ":", а значок "." указывает на то, что сравниваемые последовательности похожи. "Похожими" считаются аминокислоты A, S, T; D, E; N, Q; R, K; I, L, M, V; F, Y, W. Всего отмечено: идентичность - 920 (86,30%); схожесть - 51 (4,78%). Количество разрывов, вставленных в Morchella costata составляет 1, а количество разрывов, вставленных в Morchella vulgaris, составляет 1.
В приведенных распечатках последовательностей: последовательность с номером идентификации 5 представляет собой последовательность аминокислотных остатков для альфа-1,4-глюканлиазы, полученной из Morchella costata; последовательность с номером идентификации 6 представляет собой последовательность аминокислотных остатков для альфа-1,4-глюканлиазы, полученной из Morchella vulgaris; последовательность с номером идентификации 7 представляет собой нуклеотид, кодирующий последовательность для альфа-1,4-глюканлиазы, полученной из Morchella costata; и последовательность с номером идентификации 8 представляет собой нуклеотид, кодирующий последовательность для альфа-1,4-глюканлиазы, полученной из Morchella vulgaris.
В последовательности с номером идентификации 5 количество остатков составляет 1066. Аминокислотный состав фермента альфа-1,4-глюканлиазы:
46 Ala 13 Cys 25 His 18 Met 73 Thr
50 Arg 37 Gln 54 Ile 43 Phe 23 Trp
45 Asn 55 Glu 70 Leu 56 Pro 71 Tyr
75 Asp 89 Gly 71 Lys 63 Ser 78 Val
В последовательности с номером идентификации 6 количество остатков составляет 1070. Аминокислотный состав фермента альфа-1,4-глюканлиазы:
51 Ala 13 Cys 22 His 17 Met 71 Thr
50 Arg 40 Gln 57 Ile 45 Phe 24 Trp
62 Asn 58 Glu 74 Leu 62 Pro 69 Tyr
74 Asp 87 Gly 61 Lys 55 Ser 78 Val
Экспериментальная часть
1. Растворимые ферментативные культуры:
1.1. Влияние pH на устойчивость лиазы, выделенной из Gracilariopsis lemaneiformis, инфицированной грибками.
Испытывают две буферные системы, а именно уксусная кислота - ацетат натрия и цитрат натрия - лимонная кислота в концентрации 5 мМ при температуре 37oC. Исследованный интервал pH составляет от 3 до 5,2. Лиаза проявляет максимальную активность в интервале pH 3,6-4,2. При pH 3 устойчивость и активность фермента понижаются приблизительно на 90%. При pH 5,2 активность понижается приблизительно на 64%. Однако фермент значительно устойчивее при данной величине pH, чем при pH 3, поскольку выход 1,5-D-ангидрофруктозы при pH 5,2 составляет 75% от выхода 1,5-D-ангидрофруктозы при pH 3,8. Несколько большие выходы 1,5-D-ангидрофруктозы получают в буфере уксусная кислота - ацетат натрия, чем в цитратном буфере. Это не вызывается разницей между двумя буферами (конечная концентрация 125 мкМ в смеси для анализа 1,5-D-ангидрофруктозы) в методе анализа 1,5-D-ангидрофруктозы.
1.2. Влияние температуры на активность и устойчивость лиазы.
Этот эксперимент проводят при оптимальной величине pH. При температуре 25oC продуцирование 1,5-D-ангидрофруктозы линейно в течение 9 дней. Это указывает на то, что в течение 9 дней не наблюдаются потери активности и стабильности лиазы. При повышении температуры стабильность фермента уменьшается.
Период, за который активность фермента уменьшается наполовину, составляет при указанных температурах: 30oC - 5 дней; 37oC - 2,5 дня; 40oC - менее 1 дня; 50oC - менее 1 дня.
1.3. Влияние концентрации субстрата на стабильность лиазы и воспроизводство 1,5-D-ангидрофруктозы.
Было показано, что амилопектин и декстрины оказывают стабилизирующее воздействие на лиазу, в то время как наименьший субстрат мальтоза таким воздействием не обладает. Это проверяют как для растворимых ферментативных систем, так и для иммобилизованных ферментативных систем.
Выход 1,5-D-ангидрофруктозы возрастает с увеличением концентрации амилопектина до величины 25%. В случае декстрина выход 1,5-D-ангидрофруктозы уменьшается, когда концентрация превышает 30% (исследованы концентрации 30, 40 и 50%).
1.4. Активация и дезактивация лиазы.
Было показано, что для активации фермента не требуются ионы металлов и катализируемые ферментом реакции неожиданно могут протекать в чистой воде. Тот факт, что добавление в реакционную смесь этилендиаминтетрауксусной кислоты до концентрации 20 мМ оказывает незначительное воздействие на активность лиазы, ясно показывает, что ионы металлов не являются необходимыми для активности фермента лиазы по настоящему изобретению.
Это означает, что стадия очистки 1,5-D- ангидрофруктозы, т.е. стадия очистки методом ионообменной хроматографии, в процессе которой из реакционной смеси удаляются соли, может быть опущена, если в качестве реакционной среды используют воду. Однако добавление в реакционную смесь хлорида натрия до концентрации 0,85% (0,145 М) может на порядок увеличить выход 1,5-D-ангидрофруктозы.
1.5. Специфичность субстрата.
При охлаждении солюбилизированного крахмала он при слишком больших концентрациях превращается в твердые гели. Поэтому в качестве субстрата для альфа-1,4-глюканлиазы желательно использовать частично расщепленный крахмал.
Испытывают специфичность альфа-1,4-глюканлиазы, выделенной из M. costata, для различных олигосахаридов. Сахаридами являются мальтоза (G2), мальтотриоза (G3), мальтотетроза (G4), мальтопентоза (G5), мальтогексоза ((G6) и мальтопентоза (G7). Олигосахариды растворяют в воде при концентрации 8 мг/мл. При проведении анализа используют 150 мкл субстрата G2/ G3/ G4/ G5/ G6/ G7, 120 мкл 0,1 М MES, pH 6,3, и 30 мкл очищенного фермента. Реакционную смесь выдерживают в термостате при температуре 30oC в течение 60 мин. После этого реакцию прерывают кипячением в течение 3 мин и для осаждения добавляют 900 мкл абсолютного этанола. После центрифугирования с ускорением 20000 x g при температуре 4oC в течение 5 мин жидкость над осадком переносят в новую трубку Эппендорфа и подвергают лиофилизации.
Образцы, подвергнутые сублимационной сушке, растворяют в 1000 мл воды и фильтруют через фильтр фирмы Mielipore с размером пор 0,22 мкм, а затем 25 мкл образца помещают в колонку Dionix для проведения жидкостной хроматографии высокого разрешения.
1. 6. Жидкостная хроматография высокого разрешения.
Аналитические методики
Анализы проводят с помощью аналитической системы Dionex 4500, включающей насос GPM-2 и импульсный детектор проводимости, который используют в режиме импульсного амперометрического детектирования.
Анионообменную хроматографию проводят на колонке Carbo-Pac PA-100 (4 х 250 мм) с насадкой Carbo Pac PA-100 (3 х 250 мм) от фирмы Dionex.
В качестве элюента используют 200 мМ гидроксида натрия (A), 500 мМ ацетата натрия (B) и деионизированную воду с сопротивлением 18 МОм (C). Для насоса используют два режима соответственнно по способу номер 1 и способу номер 2 (см. табл. А в конце описания).
Стандарты.
В качестве стандартов используют глюкозу, мальтозу, мальтотриозу, мальтотетрозу, мальтопентозу, мальтогексозу и мальтогептозу (все от компании Sigma) и 1,5-ангидрофруктозу. Все соединения растворяют в деионизированной воде с сопротивлением 18 МОм, которую предварительно фильтруют через фильтр фирмы Millipore с размером пор 0,22 мкм.
1.7. Результаты.
Анализы показывают, что очищенный фермент, который выделяют из M. costata, действительно способен использовать мальтоолигосахариды в качестве субстрата 1 для получения 1,5-ангидрофруктозы.
Если в качестве субстрата используют мальтозу, то 1,5-ангидрофруктоза практически не образуется, однако при использовании других мальтоолигосахаридов (G3-G7) указанное соединение получают с высоким выходом.
Очевидно, что большие количества 1,5-ангидрофруктозы получают, если используют мальтоолигосахариды с более длинной цепочкой.
Это наблюдение хорошо совпадает с теорией продуцирования лиазой 1,5-ангидрофруктозы из невосстанавливающего конца субстрата, при этом концевая глюкоза остается без изменений.
1.8. Получение 1,5-ангидрофруктозы.
Альфа-1,4-глюканлиаза из M. costata гидролизует крахмал с получением 1,5-ангидрофруктозы в качестве конечного продукта. Конечный продукт определяют методом жидкостной хроматографии высокого разрешения по способу 2. При проведении ферментативного анализа используют 500 мкг амилопектина (раствор в воде 20 мг/мл), 400 мкл 0,1 М раствора MES с pH 6,3 и 100 мкл очищенного фермента. Реакционную смесь выдерживают в термостате при температуре 30oC в течение 30 или 120 мин и реакцию прерывают кипячением. Высокомолекулярные олигосахариды осаждают добавлением 3 объемов абсолютного этанола, образец центрифугируют и подвергают сублимационной сушке, как указано ранее. Образец растворяют в 125 мкл воды и 25 мкл помещают в колонку для проведения жидкостной хроматографии высокого разрешения.
Профиль эволюции при проведении жидкостной хроматографии высокого разрешения ясно показывает, что альфа-1,4-глюканлиаза из М. costata продуцирует 1,5-ангидрофруктозу гидролизом крахмала. Равные объемы 1,5- ангидрофруктозы обнаруживаются через 30 и 120 мин выдерживания в термостате, а это свидетельствует о том, что конечный продукт 1,5-ангидрофруктоза не подавляет активность фермента.
13C ЯМР спектр (в воде) 1,5-D-ангидрофруктозы, полученной указанным способом, показывает, что обнаруживается в основном одна форма, которая дает следующие сигналы: 93,5 (квартет, C-2), 81,5 (CH, C-5), 77,7 (CH, C-3), 72,6 (CH2, C-1), 69,8 (CH, C-4), 62,0 (CH2, C-6). Отнесения сделаны на основе корреляционных спектров H-H C-H и C-H 2D.
1.9. Кооперативное действие лиазы вместе с пуллуланазой и изомилазой.
Из табл. 2 видно, что включение пуллуланазы в реакционную смесь очевидно приводит к увеличению выхода 1,5-D- ангидрофруктозы приблизительно на 15-23%, в зависимости от того, какой субстрат используют - растворимый крахмал или амилопектин.
Реакционная смесь содержит 0,3 мл 2%-ного раствора картофельного амилопектина (от компании Sigma) в воде или 0,3 мл 2%-ного раствора крахмала (от компании Merck), 2 мкл лиазы и 0,36 единиц пуллуланазы (от компании ВМ).
Реакцию проводят при температуре 30oC в течение 1 дня. По окончании реакции берут образцы для проведения газохроматографического анализа и анализа на содержание 1,5-D-ангидрофруктозы.
Применение изоамилазы имеет то преимущество, что оптимальное значение pH для лиазы перекрывает оптимальное значение для изоамилазы из Pseudomonas (pH 3,0-4,5). Проблема однако заключается в том, что изоамилаза продуцирует избыточное количество длинноцепочечной амилозы, которая высаживается из раствора, а потому не может больше служить субстратом для лиазы. Можно ожидать, что сочетание лиазы и изоамилазы будет эффективным, если цепочка амилозы не будет слишком длинной.
2. Системы с иммобилизованным ферментом.
Иммобилизацию лиазы проводят, используя активированную сукцинимидом сефарозу (гель Affigel 15, компании Bio-Rad) и активированный глютаровым альдегидом силикагель (от компании ВМ). Восстановление активности лиазы после иммобилизации на геле Affigel составляет от 40 до 50%. Некоторое количество лиазы все еще сохраняет активность после иммобилизации, однако оно не доступно для субстрата вследствие стерических препятствий, в частности в случае таких макромолекул, как крахмал. Восстановление активности применяемых в промышленности иммобилизованных ферментов составляет приблизительно 50%.
Наиболее интересной особенностью лиазы, иммобилизованной на геле Affigel, является то, что значительно повышается устойчивость при pH 5,5. Когда в колонке поддерживается указанное значение pH, устойчивость сохраняется по крайней мере на 16 дней дольше. Сдвиг стабильности в сторону больших значений pH является очень важным, поскольку оптимальный интервал значений pH для пуллуланазы составляет приблизительно 5,5. Это является непременным условием для эффективного совместного действия лиазы и пуллуланазы в одном реакторе с одним и тем же физико-химическим окружением. Оптимальное значение pH для растворимой лиазы составляет от 3,6 до 4,2, однако в этом интервале pH пуллуланаза обладает низкой активностью или неактивна вовсе.
Величина восстановленной активности лиазы, иммобилизованной на силикагеле, очень высока и составляет приблизительно 80-100%. Однако иммобилизованный на силикагеле фермент неустойчив ни при pH 3,8, ни при pH 5,5. Возможно, часть лиазы адсорбирована на поверхности частиц силикагеля и медленно выделяется из силикагеля после каждой промывки колонки. Именно адсорбированная лиаза может вносить вклад в высокую скорость восстановления активности и ее понижения в колонке.
3. Очистка 1,5-D-ангидрофруктозы.
3.1. Система лиаза-амилопектин/растворимый крахмал.
В указанной системе по окончании реакции реакционная смесь содержит 1,5-D-ангидрофруктозу, ограниченное количество декстрина, лиазу и соли, входящие в буферный раствор. 1,5-D-Ангидрофруктозу отделяют от макромолекул (декстрина и лиазы) осаждением с помощью этанола (конечная концентрация 50%). Не осажденный низкомолекулярный амилопектин отделяют ультрацентрифугированием с помощью мембран Amicon УМЗ (величина отсечки 3000). Этанол упаривают при температуре 40oC на ротационном испарителе. Входящие в состав буфера соли отделяют от 1,5-D-ангидрофруктозы с помощью смешанных ионообменных смол. Очищенную твердую 1,5-D-ангидрофруктозу получают сублимационной сушкой.
3.2. Система лиаза-пуллуланаза/амилопектин/растворимый крахмал.
Конечными продуктами в этой системе являются 1,5-D- ангидрофруктоза и глюкоза. Если требуется получить достаточно чистый образец 1,5-D-ангидрофруктозы, то глюкозу необходимо отделить. Это достигается ферментативными методами. Глюкозу с помощью оксидазы вначале превращают в глюконовую кислоту и пероксид водорода.
Для удаления образующегося пероксида водорода необходима каталаза. Пероксид водорода окисляет 1,5-D-ангидрофруктозу с образованием двух новых соединений, структура которых пока не установлена. Другими примесями в 1,5-D-ангидрофруктозе являются продукты ее оксиления. Было показано, что 1,5-ангидрофруктоза медленно окисляется содержащимся в воздухе кислородом, особенно при высокой температуре, больших концентрациях 1,5-D-ангидрофруктозы и при длительном времени воздействия кислорода.
Глюконовую кислоту удаляют вместе с входящими в состав буфера солями при проведении ионообменной хроматографии.
В указанной системе низкомолекулярные молекулы амилопектина можно вместо ультрацентрифугирования гидролизовать с помощью амилоглюкозидазы.
3.3. Проверка чистоты 1,5-D-ангидрофруктозы.
Чистоту препаратов 1,5-D-ангидрофруктозы подтверждают тонкослойной хроматографией на колонках Dionex и методом ЯМР.
3.4. Исследование антиокислительной активности ангидрофруктозы.
Электрохимическое поглощение кислорода
Методика.
Активность 1,5-D-ангидрофруктозы исследуют в эмульсии метилового эфира линолевой кислоты в соответствии с методикой, приведенной в публикации Jorgensen and Skibsted, Z. Leben sm. Unters. Forsch 196: 423-429 (1993) с небольшими изменениями: К 5,00 мл 1,33 мМ раствора эмульсии метилового эфира линолевой кислоты в 5,0 мМ водного раствора фосфатного буфера с pH 5,8 и 0,2 вес. %. Tween 20 в качестве эмульгатора добавляют 1,5-D-ангидрофруктозу в следующих концентрациях: 0, 15, 146 и 680 мкМ. Окислительную реакцию в системе инициируют добавлением 50 мкл 0,26 М раствора метмиоглобина до конечной концентрации 0,26 мМ. Непосредственно после инициирования реакции образец инжектируют в термостатированную (25,0±0,1oC) закрытую ячейку емкостью 70 мкл, обеспечивая при этом надежную защиту от попадания в систему кислорода. Поглощение кислорода определяют по электроду Кларка, который подсоединен к управляемой компьютером базе данных. Относительную концентрацию (%) кислорода определяют через каждые 30 с.
Результаты.
Кривые, соответствующие поглощению кислорода разными образцами, приведены на фиг. 19. Для образцов, не содержащих 1,5-D-ангидрофруктозу, относительное уменьшение концентрации кислорода наблюдается сразу же после введения образца. Для образцов, содержащих 1,5-D-ангидрофруктозу, наблюдается запаздывание по фазе прежде чем кривая перегибается, и концентрация кислорода уменьшается. После запаздывания по фазе наблюдается незначительное уменьшение скорости поглощения кислорода в сравнении с образцами, в которые не добавлена 1,5-D-ангидрофруктоза. Наблюдается тенденция, в соответствии с которой образцы с наибольшим содержанием 1,5-D-ангидрофруктозы обладают наиболее длительной фазой запаздывания. Кроме того, скорость поглощения кислорода для этих образцов ниже, что следует из меньшего наклона кривых по сравнению с наклоном кривых для образцов-свидетелей (0 мкМ).
Анализ методом электронного спинового резонанса (ЭСР).
Методика.
Гидроксильные радикалы генерируют по реакции Фентона с помощью пероксида водорода (0,17 мМ) и сульфата железа (11) (4,8 мкМ). Генерированные радикалы улавливаются 5,5-диметил1- пирролин-N-оксидом (9,7 мМ). 1,5-D-ангидрофруктозу добавляют в концентрации 1,3 мМ и 6,3 мМ. Водорастворимый экстракт розмарина (Rosmarinus officinalis L. ) анализируют при концентрации 0,25 мг/мл (в граммах-эквивалентах к 1,26 мМ 1,5-D-ангидрофруктозы). Измерения проводят при комнатной температуре (20±1oC) через 120 с и повторяют для этой же реакционной смеси через 300 с при следующих параметрах спектрометра: поле в центре 3475,60 Гс; ширина развертки 55 Гс; ВЧ мощность 20 мВт; частота модуляции 100 кГц; амплитуда модуляции 1,01 Гс; коэффициент усиления приемника 1,00·105; время конверсии 81,92 мс; временная постоянная 163,84 мс и время развертки 83,89 с.
Результаты.
Генерированные гидроксильные радикалы улавливаются 5,5-диметил-1-пирролин-N-оксидом. Спиновый аддукт дает характеристический 1:2:2:1 ЭСР спектр. Высота пика в спектре пропорциональна количеству генерированного спинового аддукта. Добавление 5,5-диметил-1-пирролин-N-оксида и 1,5-D-ангидрофруктозы приводит к конкуренции между спиновой ловушкой и 1,5-D-ангидрофруктозой. Уменьшение высоты пика свидетельствует о хорошей акцепторной способности 1,5-D-ангидрофруктозы. (табл. 3).
При концентрации 1,3 мМ 1,5-D-ангидрофруктозы акцепторная активность по отношению к гидроксильным радикалам не проявляется, при концентрации 6,3 мМ 1,5-D-ангидрофруктозы высота пика снижается, указывая на то, что часть генерированных гидроксильных радикалов поглощается 1,5-D-ангидрофруктозой.
4. Использование 1,5-D-ангидрофруктозы в качестве антиоксиданта
4.1. Использование 1,5-D-ангидрофруктозы в качестве антиоксиданта в 50%-ном майонезе
50%-ный майонез используют для приготовления салатов, сэндвичей и т.п. на предприятиях общественного питания и в розничной торговле. Вследствие низкого содержания масла 50%-ный майонез пригоден для низкокалорийного применения.
Ниже приводится типичный состав майонеза, %:
Соевое масло - 50,0
Эстрагоновый уксус - 4,0
Яичный желток - 3,5
Сахар - 3,0
Соль - 1,0
Сорбат калия - 0,1
Вода - 35,2
MAYODAN 602 - 3,0
Лимонная отдушка 10251 - 0,2
MAYODAN 602 обеспечивает образование тонкой и устойчивой дисперсии масла с требуемой вязкостью и тем самым гарантирует возможность длительного хранения 50%-ного майонеза.
Отдушка 10251 представляет собой натуральную лимонную отдушку, которая придает майонезу вкус свежего лимона.
Обычно майонез готовят следующим образом:
1) Смешивают в сухом виде MAYODAN 602, сахар и соль. Диспергируют в масле в соотношении 1 часть порошка на 2 части масла.
2) Добавляют отдушку и сорбат калия в воду и выливают в миксер фирмы Koruma. Добавляют компонент 1).
3) Добавляют яичный желток.
4) Непрерывно в вакууме добавляют масло.
5) После того, как добавлено (медленно) 2/3 части масла, смешивают эстрагоновый уксус с оставшейся 1/3 частью масла и добавляют к основной массе.
Следующие данные показывают, что при добавлении к майонезу 1,5-D-ангидрофруктозы в качестве антиоксиданта полученные результаты сравнимы с известными пищевыми антиоксидантами GRINDOX 142 и GRINDOX 1029.
GRINDOX 142:
Аскорбиловый эфир пальмитиновой кислоты - 10
Пропиловый эфир галловой кислоты - 20
Лимонная кислота - 10
Пищевой эмульгатор - 60
Вид при 25oC - Паста
Цвет - От серого до светло-коричневого
Плотность, г/мл - 1,1
Везде даны весовые проценты)
GRINDOX 1029:
Аскорбиловый эфир пальмитиновой кислоты - 20
Природные токоферолы - 20
Пищевой эмульгатор - 60
Вид при 25oC - Паста
Цвет - Светло-коричневый
Плотность, г/мл - 1,0
(Везде даны весовые проценты)
При проведении тестовых испытаний антиоксиданты добавляют в майонез таким образом, чтобы концентрация антиоксиданта составляла порядка 500 ч/млн. Затем майонез помещают в калориметрическую бомбу, содержащую кислород, при температуре 80oC. Затем измеряют индукционный период до начала заметного окисления вещества.
Получены следующие результаты:
Образцы - Индукционный период, ч
1. Чистый - 28,0
2. + 500 ч/млн GRINDOX 142 - 35,0
3. + 500 ч/млн GRIDOX 1029 - 33,3
4. + 550 ч/млн GRINDOX 1029 - 34,3
5. + 500 ч/млн 1,5-ангидрофруктозы - 32,0
Приведенные результаты показывают, что 1,5-D-ангидрофруктоза является превосходным пищевым антиоксидантом и сравнима с известными антиоксидантами, применяемыми в пищевых продуктах, такими как GRINDOX 142 или GRINDOX 1029.
4.2. Использование 1,5-D-ангидрофруктозы в качестве антиоксиданта в приправе для салата
Салатная приправа на основе йогурта, содержащая 50% масла.
Салатную приправу на основе йогурта, содержащую 50% масла, применяют в салатах с картофелем, в салатах из сырых овощей, с мясом, рыбой и вареными овощами.
Состав, %
Соевое масло - 50,0
Йогурт (простой) - 39,0
Уксус (10%) - 3,5
Сахар - 3,0
Яичный желток - 2,0
Соль - 1,0
Сорбат калия - 0,1
MAYODAN 525 - 1,4
Кислая маскирующая отдушка 2072 - 0,02
MAYODAN 525 обеспечивает эмульсии исключительную стабильность, препятствует синерезису, способствует равномерному диспергированию масла и обеспечивает необходимую вязкость, улучшает устойчивость в процессе производства и гарантирует высокую сохраняемость.
Отдушка 2072 представляет собой идентичную натуральной отдушке композицию, уменьшающую кислый вкус приправы, не влияя на величину pH.
Рецепт:
1) Смешивают в сухом виде MAYODAN 525, сахар и соль. Диспергируют в масле в соотношении 1 ч. порошка на 2 ч. масла.
2) Добавляют отдушку, сорбат калия и йогурт и выливают в миксер фирмы Koruma. Добавляют компонент 1).
3) Добавляют яичный желток.
4) Непрерывно в вакууме добавляют масло.
5) После того, как добавлено (медленно) 2/3 части масла, смешивают уксус с оста вшейся 1/3 частью масла и добавляют к основной массе.
6) Добавляют, если необходимо, специи.
Результаты испытаний даны в табл. 4
5. Получение альфа-1,4-глюканлиазы
Введение.
В соответствии с еще одним аспектом настоящего изобретения фермент альфа-1,4-глюканлиаза, который используется для получения 1,5-D-ангидрофруктозы, может быть выделен из водорослей, инфицированных грибками, предпочтительно инфицированных грибками Gracilariopsis lemaneiformis, еще более предпочтительно инфицированных грибками Gracilariopsis lemaneiformis из Хиндао (Китай).
Иначе фермент может быть выделен из грибков. Грибками могут быть, например, любые из Discuna perlata, Discina parma, Gyromitra gigas, Gyromitra infula Mitrophora hybrida, Morchella conica, Morchella costata, Morchella elata, Morchella hortensis, Morchella rotunda, Morchella vulgaris, Peziza badia, Sarcosphaera eximina, Disciotis venosa, Gyromitra esculenta, Hervella crispa, Hervella lacunosa, Lehtopodia elastica, Verpa digitaliformis и другие формы Morchella. Предпочтительными грибками являются Morchella costata и Morchella vulgaris.
В соответствии с еще одним аспектом настоящего изобретения фермент альфа-1,4-глюканлиаза, который используется для получения 1,5-D-ангидрофруктозы, может быть выделен из самих водорослей, предпочтительно из Gracilariopsis lemaneiformis, еще более предпочтительно из Gracilariopsis lemaneiformis из Санта-Круса (Калифорния).
Первичную очистку фермента можно провести в соответствии с методикой, приведенной Yu et al. Однако предпочтительно первичная очистка фермента включает оптимизированную процедуру, в соответствии с которой используют твердый носитель, который не разлагается в процессе проведения стадии очистки. Этот гелеобразный носитель имеет то преимущество, что он совместим со стандартным лабораторным оборудованием, применимым для очистки белков. Подробности этой оптимизированной методики очистки приводятся далее. Стадию очистки прерывают с помощью стандартных методов, используемых при очистке белков.
Чистоту фермента легко установить с помощью электрофореза.
А. ИСТОЧНИК - ИНФИЦИРОВАННЫЕ ГРИБКАМИ ВОДОРОСЛИ
При получении праймеров по приведенным ниже полимеразным реакциям синтеза цепи и для проверки последовательности аминокислотных остатков, генерированной соответствующими последовательностями нуклеотидов, используют следующую информацию о первичной структуре.
Последовательность аминокислотных остатков, составленная из пептидов, выделенных из Gracilariopsis lemaneiformis, инфицированных грибками.
Туг Arg Trp Gln Glu Val Leu Tyr Thr Ala Met Туг Gln Asn Ala
Ala Phe Gly Lys Pro Ile Ile Lys Ala Ala Ser Met Tyr Asn Asn
Asp Ser Asn Val Arg Arg Ala Gln Asn Asp His Phe Leu Leu Gly
Gly His Asp Gly Tyr Arg Ile Leu Cys Ala Pro Val Val Trp Glu
Asn Ser Thr Glu Arg Glu Leu Tyr Leu Pro Val Leu Thr Gln Trp
Tyr Lys Phe Gly Pro Asp Phe Asp Thr Lys Pro Leu Glu Gly Ala
Последовательность аминокислотных остатков (27-34), которую используют для получения праймеров A и B (Met Tyr Asn Asn Asp Ser Asn Val)
Праймер A:
ATG TA(TC) AA(CT) AA(CT) GA(CT) TC(GATC) AA(CT) 128 mix
Праймер B:
ATG TA(TC) AA(CT) AA(CT) GA(CT) AG(TC) AA(CT) GT 64 mix
Последовательность аминокислотных остатков (45-50), которую используют для получения праймера C (Gly Gly His Asp Gly Tyr)
Праймер C:
TA (GATC)CC (GA)TX (GA)TG (GATCOCC (GATC)CC 256 mix
(Эта последовательность соответствует комплементарной ветви.)
Последовательность аминокислотных остатков (74-79), которую используют для получения праймера E (Gln Trp Tyr Lys Phe Gly)
Праймер E:
GG(GATC) CC(GA) AA(CT) TT(GA) TAC CA(CT) TG 64 mix
(Эта последовательность соответствует комплементарной ветви.)
Последовательность аминокислотных остатков (1-6), которую используют для получения праймеров F1 и F2 (Tyr Arg Trp Gln Glu Val)
Праймер F1:
TA(TC) CG(GATC) TGG CA(GA) GA(GA) GT 32 mix
Праймер F2:
TA(TC) AG(GA) TGG CA(GA) GA(GA) GT 16 mix
Последовательность, полученная после первой амплификации с использованием полимеразной реакции синтеза цепи (клон 1)
ATGTACAACA ACGACTCGAA CGTTCGCAGG GCGCAGAACG ATCATTTCCT TCTTGGCGGC CACGACGGTT A
Met Tyr Asn Asn Asp Ser Asn Val Arg Arg Ala Gin Asn Asp His Phe Leu Leu Gly Gly His Asp Gly
Последовательность, полученная после второй амплификации с использованием полимеразной реакции синтеза цепи (клон 1).
ATGTACAACA ACGACTCGAA CGTTCGCAGG GCGCAGAACG ATCATTTCCT
TCTTGGTGGA CATGATGGAT ATCGCATTCT GTGCGCGCCT GTTGTGTGGG
AGAATTCGAC CGAACGNGAA TTGTACTTGC CCGTGCTGAC CCAATGGTAC AAATTCGGCC C
Met Tyr Asn Asn Asp Ser Asn Val Arg Arg Ala Gln Asn Asp His Phe Leu Leu Gly
Gly His Asp Gly Tyr Arg Ile Leu Cys Ala Pro Val Val Trp Glu Asn Ser Thr Glu
Arg Glu Leu Туг Leu Pro Val Leu Thr Gln Trp Tyr Lys Phe Gly Pro
Последовательность, полученная после третьей амплификации с использованием полимеразной реакции синтеза цепи (клон 2).
TACAGGTGGC AGGAGGTGTT GTACACTGCT ATGTACCAGA
ATGCGGCTTT CGGGAAACCG ATTATCAAGG CAGCTTCCAT GTACGACAAC
GACAGAAACG TTCGCGGCGC ACAGGATGAC CACTTCCTTC TCGGCGGACA
CGATGGATAT CGTATTTTGT GTGCACCTGT TGTGTGGGAG AATACAACCA
GTCGCGATCT GTACTTGCCT GTGCTGACCA GTGGTACAAA TTCGGCCC
Tyr Arg Trp Gln Glu Val Leu Tyr Thr Ala Met Tyr Gln Asn Ala Ala Phe Gly Lys
Pro Ile Ile Lys Ala Ala Ser Met Tyr Asp Asn Asp Arg Asn Val Arg Gly Ala Gln Asp
Asp His Phe Leu Leu Gly Gly His Asp Gly Tyr Arg Ile Leu Cys Ala Pro Val Val
Trp Glu Asn Thr Thr Ser Arg Asp Leu Tyr Leu Pro Val Leu Thr Lys Trp Tyr Lys Phe Gly
A.1. Цитологические исследования Gracilariopsis lemaneiformis
A. 1.1.1. Обнаружение грибковой инфекции в Gracilariopsis lemaneiformis
Срезы Gracilariopsis lemaneiformis, собранных в Китае, получают вручную или из заключенного в парафин материала. Полученные срезы тщательно изучают с помощью оптического микроскопа. Грибковые гифы легко обнаруживаются в Gracilariopsis lemaneiformis.
Слоевища Gracilariopsis lemaneiformis составлены из клеток, которые кажутся очень упорядоченными и практически симметричными. Трубчатое слоевище G. lemaneiformis составлено из центральных клеток, окруженных вытянутыми тонкими клетками цилиндрической формы, и маленькими круглыми окрашенными в красный цвет периферийными клетками. Все типы клеток водорослей отличаются тем, что они имеют толстые стенки. Большинство грибковых гиф располагаются в промежутках между центральным слоем из больших клеток и периферическим слоем. Эти клетки можно легко отличить от клеток водорослей, поскольку они длинные и имеют цилиндрическую форму. Рост гиф наблюдается в виде нерегулярностей между высоко упорядоченными клетками водорослей. Наиболее часто гифы ориентированы вдоль основной оси слоевища водорослей. В некоторых случаях обнаруживаются боковые ответвления по направлению к центру и периферии. Гифы невозможно спутать с эндо-эпифитным вторым поколением водорослей.
Известно, что Calcofluor white окрашивает ткани, содержащие хитин и целлюлозу. Для реакции с хитином необходимо присутствие четырех ковалентно связанных концевых н-ацетил-глюкозаминовых остатков. В общем случае считается, что целлюлоза встречается главным образом у высших растений, хотя ее следовые количества могут обнаруживаться в некоторых водорослях. Известно также, что хитин практически отсутствует у Gracilaria.
Было обнаружено, что Calcofluor white, окрашивает область, соответствующую стенкам клеток грибковых гиф в срезах Gracilariopsis lemaneiformis.
В ультрафиолете гифы кажутся ярко белыми на голубом фоне тканей Gracilaria (см. фиг.1). Хитин является основным компонентом стенок клеток большинства грибков, однако отсутствует в Gracilaria. Из этих наблюдений мы делаем вывод, что изучаемые водоросли инфицированы грибками. Было показано, что 40% нижней части изученных срезов Gracilariopsis lemaneiformis инфицировано грибковыми гифами. Было обнаружено, что инфицированы 25% кончиков водорослей исследованных Gracilariopsis lemaneiformis.
Окрашивание срезов Gracilariopsis lemaneiformis основанием Шиффа надиодной кислоты и анилинового голубого выявляет значительно большее содержание углеводов в клетках грибков по сравнению с клетками водорослей (см. фиг.2). Сафранин 0 и малахитовый зеленый дают ту же цветную реакцию с клетками грибков, которая наблюдается в высших растениях, инфицированных грибками.
Реакция акридинового оранжевого со срезами Gracilariopsis lemaneiformis очевидно свидетельствует о нерегулярном росте грибков.
A. 1.1.2. Электронная микроскопия
Микроскопические препараты срезов толщиной 15 мкм, в которых обнаружены грибки с помощью Calcofluor white, фиксируют 2%-ным раствором четырехокиси осмия, промывают водой и удаляют воду диметоксипропаном и абсолютным спиртом. Каплю смеси 1:1 ацетона и смолы Spurr помещают на каждый срез на предметном столе, а через один час заменяют на каплю чистой смолы. Помещенные в желатин капсулы, наполненные смолой, помещают лицом вниз на срез и оставляют на ночь при температуре 4oC. После полимеризации при температуре 55oC в течение 8 ч толстые срезы, прикрепленные к блокам смолы, можно Gracilariopsis lemaneiformis отделить от предметного столика, опустив в жидкий азот. Блоки подрезают и с помощью алмазного резца делают из них на микротоме срезы толщиной 100 нм. Срезы окрашивают водным раствором уранилацетата и цитрата свинца. Срезы исследуют в электронном микроскопе с ускоряющим напряжением 80 кВ.
Эти исследования подтверждают данные наблюдений с помощью оптического микроскопа и дают новые подтверждения того, что продуцирующий лиазу китайский штамм G. lemaneiformis инфицирован грибковым паразитом или симбионтом.
Грибковые гифы образованы цилиндрическими клетками длиной от 50 до 100 мкм и всего несколько микрон в диаметре. Клетки расположены последовательно, при этом соседние клетки отделяются друг от друга разделительными перегородками. Иногда наблюдаются ответвления. Гифы растут между толстыми стенками клеток слоевища водорослей, не проникая в стенки и не повреждая клетки. Известно, что подобный симбиоз, который называют микофикобиозом, возникает между некоторыми нитевидными морскими грибками и большими морскими водорослями (Donk and Bruning. "Ecology of aquatic fungi in and on Algae", in: W. Reisser (Td.). "Algae and Symbioses: Plants, Animals, Fungi, Viruses, Interactions Explored", Biopress Ltd, Bristol, 1992).
Изучая микрофотографию, приведенную на фиг. 10, можно заметить несколько различий между клетками водорослей и клетками грибков. В отличие от достигающих нескольких микрон толстых стенок водорослей толщина стенок грибков составляет лишь 100-200 им. В клетках водорослей можно обнаружить обычные органеллы растений, такие как хлоропласты с тиллакоидными мембранами, а также окрашенные гранулы крахмала, однако их нет у грибков.
Внутриклеточные связи красных водорослей характеризуются специфической структурой, получившей название ямкового соединения. Структуры представляют собой выступающие сердцевины с высокой электронной плотностью, и они являются важной особенностью систематики водорослей (C.M.Pueschel, "An expanded survey of the ultrastructure of Red algar pit plugs", J. Phycol., 1989, Vol. 25, p. 625). В полученных нами материалах подобные соединения часто встречаются в слоевище водорослей, однако никогда не наблюдаются между клетками грибков.
A. 1.2. Эксперименты по in situ гибридизации.
Методика in situ гибридизации основана на принципе гибридизации антисенсибилизированных последовательностей рибонуклеотидов в мРНК. Эта методика используется для визуализации областей в микроскопических срезах, в которых присутствует указанная мРНК. В данном конкретном случае эта методика используется для визуализации альфа-1,4-глюканлиазы в Gracilariopsis lemaneiformis.
A. 1.2.1. Получение проб, содержащих метку 35S для in situ гибридизации.
Фрагмент массой 238 пар оснований, полученный при третьей амплификации с использованием полимеразной реакции синтеза цепи (получивший название клона 2, см. выше), клонируют на векторе PGEM-3Zf (+) (от компании Promega). Транскрипцию десенсибилизированной РНК проводят под действием промотора SP6, а сенсибилизированной РНК - с помощью промотора T7. Аналитический набор для защиты рибонуклеазы (от компании Ambion) используют со следующими модификациями. Транскрипты исследуют на 6%-ном геле для определения первичной структуры с целью удаления не включенных нуклеотидов, и элюируют буферной смесью, которая поставляется вместе с T7 РНК-полимеразой в наборе для проведения транскрипций в условиях in vitro (от компании Ambion). Десенсибилизированный транскрипт содержит 23 некодирующих нуклеотида, в то время как сенсибилизированный транскрипт содержит 39 нуклеотидов. Для гибридизации используют пробу с меткой 35S, дающую 107 отсчетов в минуту на миллилитр.
In situ гибридизацию проводят практически в соответствии с методикой, приведенной Langedale et al. (1988). Было показано, что оптимальная температура гибридизации составляет 45oC. После промывки при температуре 45oC срезы покрывают фотографической эмульсией Kodak К-5 и оставляют на 3 дня в темноте при температуре 5oC (см. J.A.Langedale. B.A.Rothermel and J. Nelson (1988), Genes and Development2: 106-115, Cold Spring Harbor Laboratory.
Эксперименты по in situ гибридизации с рибо-пробой по отношению к мРНК альфа-1,4-глюканлиазы указывают на сильную гибридизацию над и вокруг гифы грибков, обнаруженных в Gracilariopsis lemaneiformis (см. фиг. 4 и 5). Мы считаем, что это является ярким подтверждением того, что происходит образование альфа-1,4-глюканлиазы. В тканях Gracilariopsis lemaneiformis наблюдаются случайные фоновые реакции. Эта реакция наблюдается как для сенсибилизированных, так и десенсибилизированных проб. Интенсивное окрашивание над грибковой гифой наблюдается лишь для десенсибилизированных проб.
Эти результаты получают в стандартных условиях гибридизации при температуре 45oC после обычной стадии промывки. При температуре 50oC никакого окрашивания над грибками не наблюдается, в то время как фоновое окрашивание остается на прежнем уровне. Повышение температуры до 55oC в равной степени приводит к значительному уменьшению фонового окрашивания как для сенсибилизированных, так и десенсибилизированных проб.
На основании цитологических исследований с использованием комплементарного окрашивания мы делаем вывод, что Gracilariopsis lemaneiformis инфицированы грибками. Инфекции наиболее заметны в нижней части тканей водорослей.
В срезах препаратов Gracilariopsis lemaneiformis результаты по in situ гибридизации очевидно указывают на то, что гибридизация ограничена областями, где обнаруживается грибковая инфекция (см. фиг. 4). Результаты показывают, что мРНК альфа-1,4-глюканлиазы локализована в областях Gracilariopsis lemaneiformis, которые инфицированы грибками. На основании этих наблюдений мы делаем вывод, что активность альфа-1,4-глюканлиазы обнаруживается в Gracilariopsis lemaneiformis, инфицированных грибками.
A. 2. Очистка фермента и определение его свойств.
Очистка альфа-1,4-глюканлиазы, выделенной из инфицированных грибками Gracilariopsis lemaneiformis, проводят следующим образом.
A.2.1. Материалы и методики.
Водоросли отделяют фильтрацией и промывают 0,9%-ным раствором хлорида натрия. Клетки разрушают гомогенизацией с последующей обработкой ультразвуком при охлаждении льдом в 50 мМ растворе цитрат- NaOH с pH 6,2 (Буфер A) в течение 6 х 3 мин. Остатки клеток удаляют центрифугированием с ускорением 25000 x g в течение 40 мин. Полученную жидкость над осадком можно рассматривать как свободный от клеток экстракт, который после разделения на 8-25% градиентном геле используют для определения активности по методу окрашивания и вестерн-блоттинга.
A. 2.2. Разделение на геле бета-циклодекстрин-сефароза.
Не содержащий клеток экстракт непосредственно помещают в колонку с гелем бета-циклодекстрин-сефарозы 4B (2,6х18 см), предварительно уравновешенную Буфером A. Колонку промывают 3 объемами Буфера A и 2 объемами Буфера A, содержащего 1 М хлорида натрия. Альфа-1,4-глюканлиазу элюируют 2%-ным раствором декстринов в буфере A. Активные фракции объединяют и меняют буферный раствор на 20 мМ раствор бис-трис-пропан- HCl (pH 7,0, Буфер B).
Активные фракции переносят в колонку с Mono Q HR 5/5, предварительно уравновешенную Буфером В. Грибковую лиазу элюируют Буфером В в линейном градиенте 0,3 М хлорида натрия.
По другому способу препараты лиазы, полученные после хроматографии на бета-циклодекстрин-сефарозе, упаривают до объема 150 мкл и наносят на хроматографическую колонку быстрого разрешения с сефарозой 12.
A. 2.3. Анализ на активность альфа-1,4-глюканлиазы и условия для определения специфичности субстрата, оптимального значения pH и температуры
Реакционная смесь, используемая для определения активности альфа-1,4-глюканлиазы, содержит 10 мг/мл амилопектина и 25 мМ буферного раствора MeS - NaOH (pH 6,0). Реакцию проводят в течение 30 мин при температуре 30oC и прерывают добавлением реактива 3,5-динитросалициловой кислоты. Оставляют на 10 мин при комнатной температуре и измеряют оптическую плотность на длине волны 550 нм.
A. 3. Установление последовательности аминокислотных остатков альфа-1,4-глюканлиазы, выделенной из инфицированных грибками Gracilariopsis lemaneiformis.
A. 3.1. Установление последовательности аминокислотных остатков лиаз.
Лиазы ферментатируют либо в эндопротеиназой Arg-C из clostridium hystolyticum, либо с эндопротеиназой Lys-C из Lysobacter enzymogenes, которые имеют необходимую чистоту для проведения процедуры определения первичной структуры и поставляются компанией Boehringer Mannheim (Германия). При проведении ферментации с эндопротеиназой Arg-C обезвоженную методом сублимационной сушки лиазу (0,1 мг) растворяют в 50 мкл 10 М раствора мочевины, 50 мМ метиламина, 0,1 М Tris -HCl, pH 7,6. Продувают азотом и добавляют 10 мкл 50 мМ раствора дитиотреитола и 5 мМ этилендиаминтетрауксусной кислоты, а затем белок денатурируют и восстанавливают в течение 10 мин при температуре 50oC в атмосфере азота. После этого добавляют 1 мкг эндопротеиназы Arg -C в 10 мкл 50 мМ раствора Tris -HCl с рН 8,0, продувают азотом и проводят ферментацию в течение 6 ч при температуре 37oC. С целью функционализации цистеина добавляют 12,5 мкл 100 мМ раствора иодацетамида и полученный раствор помещают на 15 мин в темное место в термостате при комнатной температуре в атмосфере азота.
При проведении ферментации с эндопротеиназой Lys-C обезвоженную методом сублимационной сушки лиазу (0,1 мг) растворяют в 50 мкл 8 М раствора мочевины, 0,4 М бикарбоната аммония, pH 8,4. Продувают азотом и добавляют 5 мкл 45 мМ раствора дитиотреитола, а затем белок денатурируют и восстанавливают в течение 15 мин при температуре 50oC в атмосфере азота. После охлаждения до комнатной температуры добавляют 5 мкл 100 мМ раствора иодацетамида, чтобы получить функциональные производные цистеина, и оставляют на 15 мин в темном месте при комнатной температуре в атмосфере азота. Затем добавляют 90 мкл воды и 5 мкг эндопротеиназы Lys-C в 50 мкл 50 мМ раствора трицина и 10 мМ этилендиаминтетрауксусной кислоты с pH 8,0 и проводят ферментацию в атмосфере азота в течение 24 ч при температуре 37oC. Полученные пептиды разделяют методом жидкостной хроматографии высокого разрешения с обогащенной фазой на колонке VYDAC C18 (0,46 х 15 см; 10 мкм; от компании The Separations Group., Калифорния), используя в качестве элюента растворитель A: 0,1%-ный раствор трифторуксусной кислоты в воде, и растворитель B: 0,1%-ный раствор трифторуксусной кислоты в ацетонитриле. Перед проведением процедуры установления первичной структуры на секвенторе Applied Biosystems 476A в импульсном режиме подачи жидкой фазы с короткими циклами выделенные пептиды повторно хроматографируют на колонке Develosil C18 (0,46 х 10 см; 3 мкм; от Dr. Ole Schou из компании Novo Nordisk, Дания), используя ту же систему растворителей.
Данные о последовательности аминокислотных остатков фермента, полученного из Gracilariopsis lemaneiformis, инфицированных грибками, представлены ниже, в частности, последовательность с номером идентификации 1 и последовательность с номером идентификации 2.
Последовательность с номером идентификации 1:
Количество остатков: 1088
Состав аминокислот (в том числе для сигнальной последовательности:
61 Ala 15 Cys 19 His 34 Met 78 Thr
51 Arg 42 Gln 43 Ile 53 Phe 14 Trp
88 Asn 53 Glu 63 Leu 51 Pro 58 Tyr
79 Asp 100 Gly 37 Lys 62 Ser 77 Val
Последовательность с номером идентификации 2:
Количество остатков: 1091
Состав аминокислот (в том числе для сигнальной последовательности)
58 Ala 16 Cys 14 His 34 Met 66 Thr
57 Arg 40 Gln 44 Ile 56 Phe 23 Trp
84 Asn 47 Glu 69 Leu 51 Pro 61 Tyr
81 Asp 102 Gly 50 Lys 60 Ser 76 Val
A. 3.2. N-Концевой анализ
Исследования показывают, что N-концевая последовательность природной глюканлиазы 1 блокирована. Деблокирование осуществляют обработкой глюканлиазы 1, нанесенной по методу блоттинга на мембрану из поливинилидендифторида, с помощью безводной трифторуксусной кислоты в течение 30 мин при температуре 40oC, как это описано Le Gendre et al., "Purification of proteins and peptides by SDS-PAGE" in P. Matsudaira (ed.) "A practical guide to protein and peptide purification for microseguencing". 2nd ed., Academic Press Inc., San Diego, pp. 74-101 (1993). Полученная последовательность TALSDKQTA, которая соответствует последовательности (позиции от 51 до 59 последовательности с номером идентификации 1), полученной из клона глюканлиазы 1, и указывает на то, что N-терминальным остатком глюканлиазы 1 является N-ацетилтреонин. Позиции с 1 по 50 последовательности с номером идентификации 1 соответствуют сигнальной последовательности.
A. 4. Установление ДНК последовательности гена, кодирующего альфа-1,4-глюканлиазу, полученную из Gracilariopsis lemaneiformis, инфицированных грибками
A. 4.1. Методы молекулярной биологии.
ДНК выделяют, как описано у Saunders (1993), со следующими модификациями: вместо гель-фильтрации полисахариды отделяют от ДНК по методике ELUTIP-d (Schleicher & Schuell). (См. G.W. Saunders, "Gel purification of red aigal genomic DNA: An inexpensive and rapid method for the isolation of PCR-friendly DNA, "Journal of Phycology", Vol. 29(2): 251-254 и Schleicher & Schuell:EELUTIP-d. Rapid Method for Purification and Concentration of DNA").
A. 4.2. Полимеразная реакция синтеза цепи
Получение представляющей интерес молекулы ДНК осуществляют, используя набор для амплификации ДНК Gene Amp DNA Amplification Kit. (от компании "Perkin Elmer Cetus", США) и рекомендации производителя, за исключением того, что Tag-полимеразу добавляют позднее (см. Циклы полимеразной реакции синтеза цепи в табл. Б), а циклы температуры изменяют следующим образом, см. табл. Б.
A. 4.3. Клонирование фрагментов, полученных по полимеразной реакции синтеза цепи
Фрагменты, полученные по полимеразной реакции синтеза цепи, клонируют на pTBlue (от компании Novagen) в соответствии с рекомендациями поставщика.
A. 4.4. Определение ДНК последовательности
Определение ДНК последовательности аминокислотных остатков двухцепочечной ДНК проводят в соответствии с дидеокси-методом Sanger et al. (1979), используя набор для установления первичной структуры Auto Read Sequencing Kit (от компании Pharmacia) и ДНК секвентор Pharmacia LKB A.L.F. (См. F. Sanger, S.Nicklen and A.R. Coulson, "DNA sequencing with chain-determinating inhibitors", Proc. Natl. Acad. Sci. USA 74: 5463-5467 [1979]).
Последовательности представлены под номерами 3 и 4. Если коротко, то:
Последовательность с номером идентификации 3 содержит:
Общее количество оснований: 3267
Состав ДНК последовательности: 850 A; 761 C; 871G; 785 T
Последовательность с номером идентификации 4 содержит:
Общее количество оснований: 3276
Состав ДНК последовательности: 889 A; 702 C; 856 G; 829 T
A. 4.5. Скрининг библиотеки
Скрининг библиотеки Lambada Zap, полученной от компании Stratagene, проводят в соответствии с рекомендациями поставщика, за исключением того, что предгибридизацию и гибридизацию проводят на 2хSSC, 0,1% SDS, 10x Denhardt's или 100 мкг/мл денатурированной ДНК спермы лосося. К раствору для проведения гибридизации добавляют денатурированную пробу, содержащую метку 32P. Гибридизацию проводят в течение ночи при температуре 55oC. Фильтры дважды промывают с помощью 2х SSC, 0,1% SDS и дважды с помощью 1x SSC, 0,1% SDS.
A.4.6. Проба
Клонированные фрагменты, полученные по полимеразной реакции синтеза цепи, отделяют от вектора pT7blue путем ферментации с подходящими ферментами рестрикции. Фрагменты отделяют от вектора электрофорезом на геле агарозы и очищают фрагменты от агарозы с помощью агаразы (от компании Boehringer Mannheim). Поскольку фрагменты имеют размер всего 90- 240 пар оснований, то изолированные фрагменты перед введением метки с помощью 32P-dCTP подвергают реакции связывания, используя либо набор праймеров Prime-It (от компании Stratagene), либо набор для введения меток в ДНК Ready to Go (от компании Pharmacia).
A. 4.7. Результаты
A. 4.7.1. Генерирование фрагментов ДНК, полученных по полимеразной реакции синтеза цепи, кодирующих альфа-1,4-глюканлиазу
Последовательность аминокислотных остатков перекрывающихся триптических пептидов из альфа-1,4-глюканлиазы используют для генерирования смешанных олигонуклеотидов, которые могут быть использованы в качестве праймеров для проведения полимеразной реакции синтеза цепи (см. приведенные выше последовательности).
При проведении первой амплификации по полимеразной реакции синтеза цепи праймеры A/B (см. выше) используют в качестве праймеров обратного направления, а праймер C (см. выше) используют в качестве праймера прямого направления. Размер ожидаемого продукта полимеразной реакции синтеза цепи составляет 71 пару оснований.
При проведении второй амплификации по полимеразной реакции синтеза цепи праймеры A/B используют в качестве праймеров обратного направления, а праймер E используют в качестве праймера прямого направления. Размер ожидаемого продукта полимеразной реакции синтеза цепи составляет 161 пару оснований.
При проведении третьей амплификации по полимеразной реакции синтеза цепи праймеры 1 (см. выше) и 2 (см. выше) используют в качестве праймеров обратного направления, а праймер E (см. выше) используют в качестве праймера прямого направления. Размер ожидаемого продукта полимеразной реакции синтеза цепи составляет 238 пар оснований.
Продукты полимеразной реакции синтеза цепи анализируют на 2%-ном МТ агарозном геле и фрагменты ожидаемого размера отрезают от геля и обрабатывают агаразой (от компании Boehringer Mannheim) и клонируют на векторе pT7blue (от компании Novagel) и определяют первичную структуру.
Клонированные фрагменты после первой и второй амплификаций по полимеразной реакции синтеза цепи кодируют аминокислоты, соответствующие пептидам, для которых установлена последовательность аминокислотных остатков (см. ранее). Клон после третьей амплификации (см. выше) лишь на 87% гомологичен пептидам, для которых установлена последовательность аминокислотных остатков.
A. 4.7.2. Скрининг геномной библиотеки с клонированными фрагментами, полученными по полимеразной реакции синтеза цепи.
Скрининг библиотеки с указанными выше клонами дает два клона. Один клон содержит последовательность нуклеотидов с номером идентификации 4 (ген 2). Другой клон содержит часть последовательности с номером идентификации 3 (в прямом направлении от пары оснований 1065) (ген 1).
5'-Конец последовательности с номером идентификации 3 (т.е. в обратном направлении от пары оснований 1064) получают методом быстрой амплификации концов кДНК (A.F. Michael. K.D. Michael & G.R. Martin (1988) Proc. Natl. Acad. Sci. USA 85: 8998-9002) с использованием 5'-системы быстрой амплификации от компании Gibco BRL. Полную РНК выделяют по методике Collinge et al. (D.B. Collinge, D.E. Milligan, J.M. Dow, G. Scofield & M.J. Daniels (1987), Plant Mol. Biol. 8; 405-414). Быструю амплификацию 5'-конца проводят в соответствии с рекомендациями поставщика с использованием 1 мкг полной РНК. Продукт полимеразной реакции синтеза цепи после второй амплификации клонируют на векторе pT7blueв от компании Novagen в соответствии с рекомендациями поставщика. Чтобы компенсировать ошибки при проведении полимеразной реакции синтеза цепи, определяют последовательность аминокислотных остатков трех клонов, полученных по полимеразной реакции синтеза цепи.
Чтобы дополнить только что описанный клон сайтами рестрикции XbaI и NdeI непосредственно перед стартовым кодоном ATG, проводят еще одну полимеразную реакцию синтеза цепи, используя олигонуклеотид GCTCTA GAG CATG TTTTCAACCCTT GCG в качестве праймера обратного направления, и праймер, содержащий комплементарную последовательность, составленную из пар оснований 1573-1593 в последовательности GL1 (т.е. последовательности с номером идентификации 3), в качестве праймера прямого направления.
Полную последовательность для гена 1 (т.е. последовательность с номером идентификации 3) генерируют клонированием 3'-конца гена в виде фрагмента BamHI-Hind III геномного клона на векторе pBluescript 11 KS +, поставляемом компанией Stratagene, и дополнительным клонированием полученного по полимеразной реакции синтеза цепи 5'-конца гена в виде фрагмента XbaI-BamHl перед 3'-концом.
Ген 2 клонируют в виде дефосфорилированного на конце фрагмента Hind III на сайт EcoRV вектора pBluescript 11 KS +, поставляемого компанией Stratagene. Часть нетранслированной 3'-концевой последовательности удаляют ферментацией с SacI и последующим повторным связыванием. Сайты рестрикции Hind III и HpaI вводят непосредственно перед стартовым кодоном AT ферментацией с Hind III и HarI и повторным связыванием в присутствии следующих нуклеотидов с восстановленной первичной структурой:
AGCTT GTTAACATG TATCCAACCCTCACCTTCGTGG ACAATT GTACATAGGTTGGGAGTGGAAGCACCGC
В клонах, для которых установлена первичная структура, интронов не обнаружено. Клон первого типа (последовательность с номером идентификации 3) может быть сравнен со всеми десятью пептидными последовательностями (см. фиг. 8) и показывает 100%-ную идентичность. Сравнение двух белковых последовательностей, кодируемых генами, которые выделяют из инфицированных грибками водорослей Gracilariopsis lemaneiformis, указывает на приблизительно 78%-ную идентичность, что свидетельствует о том, что оба гена кодируют альфа-1,4-глюканлиазу.
A. 5. Экспрессия гена альфа-1,4-глюканлиазы в микроорганизмах.
(Анализ трансформантов лиазы из Pichia и трансформантов лиазы из Aspergielus)
Последовательность ДНК, кодирующую альфа-1,4-глюканлиазу, вводят в микроорганизмы для продуцирования в больших количествах фермента, обладающего высокой удельной активностью.
С этой целью, ген 1 (т.е. последовательность с номером идентификации 3) клонируют как фрагмент NotI-HindIII с дефосфорилированным концом (используют набор для дефосфорилирования ДНК, поставляемый компанией Amersham International) на вектор экспрессии pHIL-D2 из Pichia (содержащий промотор AOOX1), подвергнутый ферментации с EcoRI и подвергнутый концевому дефосфорилированию (используют набор для дефосфорилирования ДНК, поставляемый компанией Amersham International) для экспрессии в Pichia pastoris (в соответствии с методикой, приведенной в наборе для экспрессии в Pichia, который поставляется компанией Invitrogen).
В другом варианте осуществления настоящего изобретения ген 1 (т.е. последовательность с номером идентификация 3) клонируют как фрагмент NotI-HindIII с дефосфорилированным концом (используют набор для дефосфорилирования ДНК, поставляемый компанией Amersham International) на векторе экспрессии pBABMTE1 (содержит метилтрифтофановый промотор резистентности из Neuropera crassa), подвергнутом ферментации с SmaI для экспрессии в Aspergillus niger (Pall et al., Fungal Genet. Newslett, 1993, Vol. 40, pp. 59-60). Протопласты получают в соответствии с методикой, приведенной в публикации (Daboussi et al., Curr. Genet 1989, Vol. 15, pp. 453-456), используя лизирующие ферменты Sigma L-2773 и литиказу Sigma L-8012. Трансформацию протопластов проводят в соответствии с методикой, приведенной в публикации (Buxton et al. , Gene 1985, Vol. 37, pp. 207-214), за исключением того, что нанесение трансформированных протопластов на планшет проводят по методике, приведенной в публикации (Punt et al., Methods in Enzymology, 1982, Vol. 216, pp.447-457), и используют 0,6%-ную осмотически стабилизированную агарозу.
Результаты показывают, что в трансформированных Pichia pastoris и Aspergillus niger наблюдается активность лиазы.
A.5.1. Общие методы.
Получение освобожденных от клеток экстрактов.
Клетки отделяют центрифугированием со скоростью 9000 об/мин в течение 5 мин и промывают 0,9%-ным раствором хлорида натрия, вновь суспендируют в буферном растворе для проведения ферментации (50 мМ раствор фосфата калия с pH 7,5, содержащий 1 мМ этилендиаминтетрауксусной кислоты и 5% глицерина). Клетки разрушают с помощью стеклянных шариков и энергичного перемешивания. Раствор для фрагментации содержит 1 мМ PMSF (ингибитор протеазы). Экстракт лиазы (жидкость над осадком) получают после центрифугирования в течение 5 мин со скоростью 9000 об/мин, а затем в течение 5 мин с ускорением 20000 х g.
Исследование активности лиазы с помощью щелочного реактива 3,5-динитросалициловой кислоты
Один объем экстракта лиазы смешивают с равным объемом 4%-ного раствора амилопектина. Реакционную смесь выдерживают в термостате, через определенные интервалы времени отбирают пробы и анализируют их на содержание 1,5-D-ангидрофруктозы.
Активность лиазы анализируют также с использованием радиоактивного метода.
Реакционная смесь содержит 10 мкл раствора крахмала, содержащего метку 14C (1 мкКи; Sigma Chemicals Co.) и 10 мкл экстракта лиазы. Реакционную смесь оставляют на ночь при комнатной температуре, а затем анализируют в обычной системе тонкослойной хроматографии. Полученную радиоактивную 1,5-D-ангидрофруктозу детектируют с помощью устройства Instant Imager (компания Pachard Instrument Co., Inc. Мериден, штат Коннектикут).
Электрофорез и вестерн-блоттинг
SDS-PAGe. проводят, используя 8-25% градиентные гели и устройство Phast System (от компании Pharmacia). Вестерн-блоттинг также проводят, используя приставку Semi dry устройства Phast System.
Первичные антитела, возникающие в ответ на действие лиазы, выделенной из красных морских водорослей, собранных в Хиндао (Китай), используют при разбавлении 1:100. Свиной антикроличий IqG, связанный с щелочной фосфатазой (Dako A/S, Глоструп, Дания) используют в качестве вторичного антитела в разбавлении 1:1000.
Часть I. Анализ трансформантов из Pichia, содержащих приведенную выше генную конструкцию
Результаты:
1. Активность лиазы определяют через 5 дней после индуцирования (в соответствии с руководством) и показывают, что активность является внутриклеточной для всех образцов серии B.
Образцы серии B: - Удельная активность:
11 - 139
12 - 81
13 - 122
15 - 192
26 - 151
27 - 253
28 - 199
29 - 198
30 - 150
(*) Удельную активность определяют как количество наномолей 1,5-D-ангидрофрухтозы, выделяемой в минуту на один грамм белка, в реакционной смеси, содержащей 2% (вес./об) гликонена, 1% (вес./об) глицерина в 10 мМ буферного раствора фосфата калия (pH 7,5).
Температура реакции 45oC; время реакции 60 мин.
Ход времени для образца B27 приведен ниже. Эти же данные представлены на фиг. 1.
Время (мин) - Удельная активность
0 - 0
10 - 18
20 - 54
30 - 90
40 - 147
50 - 179
60 - 253
Условия проведения анализа указаны ранее, за исключением того, что время варьируют.
2. Анализ по методу вестерн-блоттинга.
CFE всех образцов содержит полосы с молекулярным весом, соответствующим природной лиазе (табл. 5).
Часть II. Трансформанты из Aspergillus
Результаты:
1. Активность лиазы определяют через 5 дней выдерживания в термостате (анализ минимального количества среды, содержащей 0,2% ферментного гидролизата казеина с помощью щелочного реактива 3,5-динитросалициловой кислоты).
1) Анализ активности лиазы в среде с культурой
Среди 35 культур, выращенных в среде, содержащей 0,2% амилопектина, альфа-1,4-глюканлиаза обнаружена лишь в двух культурах. Среда с культурой 5,4+ и 5,9+ содержит 0,13 г альфа- 1,4-глюканлиазы в литре и 0,44 г альфа-1,4-глюканлиазы в литре соответственно. Этот результат показывает, что активная лиаза секретируется из клеток. Активность лиазы обнаруживается и в не содержащем клеток экстракте.
2) Активность лиазы в не содержащих клетки экстрактах
Культура - Удельная активность (*)
5,4+ - 51
5,9+ - 148
5,13 - 99
5,15 - 25
5,19 - 37
(*) Удельную активность определяют как количество наномолей 1,5-D-ангидрофруктозы, выделяемое в минуту на один грамм белка при температуре 25oC. Знак "+" указывает на то, что добавлено 0,2% амилопектина.
Полученные результаты показывают, что ген альфа-1,4-глюканлиазы экспрессируется внутриклеточно в A. niger.
Эксперименты с трансформированными E. coli (с использованием векторов клонирования pQE30 из набора векторов экспрессии Qia от компании Qiagen) свидетельствуют об экспрессии фермента, который распознается антителом фермента, выделенного из инфицированных грибками Gracilariopsis lemaneiformis.
B. ИСТОЧНИК - ГРИБОК
B.1.1. Материалы и методы
Грибок Morchella costata получают из Американской коллекции типовых культур (ATCC) Грибки выращивают при температуре 25oC в шейкере с использованием среды, рекомендованной ATCC. Мицеллы отделяют фильтрованием и промывают 0,9%-ным раствором хлорида натрия.
Клетки грибков разрушают гомогенизацией с последующей обработкой ультразвуком при охлаждении льдом в 50 мМ растворе цитрат-NaOH с pH 6,2 (Буфер A) в течение 6 х 3 мин. Остатки клеток удаляют центрифугированием с ускорением 25000 х g в течение 40 мин. Полученную жидкость над осадком можно рассматривать как свободный от клеток экстракт, который после разделения на 8-25% градиентном геле используют для определения активности по методу окрашивания и вестерн-блоттинга.
B.1.2. Разделение на геле бета-циклодекстрин-сефароза
Не содержащий клеток экстракт непосредственно помещают в колонку с гелем бета-циклодекстрин-сефароза 4B (2,6 х 18 см), предварительно уравновешенную Буфером A. Колонку промывают 3 объемами Буфера A и 2 объемами Буфера A, содержащего 1 М хлорида натрия. Альфа-1,4-глюканлиазу элюируют 2%-ным раствором декстринов в Буфере A. Активные фракции объединяют и меняют буферный раствор на 20 мМ раствор бис-трис-пропан-HCl (pH 7,0, Буфер B).
Активные фракции переносят в колонку с Mono Q HR 5/5, предварительно уравновешенную Буфером В. Грибковую лиазу элюируют Буфером В в линейном градиенте 0,3 М хлорида натрия. По другому способу препараты лиазы, полученные после хроматографии на бета-циклодекстрин-сефарозе, упаривают до объема 150 мкл и наносят на хроматографическую колонку быстрого разрешения с сефарозой 12.
B 1.3. Анализ на активность альфа-1,4-глюканлиазы и условия для определения специфичности субстрата, оптимального значения pH и температуры.
Реакционная смесь, используемая для определения активности альфа-1,4-глюканлиазы, содержит 10 мг/мл амилопектина и 25 мМ буферного раствора MeS-NaOH (pH 6,0).
Реакцию проводят в течение 30 мин при температуре 30oC и прерывают добавлением реактива 3,5-динитросалициловой кислоты. Оставляют на 10 мин при комнатной температуре и измеряют оптическую плотность на длине волны 550 нм. Если используют не содержащие клеток экстракты, то добавляют 10 мМ этилендиаминтетрауксусной кислоты.
Используемый при проведении анализа в качестве субстрата амилопектин можно заменить на другие субстраты, температуру реакции можно изменить, как указано в описании.
При определении оптимальных значений pH реакционная смесь содержит амилопектин или мальтотетрозу в количестве 10 мг/мл в 40 мМ буферного раствора. В качестве буфера используют глицин-HCl (pH 2,0-3,5), HOAc- NaOAc (pH 3,5-5,5), MopS-NaOH (pH 6,0-8,0 и бицин-NaOH (pH 7,6-9,0). Реакцию проводят в течение 30 мин при температуре 30oC. Условия реакции при определении оптимального значения температуры те же, что и указанные ранее, за исключением того, что во всех экспериментах применяют буфер MopS-NaOH (pH 6,0). Температуру реакции варьируют, как указано по тесту.
Электрофорез (SDS-PAGE, Native-PAGE) и изоэлектрофокусировку проводят с помощью устройства Phast System (компания Pharmacia, Швеция) с 8-25% градиентными гелями и гелями в градиенте pH 3-9 соответственно. После электрофореза гели окрашивают серебром в соответствии с методикой поставщика (Pharmacia) Гликопротеины окрашивают с помощью реакции Шифф-иодная кислота (PAS), адаптированной под Phast System. При проведении окрашивания с целью определения активности электрофорез проводят в естественных условиях при температуре 6oC.
После электрофореза гель выдерживают в термостате в течение ночи при температуре 30oC в присутствии 1% растворимого крахмала. Полосу активности грибковой лиазы определяют окрашиванием с использованием раствора иод/иодид калия.
B. 1.4. Результаты
B. 1.4.1. Очистка, молекулярная масса и изоэлектрическая точка альфа-1,4-глюканлиазы
Было обнаружено, что грибковая лиаза сорбируется на колонке с бета-циклодекстрин-сефарозой, крахмалом и красной сефарозой. Для проведения очистки используют колонки с бета-циклодекстрин-сефарозой 4B и крахмалами.
Полученная на этой стадии лиаза содержит лишь незначительные примеси белков, молекулярная масса которых больше, чем у грибковой лиазы. Примеси удаляют либо ионобменной хроматографией на Mono Q HR 5/5, или более эффективно гель-фильтрацией на сефарозе 12.
Очищенный фермент является бесцветным и имеет поглощение в видимой области спектра. Молекулярная масса, которую оценивают по методу SDS-PAGE, составляет 110 кДа.
Изоэлектрическую точку очищенной грибковой лиазы pI, равную 5,4, определяют методом изоэлектрической фокусировки на гелях в градиенте pH 3-9. На натуральных гелях для электрофореза фермент наблюдается в виде одной полосы. Эта полоса проявляет активность при расщеплении крахмала, что обнаруживают по окрашиванию активности. В зависимости от возраста культуры, из которой экстрагируют фермент, фермент на естественных и изоэлектрических фокусирующих гелях показывает либо узкую полосу, или более размытую полосу с тем же значением скорости электромиграции и pI.
B. 1.4.2. Оптимальные значения pH и температуры для реакций, катализируемых лиазой.
Было установлено, что оптимальный интервал значений pH для реакций, катализируемых лиазой, составляет от pH 5 до pH 7.
B.1.4.3. Специфичность субстрата
Очищенная грибковая лиаза расщепляет мальтосахариды от мальтозы до мальтогептозы. Однако скорость расщепления варьирует. Наибольшая активность наблюдается с мальтотетрозой (активность принята за 100%), затем с мальтогексозой (97%), мальтогептозой (76%), мальтотриозой (56%), а наименьшая активность наблюдается с мальтозой (2%). Амилопектин, амилоза и гликоген также расщепляются грибковой лиазой (% будет определен). Грибковая лиаза является экзо-лиазой, а не эндо-лиазой, поскольку она расщепляет п-нитрофенил альфа-D-мальтогептозу, однако не может расщепить п-нитрофенил альфа-D-мальтогептозу, блокированную восстанавливающим концом.
B.1.5. Morchella vulgaris
Методики очистки и определения свойств альфа-1,4-глюканлиазы, выделяемой из Morchella vulgaris, те же, что и приведенные выше для Morchella costata (результаты аналогичны).
B. 2. Установление последовательности аминокислотных остатков альфа-1,4-глюканлиазы, выделенной из грибков.
B.2.1. Установление последовательности аминокислотных остатков лиаз.
Лиазы ферментатируют либо с эндопротеиназой Arg-C из Clostridium hystolyticum, либо с эндопротеиназой Lys-C из Lysobacter enzymogenes, которые имеют необходимую чистоту для проведения процедуры определения первичной структуры и поставляются компанией Bochringer Mannheim (Германия). При проведении ферментации с эндопротеиназой Arg-C обезвоженную методом сублимационной сушки лиазу (0,1 мг) растворяют в 50 мкл 10 М раствора мочевины, 50 мМ метиламина, 0,1 М Tris-HCl, pH 7,6. Продувают азотом и добавляют 10 мкл 50 мМ раствора дитиотреитола и 5 мМ этилендиаминтетрауксусной кислоты, а затем белок денатурируют и восстанавливают в течение 10 мин при температуре 50oC в атмосфере азота. После этого добавляют 1 мкг эндопротеиназы Arg-C в 10 мкл 50 мМ раствора Tris-HCl с pH 8,0, продувают азотом и проводят ферментацию в течение 6 ч при температуре 37oC.
С целью функционализации цистеина добавляют 12,5 мкл 100 мМ раствора иодацетамида и полученный раствор помещают на 15 мин в темное место в термостате при комнатной температуре в атмосфере азота.
При проведении ферментации с эндопротеиназой Lys-C обезвоженную методом сублимационной сушки лиазу (0,1 мг) растворяют в 50 мкл 8 М раствора мочевины, 0,4 М бикарбоната аммония, pH 8,4. Продувают азотом и добавляют 5 мкл 45 мМ раствора дитиотреитола, а затем белок денатурируют и восстанавливают в течение 15 мин при температуре 50oC в атмосфере азота. После охлаждения до комнатной температуры добавляют 5 мкл 100 мМ раствора иодацетамида, чтобы получить функциональные производные цистеина, и оставляют на 15 мин в темном месте при комнатной температуре в атмосфере азота. Затем добавляют 90 мкл воды и 5 мкг эндопротеиназы Lys-C в 50 мкл 50 мМ раствора трицина и 10 мМ этилендиаминтетрауксусной кислоты с pH 8,0 и проводят ферментацию в атмосфере азота в течение 24 ч при температуре 37oC.
Полученные пептиды разделяют методом жидкостной хроматографии высокого разрешения с обращенной фазой на колонке VYDAC C18 (0,46 х 15 см; 10 мкм; от компании The Separations Group, Калифорния), используя в качестве элюента растворитель A: 0,1%-ный раствор трифторуксусной кислоты в воде, и растворитель B: 0,1%-ный раствор трифторуксусной кислоты в ацетонитриле. Перед проведением процедуры установления первичной структуры на секвенторе Applied Biosystems 476A в импульсном режиме подачи жидкой фазы с короткими циклами выделенные пептиды повторно хроматографируют на колонке Develosil CI8 (0,46 х 10 см; 3 мкм; от Dr. Ole Schou из компании Novo Nordisk, Дания), используя ту же систему растворителей.
Данные о последовательности аминокислотных остатков фермента, полученного из грибка Morchella costata, представлены на фиг. 17.
Данные о последовательности аминокислотных остатков фермента, полученного из грибка Morchella vulgaris представлены на фиг. 18.
B. 3. Установление ДНК последовательности генов, кодирующих альфа-1,4-глюканлиазу, полученную из грибков
B.3.1. Методы молекулярной биологии
ДНК выделяют, как описано в публикации Dellaporte et al., Plant Mol. Biol. Rep., Vol. 1, pp. 19-21 (1983).
B.3.2. Полимеразная реакция синтеза цепи
Получение представляющей интерес молекулы ДНК осуществляют, используя набор для амплификации ДНК Gene Amp DNA Amplification Kit (от компании "Perkin Elmer Cetus", США) и рекомендации поставщика, за исключением того, что Tag-полимеразу добавляют позднее (см. Циклы полимеразной реакции синтеза цепи в табл. С), а циклы температуры изменяют следующим образом, см в табл. С.
В. 3.3. Клонирование фрагментов, полученных по полимеразной реакции синтеза цепи
Фрагменты, полученные по полимеразной реакции синтеза цепи, клонируют на pTBlue (от компании Novagen) в соответствии с рекомендациями поставщика.
B.3.4. Определение ДНК последовательности
Определение последовательности аминокислотных остатков двухцепочечной ДНК определяют в соответствии с дидеокси- методом Sanger et al., (1979), используя набор для установления первичной структуры Auto Read Sequencig Kit (от компании Pharmacia) и ДНК секвентор Pharmacia LKB A.L.F. (см. F. Sanger, S. Nicklen and A.R. Coulson. "DNA Sequencing with chain-determinating inhibitors", Proc. Natl. Acad. Sci. USA 74: 5463-5467 [1979]).
B. 3.5. Скрининг библиотеки
Скрининг библиотек: Lambda Zap, полученных от компании Stratagene, проводят в соответствии с рекомендациями поставщика, за исключением того, что предгибридизацию и гибридизацию проводят на 2хSSC, 0,1% SDS 10х Denhardt's и 100 мкг/мл денатурированной семенной жидкости лосося.
К раствору для проведения гибридизации добавляют денатурированную пробу, содержащую метку 32P. Гибридизацию проводят в течение ночи при температуре 55oC. Фильтры дважды промывают с помощью 2хSSC, 0,1% SDS и дважды с помощью 1xSSC, 0,1% SDS.
A.4.6. Проба.
Клонированные фрагменты, полученные по полимеразной реакции синтеза цепи, отделяют от вектора pT7blue путем ферментации с подходящими ферментами рестрикции. Фрагменты отделяют от вектора электрофорезом на геле агарозы и очищают фрагменты от агарозы с помощью агаразы (от компании Boehringer Mannhein). Поскольку фрагменты имеют размер всего 90- 240 пар оснований, то изолированные фрагменты перед введением метки с помощью 32P-dCTP подвергают реакции связывания, используя либо набор случайных праймеров Prime-It (от компании Stratagene), либо набор для введения меток в ДНК Ready to Go (от компании Pharmacia).
B.3.7. Результаты.
B. 3.7.1. Генерирование фрагментов ДНК, полученных по полимеразной реакции синтеза цепи, кодирующих альфа-1,4-глюканлиазу
Последовательности аминокислотных остатков (приведенные далее) перекрывающихся триптических пептидов из альфа-1,4- глюканлиазы используют для генерирования смешанных олигонуклеотидов, которые могут быть использованы в качестве праймеров для проведения полимеразной реакции синтеза цепи для амплификации ДНК, выделенной из Morchella costata и Morchella vulgaris.
Lys Asn Leu His Pro Gln His Lys Met Leu Lys Asp Thr Val Leu Asp Ile Val Lys
Pro Gly His Gly Glu Туг Val Gly Trp Gly Glu Met Gly Gly Ile Gln Phe Met Lys
Glu Pro Thr Phe Met Asn Tyr Phe Asn Phe Asp Asn Met Gln Tyr Gln Gln Val Tyr
Ala Gln Gly Ala Leu Asp Ser Arg Glu Pro Leu Tyr His Ser Asp Pro Phe Tyr
При проведении первой амплификации по полимеразной реакции синтеза цепи праймеры A1/A2 (см. ниже) используют в качестве праймеров обратного направления, а праймеры B1/B2 (см. ниже) используют в качестве праймеров прямого направления.
Праймер A1: CA(GA)CA(CT)AA(GA)ATGCT(GATC)AA(GA)G(CT)AC
Праймер A2: CA(GA)CA(CT)AA(GA)ATGTT(GA)AA(GA)GA(CT)AC
Праймер B1: TA(GA)AA(GATC)GG((GA)TC(GA)CT(GA)TG(GA)TA
Праймер B2: TA(GA)AA(GATC)GG(GA)TC(GATC)GA(GA)TG(GA)TA
Продукты полимеразной реакции синтеза цепи анализируют на 2%-ном LMT агарозном геле и фрагменты ожидаемого размера отрезают от геля и обрабатывают агарозой (от компании Boehringer Mannheim), клонируют в векторе pT7blue (от компании Novagel) и определяют первичную структуру.
Клонированные фрагменты после амплификации по полимеразной реакции синтеза цепи, кодируют аминокислоты, соответствующие пептидам, для которых установлена последовательность аминокислотных остатков (см. ранее). Для Morchella costata амплифицированная по полимеразной реакции синтеза цепи ДНК последовательность соответствует последовательности, приведенной на фиг. 14, от позиции 1202 до позиции 1522. Для Morchella vulgaris амплифицированная по полимеразной реакции синтеза цепи ДНК последовательность соответствует последовательности, приведенной на фиг. 15, от позиции 1218 до позиции 1535.
A. 4.7.2. Скрининг геномной библиотеки с клонированными фрагментами, полученными по полимеразной реакции синтеза цепи.
Скрининг библиотеки с указанными выше клонами дает два клона для каждого источника. Для Morchella costata два клона объединяют с образованием последовательности, приведенной на фиг. 14 (см. ниже). Для Morchella vulgaris два клона могут быть объединены с образованием последовательности, приведенной на фиг. 15, как это описано выше.
Чтобы дополнить только что описанный клон сайтами рестрикции PstI, PvuII, AgcI и NcI непосредственно перед стартовым кодоном AT, проводят еще одну полимеразную реакцию синтеза цепи, используя олигонуклеотид
AAACTGCAGCTGGCGCGCC ATGGCAGGATTTTCTGAT
в качестве праймера обратного направления, и праймер, содержащий комплементарную последовательность, составленную из пар оснований 1297-1318 на фиг. 4, в качестве праймера прямого направления.
Полную последовательность для Morchella costata получают клонированием 5'-конца гена в виде фрагмента BgIII-EcoRI одного из геномных клонов (первого клона) на сайты BamHI-EcoRI вектора pBluescript 11 KS+, полученного от компании Stratagen. Затем 3'-конец гена клонируют на вектор pBluescript 11 KS+, модифицированный присоединением фрагмента NspV (с дефосфорилированным концом с помощью набора для дефосфорилирования ДНК от компании Amersham International)-EcoRI из другого геномного клона (второго клона), после того, как модифицированный вектор pBluescript 11 KS+ подвергают ферментации с EcoPI и EcoP. Затем промежуточную часть гена клонируют на еще одном модифицированном векторе pBluescript 11 KS+ в виде фрагмента EcoRI из первого клона путем связывания этого фрагмента с другим модифицированным вектором pBluescript 11 KS+, подвергнутым ферментации с EcoRI.
B.4. Экспрессия гена альфа-1,4-глюканлиазы в микроорганизмах.
Последовательность ДНК, кодирующую альфа-1,4-глюканлиазу, можно ввести в микроорганизмы для продуцирования в больших количествах фермента, обладающего высокой удельной активностью.
С этой целью ген Morchella costata (фиг. 14) клонируют как фрагмент XbaI-XhoI с дефосфорилированным концом (используют набор для дефосфорилирования ДНК, поставляемый компанией Amersham International) на вектор экспрессии pHIL - D2 из Pichia (содержащий промотор AOOX1), подвергнутый ферментации с EcoRI и подвергнутый концевому дефосфорилированию (используют набор для дефосфорилирования ДНК, поставляемый компанией Amersham International) для экспрессии в Pichia pastoris (в соответствии с методикой, приведенной в наборе для проведения экспрессии в Pichia, который поставляется компанией Invitrogen).
В другом варианте осуществления настоящего изобретения ген 1 из Morchella costata (тот же, что и на фиг. 14, за исключением того, что его модифицируют методом полимеразной реакции синтеза цепи, чтобы ввести сайты рестрикции, как это указано выше) клонируют как фрагмент Pvu II-XhoI с дефосфорилированным концом (используют набор для дефосфорилирования ДНК, поставляемый компанией Amersham International) на векторе экспрессии pBARMTE1 (содержит метилтрифтофановый промотор резистентности из Neuropera crassa), подвергнутом ферментации с SmaI для экспрессии в Aspergillus niger (Pall et al., Fungal Genet. Neewslett, 1993, Vol.40, pp. 59-60). Протопласты получают в соответствии с методикой, приведенной в публикации (Daboussi et al., Curr. Genet 1989, vol.15, pp.453-456), используя лизирующие ферменты Sigma L-2773 и литиказу Sigma L-8012. Трансформацию протопластов проводят в соответствии с методикой, приведенной в публикации (Buxton et al., Gene 1985, Vol. 37, pp. 207-214), за исключением того, что нанесение трансформированных протопластов на планшет проводят по методике, приведенной в публикации (Punt et al. , Methods in Enzymology, 1992, Vol. 216, pp.447-457), и используют 0,6%-ную осмотически стабилизированную агарозу.
Результаты показывают, что в трансформированных Pichia pastoris и Aspergillus niger наблюдается активность лиазы.
Анализ трансформантов лиазы из Pichia и трансформантов лиазы из Aspergillus.
Общие методы.
Получение освобожденных от клеток экстрактов
Клетки отделяют центрифугированием со скоростью 9000 об/мин в течение 5 мин и промывают 0,9%-ным раствором хлорида натрия, вновь суспендируют в буферном растворе для проведения фрагментации (50 мМ раствор фосфата калия с pH 7,5, содержащий 1 мМ этилендиаминтетрауксусной кислоты и 5% глицерина). Клетки разрушают с помощью стеклянных шариков и интенсивного перемешивания. Раствор для фрагментации содержит 1 мМ PMSF (ингибитор протеазы). Экстракт лиазы (жидкость над осадком) получают после центрифугирования в течение 5 мин со скоростью 9000 об/мин, а затем в течение 5 мин с ускорением 20000 х g.
Исследование активности лиазы с помощью щелочного реактива 3,5-динитросалициловой кислоты
Один объем экстракта лиазы смешивают с равным объемом 4%-ного раствора амилопектина. Реакционную смесь выдерживают в термостате и образцы извлекают через определенные интервалы и анализируют на содержание 1,5-D-ангидрофруктозы.
Активность лиазы анализируют также с использованием радиоактивного метода
Реакционная смесь содержит 10 мкл раствора крахмала, содержащего метку 14C (1 мкКи; Sigma Chemicals Co.) и 10 мкл экстракта лиазы. Реакционную смесь оставляют на ночь при комнатной температуре, а затем анализируют в обычной системе тонкослойной хроматографии. Полученную радиоактивную 1,5-D-ангидрофруктозу детектируют с помощью устройства Instant Imager (компания Pachard Instrument Co., Inc. Мериден, штат Коннектикут).
Электрофорез и вестерн-блоттинг
SDS-PAGE проводят, используя 8-25% градиентные гели и устройство Phast System (от компании Pharmacia) Вестерн-блоттинг также проводят, используя приставку Semidry устройства Phast System. Первичные антитела, возникающие в ответ на действие лиазы, выделенной из красных морских водорослей, собранных в Хиндао (Китай), используют при разбавлении 1:100. Свиной антикроличий IgG связанный с щелочной фосфатазой (Dako A/S, Голструп, Дания), используют в качестве вторичного антитела в разбавлении 1:1000.
Часть 1. Анализ трансформантов из Pichia, содержащих приведенную выше генную конструкцию
Лиаза из Morchella costata, экспрессированная внутриклеточно в Pichia pastoris.
Культура. - Удельная активность (*)
A18 - 10
A20 - 32
A21 - 8
A22 - 8
A24 - 6
(*)Удельную активность определяют как количество наномолей 1,5-D-ангидрофруктозы, выделяемой в минуту на один грамм белка при температуре 25oC.
Часть II. Трансформанты из Aspergillus
Результаты:
1. Активность лиазы определяют через 5 дней выдерживания в термостате (анализ минимального количества среды, содержащей 0,2% ферментного гидролизата казеина с помощью щелочного реактива 3,5-динитросалициловой кислоты).
Активность лиазы в не содержащих клетки экстрактах
Культура - Удельная активность(*)
8.13 - 11
8.16 - 538
8.19 - 37
*Удельную активность определяют как количество наномолей 1,5-D-ангидрофруктозы, выделяемой в минуту на один грамм белка при температуре 25oC.
Полученные результаты показывают, что лиаза из Morchella costata экспрессируется внутриклеточно в A. niger.
II. Изучение активности лиазы радиоактивным методом
Освобожденные от клеток экстракты следующих культур содержат 1,5-D-ангидрофруктозу с меткой 14C.
51+, 54+, 55+, 59+, 512, 513, 514, 515, 516, 518, 519.
Данные тонкослойной хроматографии продуктов расщепления под действием альфа-1,4-глюканлиазы с использованием C-крахмала в качестве субстрата приведены на фиг. 20. Реакционную смесь наносят на пластинку ТСХ. Номер дорожки соответствует номеру культуры: 1, 512; 2, 513; 3, 514; 4, 515; 5, 516; 7, 518; 8, 519; 9, 520. Пятна, идущие с фронтов, соответствуют 1,5-D-ангидрофруктозе.
C. ИСТОЧНИК - САМИ ВОДОРОСЛИ
Методики очистки и изучение свойств альфа-1,4-глюканлиазы, выделенной из Gracilariopsis lemaneiformis(получают из Санта-Круса), в основном те же, что и описанные ранее, например, для Morchella costata (с теми же результатами).
1. Исследование альфа-1,4-глюканлиазы из свободных от паразитов красных водорослей Gracilariopsis lemaneiformis, собранных в Калифорнии.
Аминокислотный состав лиазы приведен в табл. 6.
2. Анализ первичной структуры.
Сравнение последовательности пептидов, выделенной из калифорнийских водорослей, с последовательностью аминокислотных остатков, выделенной из инфицированных грибками водорослей, собранных в Китае, показывает высокую степень гомологичности (идентичность последовательности аминокислот, полученной из фрагментов полимеразной реакции синтеза цепи и соответствующей последовательности в альфа-1,4-глюканлиазе, выделенной из водорослей, собранных в Китае, составляет от 78 до 80%) между двумя белковыми последовательностями.
Из этих двух последовательностей, выделенных из калифорнийских водорослей, получают три олигонуклеотида с целью генерировать фрагмент, получаемый по полимеразной реакции синтеза цепи с массой приблизительно 970 пар оснований.
Праймер 1: ATGAC(GATC)AA(CT)TA(CT)AA(CT)TA(CT)GA(CT)AA
Праймер 2: (AG)TG(GATC)GGCATCAT(GATC)GC(GATC)GG(GATC)AC
Праймер 3: GTCAT(GA)TC(CT)TGCCA(GATC)AC(GA)AA(GA)TC
При проведении первой амплификации по полимеразной реакции синтеза цепи праймер 1 используют в качестве праймера обратного направления, а праймер 2 используют в качестве праймера прямого направления. При проведении второй амплификации по полимеразной реакции синтеза цепи праймер 1 используют в качестве праймера обратного направления, а праймер 3 используют в качестве праймера прямого направления. В результате полимеразной реакции синтеза цепи получают фрагмент ожидаемого размера, который клонируют на векторе pT7blue, поставляемом компанией Novagen. Определяют первичную структуру трех независимых плазмид, содержащих фрагмент, получаемый по полимеразной реакции синтеза цепи, и выясняют, что эти три клонированных фрагмента, полученные по полимеразной реакции синтеза цепи, имеют своими источниками три различных белка. Это указывает на то, что существует по крайней мере три различных гена, кодирующих альфа-1,4-глюканлиазу в калифорнийских водорослях.
3. Концентрация субстрата, при которой достигается половина от максимальной скорости, составляет 3,76 мг/мл для амилопектина и 3,37 мг/мл для глицина.
4. Скорости расщепления различных субстратов под действием лиазы приведены в табл. 7.
Условия проведения реакция: реакционная смесь содержит 10 мМ HOAc-NaOAc (pH 3,8). Концентрация субстрата 10 мг/мл.
Конечный объем после добавления лиазы и воды составляет 100 мкл. Время реакции при температуре 45oC составляет 40 мин.
Лиаза не способна расщеплять пуллулан, тетрасахарид нигеран, тетралозу, изомальтозу, глюкозу, альфа-, бета- и гамма- циклодекстрины. Лиаза расщепляет панозу и нигерозу хотя и с малой скоростью.
5. Оптимальная температура для лиазы составляет 48oC при использовании амилопектина в качестве субстрата и 50oC при использовании гликогена в качестве субстрата. При 50oC реакционная способность гликогена сравнима с реакционной способностью амилопектина; при температуре ниже 50oC амилопектин является более хорошим субстратом, чем гликоген.
6. Оптимальный интервал значений pH для лиазы составляет от 3,5 до 7,0; оптимальным является pH 3,8. При проведении испытаний используют следующие буферы: глицин-HCl (pH 2,2-3,6), HOAc-NaOAc (pH 3,5-5,5), Mes-NaOH (pH 5,5-6,7), Mops-NaOH (pH 6,0-8,0) и бицин-NaOH (pH 7,6-9,0). Количество всех используемых буферов составляет 40 мМ.
7. При конечной концентрации 2 мМ п-хлормеркурбензойная кислота ингибирует активность лиазы на 96%, свидетельствуя о том, что группа (группы) -SH имеет важное значение для активности фермента.
7. Дальнейшие исследования.
7.1. Влияние спиртов на повышение активности и стабильности лиазы, выделенной из инфицированных грибками водорослей.
Исследуют 1-пропанол, 2-пропанол и 1-бутанол в следующих концентрациях (0%, 1%, 5% и 10%). Оптимальная концентрация 1-пропанола составляет 5% и приводит после выдерживания в термостате в течение 6 дней к увеличению выхода 1,5-D- ангидрофруктозы на 34%; оптимальная концентрация 2-пропанола составляет 1% и приводит после выдерживания в термостате в течение 10 дней к увеличению выхода 1,5-D-ангидрофруктозы на 20%; оптимальная концентрация 1-бутанола составляет 5% и приводит после выдерживания в термостате в течение 10 дней к увеличению выхода 1,5-D-ангидрофруктозы на 52%.
Исследуют этанол в следующих концентрациях (0%, 1%, 3%, 5%, 7%, 9%, 11%, 13%, 15%). Оптимальная концентрация для выдерживания в термостате в течение 7 дней составляет 5% и приводит к увеличению выхода 1,5-D-анигдрофруктозы на 12%. Для выдерживания в термостате в течение 10 дней оптимальная концентрация составляет 3% и приводит к увеличению выхода 1,5-D-ангидрофруктоэы на 16% (табл. 8).
7.2. Влияние различных реакционных сред на продуцирование 1,5-D-ангидрофруктозы лиазой, выделенной из инфицированных грибками водорослей, и лиазы из M. costata и M. vulgaris
7.2.1. Лиаза, выделенная из инфицированных грибками водорослей
Результаты показывают (см. далее в таблице), что наилучшей реакционной средой является 5 мМ раствор HOAc-NaOAc (pH 3,9), содержащий миллимолярные концентрации динатриевой соли этилендиаминтетрауксусной кислоты. Использование для продуцирования 1,5-D-ангидрофруктозы как чистой воды, так и 0,85%-ного раствора хлорида натрия приводит к уменьшению выхода. Добавление 0,85%-ного раствора хлорида натрия к 5 мМ раствору HOAc-NaOAc также приводит к уменьшению выхода 1,5-D-ангидрофруктозы (табл. 9).
7.2.2. Следующие буферы: Mes-NaOH, Mops-NaOH, Hepes-NaOH и бицин-NaOH являются оптимальной реакционной средой для лиазы, выделенной из M. costata и M. vulgaris. В буфере HOAc-NaOAc лиаза неустойчива и использование указанной буферной системы приводит к уменьшению выхода 1,5-D-ангидрофруктозы.
7.3. Воздействие эндоамилазы и удаляющих боковые ответвления ферментов на продуцирование 1,5-D-ангидрофруктозы.
7.3.1. Воздействие эндоамилазы.
Крахмал, который используют для продуцирования 1,5-D-ангидрофруктозы, можно вначале привести в жидкое состояние с помощью эндоамилазы или кислотным гидролизом.
Крахмал, подвергнутый расщеплению эндоамилазой, является более устойчивым субстратом для лиазы по сравнению с природным крахмалом. При температурах, которые применяются при проведении реакций, катализируемых лиазой, крахмал обладает ограниченной растворимостью. Обработка крахмала эндоамилазой приводит к увеличению выхода глюкозы. Что касается выхода 1,5-D-ангидрофруктозы, то было показано, что содержание восстанавливающего вещества, составляющее приблизительно 10-15% (в пересчете на сухой продукт), является наиболее оптимальным для субстрата лиазы и дальнейшая обработка эндоамилазой, приводящая к увеличению восстанавливающего вещества до 19%, не является более приемлемой для лиазы.
7.3.2. Воздействие пуллуланазы и изоамилазы
Как видно из представленных ниже результатов, изоамилаза и пуллуланаза увеличивают выход 1,5-D-ангидрофруктозы до 50% при pH 4,5 и 5,0. Реакционная система включает лиазу, выделенную из инфицированных грибками водорослей, к которой добавлены или не добавлены изоамилаза и пуллуланаза (от компании Mega Zyme Ltd.). В качестве субстрата применяют амилопектин. Количество 1,5-D-ангидрофруктозы, полученной в присутствии лишь лиазы, принимают за 100% (табл. 10).
7.4. Относительная расшепляющая способность грибковой лиазы по отношению к различным субстратам
7.4.1. Лиаза из M. costata (табл. 11).
Активность, наблюдаемая для мальтотетрозы, принимается за 100%.
7.4.2. Лиаза из M. vulgaris (табл. 12).
Активность, наблюдаемая для мальтотетрозы, принимается за 100%. Конечная концентрация субстратов составляет 10 мг/мл.
Лиаза, выделенная из M. costata и M. vulgaris, не может расщеплять следующие сахара: трегалозу, панозу, нигерозу, нигеротетрозу, глюкозу, изоамилозу, альфа-, бета- и гамма-циклодекстрины, пуллулананы и п-нитрофенил-альфа-D-мальтогептозиды, у которых блокирован невосстанавливающий конец, поскольку на ТСХ пластинках не обнаруживают 1,5-D-ангидрофруктозу после выдерживания указанных субстратов в термостате вместе с лиазой в течение 48 ч.
7.5. Оптимальные значения pH и температуры для реакций, катализируемых лиазой приведены в табл. 13.
7.6. Стабилизирующее воздействие гликогена на лиазу, выделенную из инфицированных грибками Gracilariopsis lemaneiformis
Полученные результаты показывают, что при более высоких температурах скорости реакции выше в том случае, если в качестве субстрата используют не амилопектин, а гликоген (табл. 14).
7.7 Молекулярные массы и значения pI для лиаз.
Молекулярные массы лиаз из инфицированных грибками G. lemaneiformis, обе формы лиаз из не содержащих грибков G. lemaneiformis, лиаз из М. costata и M. vulgaris составляют приблизительно 110000 + 10000 дальтон по данным SDS-PAGE при использовании градиентного геля (8-25%).
Значение pI для лиазы из инфицированных грибками G. lemaneiformis составляет приблизительно 3,9. Для лиазы из M. vulgaris величина pI приблизительно составляет 4,6, а величина pI для лиазы из М. costata составляет около 5,0. Эти значения получают изоэлектрической фокусировкой на геле в градиенте pH от 3 до 9.
Значения pI, вычисленные из состава аминокислот: для лиазы из инфицированных грибками G. lemaneiformis 5,58 и для лиазы из М. costata 6,30.
7.8. Иммунологические исследования лиазы методом вестерн-блоттинга.
Результаты показывают, что антитела по отношению к лиазе, выделенной из водорослей, способны распознавать грибковую лиазу как в не содержащих клеток экстрактах, так и в очищенной форме, что подтверждается методом вестерн-блоттинга. Антитела по отношению к лиазе, выделенной из водорослей, собранных в Китае, способны также распознавать лиазу, выделенную из водорослей, собранных в Санта-Крусе (Калифорния).
7.9. Обратимое и необратимое ингибирование грибковой лиазы
7.9.1. Обратимые ингибиторы, глюкоза и мальтоза
При концентрации субстрата 10 мг/мл активность лиазы из M. costata уменьшается на 19,3% в присутствии 0,1 М глюкозы, если в качестве субстрата используют амилопектин; активность не изменяется в том случае, если в качестве субстрата используют гликоген. В присутствии 0,1 М мальтозы активность для гликогена и амилопектина уменьшается соответственно на 48,8 и 73,4% (табл. 15).
Вероятно, ингибирование под действием 0,1 М глюкозы является конкурентным, поскольку увеличение концентрации субстрата от 1 до 2% уменьшает ингибирование с 19,3 до 7%, в то время как ингибирование под действием 0,1 М мальтозы не является конкурентным, так как увеличение концентрации субстрата не приводит к значительному сокращению степени ингибирования.
Для лиазы из M. vulgaris 0,1 М раствор глюкозы и мальтозы также приводит к ингибированию реакции при использовании в качестве субстрата как амилопектина, так и гликогена (табл. 16).
7.9.2. Обратимый ингибитор деоксиджиримицин
При использовании амилопектина в качестве субстрата с конечной концентрацией 2% активность понижается до 10,4% для лиазы из водорослей и лиазы из М. costata в присутствии 25 мкМ деоксиджиримицина. При 100 мкМ активность обеих лиаз практически полностью теряется.
7.9.3. Необратимый ингибитор PCMB.
В тех же самых условиях проведения анализа в присутствии 2 мМ PCMB активность понижается на 60% для лиазы из М. costata и на 98% для лиазы из инфицированных грибками красных водорослей. Это означает, что грибковая лиаза в значительно меньшей степени чувствительна к действию ингибиторов, содержащих тяжелые металлы.
7.10. Примеры продуцирования 1,5-D-ангидрофруктозы в условиях лаборатории.
7.10.1. Продуцирование 1,5-D-ангидрофруктозы при использовании декстрина в качестве субстрата
В реактор помещают 1000 г декстринов (получают обработкой крахмала под действием термамила до конечного содержания восстанавливающего вещества 10%) в конечном объеме 46 л (HOAc- NaOAc с pH 3,9, содержащий 5 мМ динатриевой соли этилендиаминтетрауксусной кислоты). Реакцию инициируют добавлением 3 мг лиазы, выделенной из инфицированных грибками водорослей. Реакцию проводят при комнатной температуре. На 19-й день вносят еще одну порцию лиазы (4 мг) (табл. 17).
7.10.2. Использование 14C-крахмала для продуцирования 14C-1,5-D-ангидрофруктозы.
Крахмал с равномерно распределенной меткой 14C (340 мкКи получают от компании Sigma) сушат в вакууме для удаления содержащегося в нем этанола и растворяют в 2 мл воды. Реакцию инициируют добавлением 20 мкл лиазы, выделенной из инфицированных грибками водорослей, и 20 мкл пуллуланазы (получают от компании Mega Zyme Ltd.). Реакционную смесь оставляют на ночь при температуре 30oC. По окончании реакции смесь отфильтровывают с помощью фильтра, отсекающего молекулы с массой более 10000, с целью отделить ферменты и непрореагировавшие молекулы крахмала.
Фильтрат переносят в колонку с кальциевым производным углеводорода (от компании Chrompack) и используют хроматограф высокого разрешения фирмы Waters. В качестве элюента используют воду. Скорость подачи элюента 0,5 мл/мин. 1,5-D-Ангидрофруктоза эффективно отделяется от глюкозы и мальтосахаридов. Фракции, содержащие 1,5-D-ангидрофруктозу, объединяют и подвергают сублимационной сушке; в целом собирают 140 мкКи 14C-1,5-D-ангидрофруктозы.
Эти находки относятся к еще одному аспекту настоящего изобретения, а именно к использованию реагента, который способен увеличивать гидрофобность реакционной среды (предпочтительно спирта), с целью повышения устойчивости и активности лиазы по настоящему изобретению. Увеличение устойчивости i приводит к повышению выхода 1,5-D-ангидрофруктозы.
Другие модификации настоящего изобретения, не выходящие за рамки притязаний по настоящему изобретению, вполне очевидны для специалистов.
Формула изобретения: 1. Способ получения сахара 1,5-D-ангидрофруктозы, включающий обработку альфа-1,4-глюкана ферментом альфа-1,4-глюканлиазой и выделение целевого продукта, отличающийся тем, что используют клонированный фермент, полученный путем экспресии в подходящих клетках-хозяевах, трансформированных ДНК-конструкцией, содержащей нуклеотидную последовательность, кодирующую альфа-1,4-глюканлиазу и выбранную из группы SEQ N 3,4,7,8.
2. Способ по п.1, отличающийся тем, что если глюкан содержит связи, отличные от и дополнительно к альфа-1,4-связям, то альфа-1,4-глюканлиазу используют в сочетании с подходящим реагентом, способным расщеплять другие связи.
3. Способ по п. 2, отличающийся тем, что глюкан представляет собой крахмал, а гидролазу, предпочтительно глюканогидролазу, используют в сочетании с альфа-1,4-глюканлиазой.
4. Способ по п. 2 или 3, отличающийся тем, что гидролазой является по крайней мере одна из пулланаз или изоамилаз.
5. Способ по любому из предшествующих пунктов, отличающийся тем, что альфа-1,4-глюканлиазу связывают с носителем или, что более предпочтительно, используют в чистом виде.
6. Способ по п.3 или любому зависимому от него пункту, отличающийся тем, что крахмал применяют в больших концентрациях, таких, как приблизительно до 25%, в растворе.
7. Способ по любому из предшествующих пунктов, отличающийся тем, что субстрат подвергают воздействию фермента в присутствии буферного раствора.
8. Способ по любому из пп.1 - 6, отличающийся тем, что субстрат подвергают воздействию фермента в присутствии практически чистой воды.
9. Способ по любому из предшествующих пунктов, отличающийся тем, что субстрат подвергают воздействию фермента в отсутствие кофактора.
10. Способ по любому из предшествующих пунктов, отличающийся тем, что фермент используют в сочетании с амилопектином или декстрином.
11. Способ получения сахара 1,5-D-ангидрофруктозы, включающий обработку альфа-1,4-глюкана ферментом альфа-1,4-глюканлиазой, отличающийся тем, что используют фермент с аминокислотной последовательностью, соответствующей SEQ N 1, или 2, или 5, или 6.
12. Способ по п.11, отличающийся тем, что фермент выделяют либо из грибков, преимущественно Morchella costata или Morchella vulgaris, либо из инфицированных грибками водорослей, преимущественно из Gracilariopsis lemaneiformis либо из самих водорослей, преимущественно Gracilariopsis lemaneiformis.
13. Способ по п.12, отличающийся тем, что фермент выделяют и/или далее очищают из грибков, либо из инфицированных грибками водорослей, либо из самих водорослей с использованием геля, который не разлагается под действием фермента.
14. Способ по п.13, отличающийся тем, что основу геля составляет декстрин или его производные, предпочтительно гель на основе циклодекстрина, более предпочтительно бета-циклодекстрина.
15. Способ по любому из пп.12 - 14, отличающийся тем, что фермент предпочтительно включает последовательность аминокислотных остатков с номером идентификации 1, или последовательность аминокислотных остатков с номером идентификации 2, или последовательность аминокислотных остатков с номером идентификации 5, или последовательность аминокислотных остатков с номером идентификации 6, или любую их разновидность.
16. Применение 1,5-D-ангидрофруктозы в качестве антиоксиданта.
17. Применение 1,5-D-ангидрофруктозы в качестве подслащивателя.