Forbidden

You don't have permission to access /zzz_siteguard.php on this server.

КОНСТРУКЦИЯ ДНК (ВАРИАНТЫ), ДНК-ВЕКТОР, ИММУНОГЕННАЯ КОМПОЗИЦИЯ ПРОТИВ ВИРУСА ГРИППА, СПОСОБ ИНДУКЦИИ ИММУННОГО ОТВЕТА, ВАКЦИНА И СПОСОБ ВАКЦИНАЦИИ - Патент РФ 2193065
Главная страница  |  Описание сайта  |  Контакты
КОНСТРУКЦИЯ ДНК (ВАРИАНТЫ), ДНК-ВЕКТОР, ИММУНОГЕННАЯ КОМПОЗИЦИЯ ПРОТИВ ВИРУСА ГРИППА, СПОСОБ ИНДУКЦИИ ИММУННОГО ОТВЕТА, ВАКЦИНА И СПОСОБ ВАКЦИНАЦИИ
КОНСТРУКЦИЯ ДНК (ВАРИАНТЫ), ДНК-ВЕКТОР, ИММУНОГЕННАЯ КОМПОЗИЦИЯ ПРОТИВ ВИРУСА ГРИППА, СПОСОБ ИНДУКЦИИ ИММУННОГО ОТВЕТА, ВАКЦИНА И СПОСОБ ВАКЦИНАЦИИ

КОНСТРУКЦИЯ ДНК (ВАРИАНТЫ), ДНК-ВЕКТОР, ИММУНОГЕННАЯ КОМПОЗИЦИЯ ПРОТИВ ВИРУСА ГРИППА, СПОСОБ ИНДУКЦИИ ИММУННОГО ОТВЕТА, ВАКЦИНА И СПОСОБ ВАКЦИНАЦИИ

Патент Российской Федерации
Суть изобретения: Изобретение относится к генной инженерии и иммунологии и может быть использовано для получения фармацевтических препаратов, обеспечивающих иммунную защиту против вируса гриппа; конструкции ДНК включают гены, кодирующие белки вируса гриппа человека: нуклеопротеин, гемагглютинин, матричный белок. В качестве основы конструкции используют вектор V1Jns, включающий промотор цитомегаловируса с последовательностью интрона А, область терминации транскрипции гормона роста быка со встроенным уникальным Sfi1-сайтом, область начала репликации, ген устойчивости к канамицину. Конструкции ДНК в составе иммуногенной композиции или вакцины при введении в ткани субъекта экспрессируют генные продукты вируса гриппа, которые могут обеспечить иммунную защиту против инфицирования гомологичным или гетерологичным штаммами вируса гриппа. Изобретение позволяет обеспечить длительно действующий перекрестно-реактивный иммунитет против вируса гриппа. 8 с.п.ф-лы, 51 ил., 7 табл.
Поиск по сайту

1. С помощью поисковых систем

   С помощью Google:    

2. Экспресс-поиск по номеру патента


введите номер патента (7 цифр)

3. По номеру патента и году публикации

2000000 ... 2099999   (1994-1997 гг.)

2100000 ... 2199999   (1997-2003 гг.)
Номер патента: 2193065
Класс(ы) патента: C12N15/44, A61K48/00, A61K39/145
Номер заявки: 95122782/13
Дата подачи заявки: 14.03.1994
Дата публикации: 20.11.2002
Заявитель(и): МЕРК ЭНД КО. ИНК. (US); ВИКАЛ ИНКОРПОРЕЙТЕД (US)
Автор(ы): ДОННЕЛЛИ Джон Дж. (US); ДВАРКИ Варавани Дж. (IN); ЛИУ Маргарет А. (US); МОНТГОМЕРИ Донна Л. (US); ПАРКЕР Сьюзанн Е. (US); ШИВЕР Джон В. (US); АЛМЕР Джеффри Б. (CA)
Патентообладатель(и): МЕРК ЭНД КО. ИНК. (US); ВИКАЛ ИНКОРПОРЕЙТЕД (US)
Описание изобретения: Изобретение касается получения и применения нового фармацевтического продукта: нуклеиновой кислоты, которая при непосредственном введении в ткань живого позвоночного животного вызывает образование иммунных ответных реакций, специфически узнающих вирус гриппа человека.
Грипп представляет собой острое лихорадочное заболевание, вызываемое инфекцией дыхательных путей вирусами гриппа А или В. Вспышки заболеваний гриппом происходят по всему свету почти каждый год с периодическими эпидемиями или пандемиями. Грипп может вызывать значительные общие симптомы, тяжелые заболевания (например, вирусное воспаление легких), требующие госпитализации, и осложнения, такие как вторичная бактериальная пневмония. Недавние эпидемии в Соединенных Штатах, как считают, привели к более 10000 (до 40000) смертных случаев в год и к 5000-10000 смертям в год в неэпидемические годы. Наилучшей стратегией для предотвращения заболеваемости и смертности, связанных с гриппом, является вакцинация. Лицензированные в настоящее время вакцины получают из выращенного в яйцах вируса и затем инактивированного. Вакцины включают в себя три вирусных штамма (два А штамма и один В штамм). Пригодны три типа вакцин: содержащие целый вирус, субвирион и очищенный поверхностный антиген. Только две последние применяют для детей из-за повышенных лихорадочных ответных реакций при использовании вакцины с целым вирусом. Детям моложе 9 лет требуются две иммунизации, тогда как взрослым нужна только однократная инъекция. Однако было высказано предположение [см. Medical Letter 32: 89-90, Sept. 17, 1993], что "больные, вакцинированные рано осенью, получают преимущества от второй дозы зимой или ранней весной", основанное на наблюдениях на пожилых больных. Титры антител после вакцинации могут снижаться до уровней ниже защитных в пределах четырех или менее месяцев. Эти вакцины готовят заново каждый год на основе прогнозирования, какой из новых вирусных штаммов будет клинически распространяться, и на основе оценки, какой из новых вирулентных штаммов ожидается преобладающим в наступающем сезоне гриппа. Рекомендуется ежегодная ревакцинация.
Недостатками лицензированной вакцины являются:
1) Антигенная изменчивость, в частности, в штаммах А гриппа приводит к появлению вирусов, которые не нейтрализуются антителами, выработанными под действием прежней вакцины или при предшествующей инфекции. Новые штаммы возникают в результате точковой мутации (антигенного дрейфа) и рекомбинации (антигенной изменчивости) генов, кодирующих поверхностные гликопротеины (гемагглютинин [НА] и нейраминидазу), тогда как внутренние белки являются высококонсервативными в штаммах с антигенным дрейфом и антигенной изменчивостью. Иммунизация вызывает "гомологический" штамм-специфический опосредованный антителами иммунитет, но не "гетерологичный", общий для групп иммунитет, основанный на опосредованном клеткой иммунитете.
2) Даже если преобладающие распространяющиеся штаммы вируса гриппа не обнаруживают значительных антигенного дрейфа или антигенной изменчивости от одного года к другому, иммунизацию следует проводить каждый год из-за снижения титров антител. Хотя некоторые исследователи сообщали, что ингибирующие гемагглюцинацию (HI) и нейтрализующие антитела сохраняются в течение месяцев - лет с последующим постепенным снижением, Консультативный Комитет по иммунизации считает снижение титров антител в течение следующего после вакцинации года достаточной причиной для ежегодной иммунизации, даже если не было большого антигенного дрейфа или антигенной изменчивости. (HI антитела ингибируют способность вируса гриппа агглютинировать эритроциты крови. Подобно нейтрализующим антителам, они первично направлены против антигена НА. Тесты ингибирования гемагглютинации легче и дешевле в проведении, чем тесты нейтрализации и, следовательно, их чаще применяют в качестве средства для оценки способности антител, выработанных против одного из штаммов вируса гриппа, реагировать с отличающимся штаммом.) Как упоминалось выше, Medical Letter предполагает, что определенные более старые индивидуумы с высоким риском заболевания должны вакцинироваться дважды в сезон вследствие короткоживущих защитных титров антител.
3) Эффективность вакцины является субоптимальной. Разработка вакцины для следующего сезона основана на прогнозировании ожидаемых распространяющихся штаммов (через дежурное выборочное исследование в Азии), прогнозирование может быть неточным и может привести к плохому соответствию между штаммами, применяемыми для вакцины, и штаммами, действительно распространяющимися в данном пространстве. Кроме того, как это произошло во время сезона гриппа 1992-1993 годов, новый штамм Н3N2 (A/Beijing/92) стал клинически выявляемым во время последней фазы этого сезона гриппа. Это потребовало быстрого изменения в составе вакцины 1993-1994 вследствие слабой перекрестной реактивности с A/Beijing/92 антител, индуцируемых прежним штаммом Н3N2 (A/Beijing/89), из-за антигенного дрейфа. Однако из-за длительного периода времени, необходимого для приготовления лицензированной в настоящее время вакцины, новый штамм вакцины не мог быть введен во время сезона 1992-1993 г., несмотря на доказательство плохой защиты при применении существующей тогда вакцины и увеличенной вирулентности нового распространяющегося штамма Н3N2.
Даже когда вакцина и распространяющиеся штаммы хорошо подходят друг другу, лицензированная вакцина предотвращает болезнь только у приблизительно 70% детей и молодежи и в 30-40% слабых старых людей. Поэтому используют другие критериидля доказательства эффективности вакцины, когда вакцинные штаммы соответствуют циркулирующим штаммам. Эти критерии включает в себя предотвращение тяжелого заболевания и вторичных осложнений, что отражается в предотвращении госпитализации (70% для пожилых людей, живущих дома, по сравнению с 50-60% пожилых, живущих в домах престарелых и инвалидов), и предотвращение смерти (80% для обитателей домов престарелых). Иммунитет населения для снижения распространения инфекции в доме престарелых рассматривается как еще одно преимущество иммунизации.
Характеристики идеальной универсальной вакцины против гриппа (цели изобретения)
1) Генерирование общей для всех групп (гетерологичной) защиты. Универсальная вакцина должна быть способна защищать против различных штаммов, например, в пределах подтипа Н3N2, и возможно даже в случае перекрестных подтипов, например от Н1N1 до Н3N2. Защита, вероятно, должна быть медиирована цитотоксическими Т-лимфоцитами (СТL), узнающими антигены из внутренних консервативных вирусных белков, хотя нейтрализующие антитела, направленные против консервативных частей мембрано-связанных белков, также могут играть роль.
2) Увеличенная широта ответной реакции в виде антител. Поскольку считают, что CTL играет роль в выздоровлении, вакцина на основе только CTL ответа, по-видимому, должна сокращать продолжительность заболевания (потенциально до превращения болезни в преклиническую (бессимптомную), но она не могла бы полностью предотвратить болезнь. Экспериментально было показано, что способ получения вакцины против гриппа при помощи пассажа в яйцах способен отбирать субпопуляции вируса с измененной НА антигенностью. В результате эффективность вакцины могла бы снижаться, поскольку антитела, индуцируемые этой вакциной, могут быть не вполне эффективными против преобладающего циркулирующего штамма. Поэтому хотелось бы получить антитела, имеющие улучшенную широту ответа по сравнению с имеющейся сейчас вакциной. Сезон гриппа 1992-1993 г. предоставил превосходной случай исследования недостатков существующей вакцины, заключающихся в том, что вакцина, которая использована A/Beijing/89, генерировала антитела, которые были слабореагирующими перекрестно (и менее защитными) против нового штамма A/Beijing/92, который был также более вирулентным. Оба штамма представляют собой Н3N2, т.е. принадлежат к одному и тому же подтипу. По аминокислотной последовательности, однако, A/Beijing/92-подобные штаммы отличаются от A/Beijing/89-подобных штаммов только 11 точковыми мутациями (положения 133, 135, 145, 156, 157, 186, 190, 191, 193, 226 и 262) в районе НАI. Неизвестно, повлиял ли существующий процесс изготовления вакцины на отсутствие перекрестной реактивности, но очевидно, что желательно улучшение в широте ответной реакции антител.
3) Увеличенная продолжительность ответной реакции в виде образования антител. Поскольку одной из групп, представляющих наибольшую опасность для заболеваемости и смертности от инфекции гриппом (пожилые люди), является также группа, в которой защитные титры антител могут снижаться слишком быстро для того, чтобы ежегодная иммунизация была эффективной, усовершенствованная вакцина должна генерировать защитные титры антител, сохраняющиеся более долго.
Полинуклеотиды в качестве вакцины
Было показано, что внутримышечная инокуляция полинуклеотидных конструкций, т. е. ДНК плазмид, кодирующих белки, приводит к образованию in situ данного белка в мышечных клетках. Путем применения кДНК-плазмид, кодирующих вирусные белки, генерировали ответную реакцию как в виде антител, так и в виде CTL, обеспечивая гомологическую и гетерологическую защиту против последующего заражения с гомологичной или перекрестной в отношении штаммов защитой соответственно. Каждый из этих типов иммунных реакций представляет потенциальное преимущество по сравнению с существующими стратегиями вакцинации. Применение полинуклеотидных вакцин (PNV) для образования антител может привести к увеличению продолжительности образования антител, а также к обеспечению антигена, который может иметь как точную последовательность клинически циркулирующего штамма вируса, так и правильные посттрансляционные модификации и конформацию нативного белка (по сравнению с рекомбинантным белком). Генерирование CTL-ответов этим способом предоставляет преимущества перекрестной в отношении штаммов защиты без необходимости применения живого патогенного вектора или ослабленного вируса.
Таким образом, основным стимулом к разработке вакцин против таких вирусов, как вирус гриппа, против которого генерируются нейтрализующие антитела, является разнообразие белков оболочки вируса среди различных изолятов или штаммов. Поскольку цитотоксические Т-лимфоциты (СТL) в мышах и в человеке способны узнавать эпитопы, происходящие из консервативных внутренних вирусных белков [J. W. Yewdell et al., Proc. Natl. Acad. Sci. (USA) 82, 1785 (1985); A.R.M. Townsend, et al., Cell 44, 959 (1986); A.J. McMichael et al., J. Gen. Virol. 67, 719 (1986); J. Bastin et al., J. Exp. Med. 165, 1508 (1987); A.R.M. Townsend and H. Bodmer, Annu. Rev. Immunol. 7, 601 (1989)], и считаются важными в иммунном ответе на вирусы [Y.-L. Lin and B.A. Askonas, J. Exp. Med. 154, 225 (1981); I. Gardner et al., Eur. J. Immunol. 4, 68 (1974); K.L. Yap and G.L. Ada, Nature 273, 238 (1978); A.J. McMichael et al. , New Engl. J. Med. 309, 13 (1983); P.M.Taylor and B.A. Askonas, 58, 417 (1986)], усилия были направлены на развитие СТL-вакцин, способных обеспечить гетерологичную защиту против различных вирусных штаммов.
CD8+ CTL убивают инфицированные вирусом клетки, когда их Т-клеточные рецепторы узнают вирусные пептиды, ассоциированные с молекулами МНС (главной системы тканевой совместимости) класса I [R.M. Zinkernagel and P.C. Doherty, ibid. 141, 1427 (1975); R.N. Germain, Nature 353-605 (1991)]. Эти пептиды получают из эндогенно синтезированных вирусных белков, независимо от локализации или функции белка внутри вируса. Поэтому путем узнавания эпитопов из консервативных вирусных белков СТL могут обеспечивать перекрестную в отношении штаммов защиту. Пептиды, способные к ассоциации с МНС класса I, узнаваемые СТL, происходят из белков, присутствующих в цитоплазме или эндоплазматическом ретикулуме или происходящих через них [J.W. Yewdell and J.R. Bennink, Science 244, 1072 (1989); A.R.M. Townsend et al., Nature 340, 443 (1989); J. G. Nuchtern et al., ibid. 339, 223 (1989]. Таким образом, экзогенные белки, вступающие в ядрышковый путь процессинга (как в случае антигенов, представленных молекулами МНС класса II), не являются эффективными в генерировании CD8+ CTL-ответных реакций.
Большинство попыток генерировать СТL-ответы использовали реплицирующиеся векторы для получения белкового антигена внутри клетки [J.R. Bennink et al., ibid. 311, 578 (1984); J.R. Bennink and J.W. Yewdell. Curr. Top. Mecrobiol. Immunol. 163, 153 (1990); C.K. Stover et al., Nature 351, 456 (1991); A. Aldovini and R.A. Young, Nature 351, 479 (1991); R. Schafer et al., J. Immunol. , 149, 53 (1992); C.S. Hahn et al., Proc. Natl. Acad. Sci. (USA) 89, 2679 (1992)] или они фокусировались на введении пептидов в цитозоль [F.R. Carbone and M.J. Bevan, J. Exp. Med. 169, 603 (1989); K. Deres et al., Nature 342, 561 (1989); H. Takahashi et al., ibid. 344, 873 (1990); D.S. Collins et al. , J. Immunol. 148, 3336 (1992); M.J. Newman et al., ibid. 148, 2357 (1992)]. Оба эти подхода имеют недостатки, которые могут уменьшить их применение для получения вакцин. Ретровирусные векторы имеют ограничения в отношении размера и структуры полипептидов, которые могут экспрессироваться в виде слитых белков с сохранением способности репликации рекомбинантного вируса [A. D. Miller, Curr. Top. Microbiol. Immunol. 158, 1 (1992)], и эффективность векторов, таких как вирус осповакцины, для последующих иммунизаций может быть ослаблена иммунными ответными реакциями против самих векторов [E. L. Cooney et al., Laucet 337, 567 (1991)]. Кроме того, вирусные векторы и модифицированные патогены сами по себе опасны, что может препятствовать их использованию в человеке [R.R. Redfield et al., New Engl. J. Med. 316, 673 (1987); L. Mascola et al., Arch. Intern. Med. 149, 1569 (1989)]. Кроме того, выбор пептидных эпитопов зависит от структуры МНС антигенов индивидуумов и, следовательно, пептидные вакцины могут иметь ограниченную эффективность вследствие разнообразия гаплотипов МНС в популяциях при аутбридинге.
Benvenisty, N. и Reshef, L. [IPNAS 83, 9551-9555 (1986)] показали, что осажденная CaCl2 ДНК, введенная в мышей интраперитонеально, внутривенно или внутримышечно, могла экспрессироваться. Было показано, что внутримышечная (i. m. ) инъекция экспрессирующих векторов ДНК в мышей приводит к поглощению ДНК мышечными клетками и экспрессии белка, кодируемой этой ДНК [J.A. Wolff et al., Science 247, 1465 (1990); G. Ascadi et al., Nature 352, 815 (1991)]. Было показано, что эти плазмиды сохранялись в эписомах и не реплицировались. Затем сохраняющаяся экспрессия наблюдалась после i.m. инъекции в скелетные мышцы крыс, рыбы и приматов и в сердечную мышцу крыс [H. Lin et al., Circulation 82, 2217 (1990); R.N. Kistis et al., Proc. Natl. Acad. Sci. (USA) 88, 4138 (1991), E. Hansen et al., FEBS Lett. 290, 73 (1991); S. Jiao et al., Hum. Gene Therapy 3, 21 (1992); J.A. Wolff et al., Human Mol. Genet. 1, 363 (1992)] . Способ применения нуклеиновых кислот в качестве терапевтических средств сообщался в WO 90/11092 (4 октября 1990), в котором для вакцинации позвоночных животных использовали одни полинуклеотиды.
Для успеха способа необязательно, чтобы иммунизация была внутримышечной. Так, Tang et al. [Nature, 356, 152-154 (1992)] обнаружили, что введение золотых микроснарядов, покрытых ДНК, кодирующей бычий гормон роста (BGH), в кожу мышей приводило к образованию антител против BGH в мышах. Turth et al. [Analytical Biochemistry, 205, 365-368 (1992)] показали, что можно было бы использовать струйный инжектор для трансфекции мышечных, жировых тканей и тканей молочной железы живых животных. Обзор различных способов введения нуклеиновых кислот сделан недавно Friedman, T. [Science, 244, 1275-1281 (1989)] . Смотри также Robinson et al., Abstracts of Papers Presented at the 1992 Meeting of Modern Approaches to New Vaccines, Including Prevention of AIDS, Cold Spring Harbor, p. 92, где утверждается, что внутримышечное, внутрибрюшинное и внутривенное введение ДНК вируса гриппа птиц обеспечивало защиту против летальной инфекции. Однако не было указаний о том, гены какой вируса птичьего гриппа были использованы. Кроме того, говорилось только о Н7-специфических ответных реакциях без упоминания об индуцировании перекрестной в отношении разных штаммов защиты.
Таким образом, данное изобретение рассматривает любые из известных способов введения нуклеиновых кислот в живые ткани для индуцирования экспрессии белков. Данное изобретение обеспечивает способ введения вирусных белков в путь процессинга антигена для генерирования вирус-специфических CTL. Данное изобретение удовлетворяет потребность в специфических терапевтических средствах, способных вызывать желаемые профилактические иммунные реакции против вирусных патогенов (для вируса гриппа). Особенно важна в этом терапевтическом подходе возможность индуцирования Т-клеточных иммунных реакций, которые могут предотвращать инфекции даже в том случае, когда вирусные штаммы гетерологичны относительно штамма, из которого получен ген антигена. Таким образом, данное изобретение обеспечивает конструкции ДНК, кодирующие вирусные белки вируса гриппа человека; нуклеопротеин (NP), гемагглютинин (НА), нейраминидазу (NM), матричный белок (М), неструктивный белок (NS), полимеразу (PB1 и РВ2 - основные полимеразы 1 и 2; РА - кислую полимеразу) или любые другие гены вируса гриппа, кодирующие продукты, которые генерируют специфические CTL.
Вирус гриппа имеет РНК-геном, состоящий из множественных сегментов РНК (рибонуклеиновой кислоты). Каждая РНК кодирует по меньшей мере один генный продукт. Продукт гена NP связывается с РНК и переносит вирусные РНК в ядро инфицированной клетки. Эта последовательность является консервативной, только приблизительно 7% дивергенции аминокислотной последовательности возникает в течение периода 50 лет. Продукты гена Р (PB1, РВ2, РА) ответственны за синтез новых вирусных РНК. Эти гены даже более консервативны, чем ген NP. НА является основным генным продуктом оболочки вируса. Он менее высоко консервативен, чем NP. Он связывает клеточный рецептор и, следовательно, участвует в инициации новых инфекций гриппом. Основная нейтрализующая реакция антител направлена против этого генного продукта. Основной ответ цитотоксических Т-лимфоцитов (СТL) также направлен против этого белка. Существующие вакцины против гриппа человека включают в себя три штамма вируса гриппа или их НА белки. Однако вследствие вариабельности в белковой последовательности НА в различных штаммах эта вакцина должна постоянно подгоняться к штаммам, которые в данный момент вызывают патологию. Однако НА действительно имеет некоторые консервативные элементы для генерирования CTL, если он предоставлен должным образом. Продукты генов NS1 и NS2 имеют не полностью охарактеризованные биологические функции, но они могут иметь значение в образовании защитных CTL-ответных реакций. Наконец, генные продукты М1 и М2, которые несколько более консервативны, чем НА, индуцируют основной CTL-ответ. М1 белок является очень обильным по массе продуктом вирусного гена.
Защитная эффективность вакцинации ДНК против последующего вирусного заражения демонстрируется иммунизацией нереплицирующейся плазмидной ДНК, кодирующей один или несколько вышеупомянутых вирусных белков. Это является преимуществом, так как в вакцинации не участвует инфекционный агент, не требуется сборки вирусных частиц и возможна селекция антигенных детерминант. Кроме того, так как последовательность нуклеопротеина и некоторых других продуктов вирусных генов консервативна и имеется в многочисленных штаммах гриппа, защита против последующих заражений вирулентным штаммом вируса гриппа, гомологичным или гетерологичным по отношению к штамму, из которого получен клонированный ген, является возможной.
Конструкции ДНК, способные экспрессироваться при прямом введении, инъекцией или другим способом в ткани животных, представляют собой новые профилактические фармацевтические препараты. Они индуцируют цитотоксические Т-лимфоциты (CTL), специфические для вирусных антигенов и отвечающие на различные штаммы вируса, в отличие от антител, которые, как правило, штамм-специфичны. Генерирование таких СТL in vivo обычно требует эндогенной экспрессии антигена, как в случае вирусной инфекции. Для генерирования вирусного антигена для предоставления его иммунной системе, без недостатков прямой доставки пептида или применения вирусных векторов, плазмидную ДНК, кодирующую белки вируса гриппа человека, инъецировали в четырехглавую мышцу BALB/с мышей, это приводило к генерированию специфических для вируса гриппа CTL и защите от последующего заражения гетерологичным штаммом вируса гриппа, как было измерено, уменьшенным вирусным титром в легких, ингибированием потери веса и повышенным выживанием. Высокий титр нейтрализующих антител к гемагглютинину и антител к нуклеопротеину был обнаружен у макаки-резуса и уменьшенные титры вируса в носу наблюдали после гомологичного и гетерологичного заражения у африканских хорьков. Основные наблюдения, относящиеся к нашему изобретению, включают в себя:
1) Демонстрацию эффективности. Гетерологичная защита наблюдается после иммунизации ДНК нуклеопротеина (NP), измеренная по повышенному выживанию, пониженным вирусным титрам в легких и ингибированию потери веса в мышах, заражаемых штаммом вируса гриппа, отличающимся от источника штамма для гена NP. В этом случае поверхностные белки двух штаммов были совершенно различными (H1N1 vs. H3N2) и штамм для заражения возник через 34 года после исходного штамма. Иммунизация хорьков ДНК NP и ДНК матрикса (М1) по отдельности, вместе или в комбинации с ДНК НА обеспечила защиту (уменьшенное назальное выделение вируса) против заражения штаммом с антигенным дрейфом (клинический изолят).
Защита коктейлем ДНК (ДНК NP и М1, кодирующая белки Beijing/89, и ДНК НА, кодирующая либо Beijing/89, либо Hawaii/91) была заметно выше против штамма с антигенным дрейфом, чем даваемая лицензированной вакциной, содержащей Beijing/89, у хорьков. Смесь (коктейль), содержащая ДНК НА из Hawaii/91, по-видимому, была несколько более эффективной, чем смесь, содержащая ДНК НА из Beijing/89. Защита, обнаруживаемая с коктейлем, содержащим ДНК НА для Hawaii/91, приводила к защите, идентичной защите, наблюдаемой с гомологичной ДНК НА (Georgia/93), тогда как коктейль с ДНК НА для Beijing/89 отличался от гомологичной защиты, хотя все еще был значительно лучше, чем лицензированный продукт. Антитела к Н1 образовались во всех видах, в том числе в мышах, хорьках, макаках-резусах и Африканских зеленых мартышках.
2) Постоянство. В исследованиях с применением ДНК, кодирующей репортерный ген, присутствие ДНК и экспрессия белка сохранялись по меньшей мере в течение 1,5 года (самое продолжительное время, тестированное в мышах; Wolff et al., Human Mol. Genet., 1992). Таким образом, если генные продукты вируса гриппа также экспрессировались постоянно, то полученная реакция также должна была сохраняться. Было показано, что антитела и CTL (Yankauckas et al., DNA and Cell Biol., 1993) и гомологичный защитный иммунитет (данные МRL), генерированные инъекцией ДНК вируса гриппа, сохранялись в течение более 1 года в мышах. Было показано, что антитела сохранялись в макаке-резусе в течение по меньшей мере 1 года. Ответные CTL реакции и гетерологичная защита (увеличенное выживание) сохранялись до 6 месяцев (самая дальняя точка, тестированная до тех пор). Небольшое снижение степени гетерологичной защиты наблюдалось, но защита может быть усилена (повторной иммунизацией).
3) Диапазон доз. Исследования требуемых доз, проводимые на макаках-резусах, показали, что доза 100 мкг ДНК НА, даваемая два раза, приводила к хорошим титрам Н1 антител, которые сохранялись пока до одного года. Образование защиты (повышенное выживание после гетерологичного заражения) наблюдали с дозами такими низкими, как 6 мкг (даваемыми 3 раза), и с однократной инъекцией 200 мкг, но обычно увеличенное число инъекций (до трех) улучшало степень защиты. Исследования на приматах обнаружили, что 2 инъекции 10 или 100 мкг ДНК, кодирующей 3 НА и NP и М1 (последняя - кодирует генные продукты H3N2 Beijing/89), приводили к титрам Н1 антител, таким же, какие генерируются лицензированной вакциной. Важно помнить, что все исследованные животные не подвергались действию вируса гриппа, тогда как клиническая популяция (более старые индивидуумы) все перенесли грипп. (Вспомните, что детям до 9 лет давали 2 инъекции лицензированной вакцины).
Краткое описание чертежей
Фиг. 1. Обнаружение плазмидной ДНК NP в мышцах при помощи PCR. Мышей инъецировали три раза с интервалами в три недели ДНК NP RSV или пустым вектором (100 мкг на ногу) в обе четырехглавые мышцы BALB/с мышей с последующим заражением гриппом. Мышцы удаляли спустя 4 недели после конечной инъекции и сразу же замораживали в жидком азоте. Затем их пульверизировали в буфере для лизиса (25 мМ Трис-Н3РО4, рН 8, 2 мМ транс-1:2-диаминоциклогексан-тетрауксусная кислота (СДТА), 23 мМ ДТТ, 10% глицерин, 1% Тритон Х-100) в MIKRODISMEMBRATORТМ (B. Braun Instruments) и высокомолекулярную ДНК экстрагировали смесью фенол/хлороформ и осаждали этанолом. Реакцию PCR из 40 циклов проводили согласно инструкциям в ките (наборе) Perkin Elmer Cetus GENEAMPТМ для детектирования присутствия плазмиды ДНК NP в мышце. Продукт PCR из 772 п.н. (см. головку стрелки), простирающийся от промотора CMV через большую часть 5'-района встроенного гена NP, получали из смыслового олигонуклеотида из 18 п. н. , примированного в промоторном районе (GTGTGCACCTCAAGCTGG, SEQ.ID:1) и олигонуклеотидного антисмыслового праймера из 23 п.н. в 5'-части встроенной последовательности NP (CCCTTTGAGAATGTTGCACATTC, SEQ.ID:2:). Продукт 772 п.н. виден на окрашенном бромидом этидия агарозном геле в выбранных инъекцированных ДНК NP мышечных пробах, но не в контроле (пустой вектор) (600 L). Метки над каждой дорожкой указывают идентификационный номер мыши и правую или левую ногу.
Фиг.2. Получение NP антител в мышах, инъецированных ДНК NP. Мышей инъецировали 100 мкг ДНК V1 - NP в каждую ногу при 0, 3 и 6 неделях и кровь извлекали при 2, 5 и 8 неделях. Присутствие анти-NP IgG в сыворотке определяли при помощи ELISA (J.J. Donnelly et al., J. Immunol., 145, 3071 (1990)) с применением NP, очищенного из клеток насекомых, которые были трансфицированы экспрессирующим бакуловирусным вектором. Результаты нанесены на график как средний log 10 титр ELISA ± SEM (n=10) в зависимости от времени после первой инъекции ДНК NP. Мыши, иммунизированные пустым вектором, не генерировали детектируемых NP антител.
Фиг. 3. Процент специфического лизиса, определяемого в 4-часовом тесте высвобождения 51Сr, для СТL, полученных из мышей, иммунизированных ДНК. Мыши были иммунизированы 400 мкг ДНК V1 - NP (сплошные кружки) или пустым вектором (сплошные квадратики) и убивали их спустя 3-4 недели. Отрицательные контроли СТL получали из незаражаемой мыши (белые треугольники) и положительные контроли из мыши, которая выздоровела после инфекции А/НК/68 раньше на 4 недели (сплошные треугольники). Графики изображают данные из репрезентативных отдельных мышей. По меньшей мере 8 мышей исследовали для каждой серии условий.
Панель А: Клетки селезенки, повторно стимулированные NP147-155-импульсно-мечеными аутологичными клетками селезенки, тестировали против NP147-155-импульсно-меченых Р815 клеток.
Панель В: Клетки селезенки, повторно стимулировали NP147-155-импулсно-мечеными аутологичными клетками селезенки и тестировали против мишеней Р815, инфицированных вирусом А/Victoria/73 (H3N2) в течение 6 часов перед добавлением СТL.
Панель С: Клетки селезенки повторно стимулировали Соn А и IL-2 без дополнительного антигена и тестировали против Р815 клеток, импульсно меченных NP147-155.
Панель D: Мышей инъецировали 200 мкг на одну инъекцию ДНК V1 - NP или пустым вектором 3 раза с 3-недельными интервалами. Селезенки собирали спустя 4 недели после последней иммунизации, клетки селезенки культивировали с IL-2 и Con A в течение 7 дней и СТL определяли против клеток-мишеней Р815, инфицированных А/Victoria/73.
Фиг. 4. Потеря массы (в граммах) и выздоровление в иммунизированных ДНК мышей после интраназального (без наркоза) заражения с применением 104 TCID50 А/НК/68. Мышей иммунизировали три раза с 3-недельными интервалами ДНК V1 - NP или пустым вектором или не инъецировали и заражали через 3 недели после последней иммунизации. Массы для групп из 10 мышей определяли во время заражения и ежедневно, начиная с 4-го дня, для инъецированных ДНК NP мышей (сплошные кружки), контролей (пустые векторы) (белые треугольники) и неинъецированных мышей (контролей) (белые кружки). Представлены средние массы ± SEM. Инъецированные ДНК NP мыши обнаружили гораздо меньшую потерю массы на 8-13 дни, чем инъецированные пустым вектором мыши (р≤0,005) и неинъецированные мыши (р≤0,01), как показал t-тест. Не было значительной разницы между двумя контролями (р=0,8 согласно t-тесту).
Фиг. 5. Выживание иммунизированных ДНК мышей после интраназального заражения (под наркозом) 102,5 ТСID50 А/НК/68. Мышей, иммунизированных три раза с 3-недельными интервалами ДНК V1 - NP (сплошные кружки) или пустыми векторами (белые кружки), и неинъецированные контроли (белые треугольники) заражали через три недели после последней иммунизации. Процент выживания показан для групп из 9 или 10 мышей. Выживание инъецированных ДНК NP мышей была значительно выше, чем контролей (р=0,0004 согласно Сhi-sguare анализу), тогда как между инъецированными пустым вектором и неинъецированными мышами не наблюдали значительного различия (р=0,1) согласно Chi-sguare анализу).
Фиг.6. Последовательность экспрессирующего вектора VIJ, SEQ.ID:10:.
Фиг.7. Последовательность экспрессирующего вектора VIJneo, SEQ.ID:18:.
Фиг. 8. Последовательность промотор-терминаторной последовательности СМVintA-B H, SEQ.ID:11.
Фиг.9 (А, В). Анти-NP антитела мартышек.
Фиг.10. Ингибирование гемагглютинации у хорьков с пунктирной линией, указывающей минимальный защитный титр антител, и средней величиной, обозначенной кружком с проходящей через него линией.
Фиг.11. Анти-NP IgG антитела в хорьках после иммунизации ДНК.
Фиг. 12 (А, В). Выделение вируса гриппа в хорьках с иммунизацией ДНК и без иммунизации ДНК.
Фиг. 13. Диаграмма векторов p RSV-PR-NP и V1-NP, Х обозначает встроенный кодирующий район.
Фиг.14 (А, В). Схематическое изображение белков и штаммов гриппа.
Фиг. 15. Схематическое изображение процессинга инъецированной ДНК внутри клетки.
Фиг. 16. Устойчивость хорьков к штамму А/PR/8/34 гриппа, индуцированная иммунизацией генами НА и внутренних белков.
Фиг.17. Схематическое изображение вектора VIJns.
Фиг. 18. Африканских зеленых мартышек инъецировали смесью ДНК, состоящей из НА ДНК (А/Beijing/89, B/Panama/90, A/Texas/91, NP ДНК (A/PR/34) и М1 ДНК (A/PR/34). Каждый компонент был в количестве либо 10 мкг (сплошные квадраты), либо 100 мкг (сплошные кружки), вводимых дважды с 6-недельным интервалом (см. стрелки). Для сравнения других животных инъецировали лицензированными вакцинами с субвирионом (белые квадраты) или целым вирионом (белые кружки) при полной дозе, применяемой для человека (45 мкг белковый эквивалент; 15 мкг на НА). Пробы сыворотки брали каждые две недели в течение 18 недель и анализировали на Н1 титр против А/Beijing/89 НА. Данные выражали в виде геометрического среднего титра Н1±SEM, где n=3.
Фиг. 19. Самок ВАLВ/с мышей (4-6-недельных) инъецировали ДНК А/PR/34 NP (200 мкг) три раза с 3-недельными интервалами. Отрицательные контроли включали в себя мышей, инъецированных контрольной ДНК (200 мкг), рекомбинантным белком NP (10 мкг), и неинъецированных мышей (ложный контроль). Для сравнения тестировали также мышей, инфицированных вирусом гриппа А/НК/68 (flu). CTL получали через 6 месяцев после первой дозы и их рестимулировали in vitro инфицированными вирусом сингенными клетками селезенки и тестировали против NP пептидом импульсно-меченых Р815 клеток при отношении эффектор:мишень 10:1. Данные обозначают % специфического лизиса ±Sd, где n=3.
Фиг. 20. С3Н/НеN мышей инъецировали нормальными С2С12 миобластами (1•107 клеток), рекомбинантным белком NP (2 мкг) или NP-трансфицированными миобластами (1•107 клеток). Это количество NP белка (2 мкг) было достаточным для генерирования ответной реакции в виде образования антител и было эквивалентным приблизительно в 100 раз большему количеству NP, присутствующему в трансплантированных NP-трансфицированных миобластах. CTL получали из этих мышей через 6 недель после обработки и рестимулировали in vitro инфицированными вирусом гриппа сингенными клетками селезенки. В качестве положительного контроля получали CTL из мышей, которые были инфицированы вирусом гриппа A/HK/68. Необработанные (сплошные столбики), инфицированные вирусом гриппа A/Victoria/73 (полосатые столбики) и NP-трансфицированные (заштрихованные столбики) миобласты применяли в качестве клеток-мишеней при отношении эффектор:мишень 25:1. Данные представлены как % специфического лизиса ±Sd, где n=3.
Фиг. 21. 4-недельных самок BALB/с мышей иммунизировали внутримышечно 200 мкг ДНК NP трижды с 3-недельными интервалами. Мышей заражали через 3 недели после третьей иммунизации 300 TCID50 А/НК/68, вводимыми под наркозом (заражение всех дыхательных путей). Процент выживших мышей (10 мышей на группу) нанесен на график в зависимости от времени после заражения.
Фиг. 22. 4-недельных самок BALB/с мышей иммунизировали внутримышечно 100 мкг ДНК NP трижды при 3-недельных интервалах. Мышей заражали через 3 недели после третьей иммунизации 300 TCID50 А/НК/68, вводимыми под наркозом (общее заражение дыхательных путей). Мышей взвешивали 1 раз в день и процент от исходного веса рассчитывали для каждой выжившей мыши. Средний % от исходных весов наносили на график ±SEM в зависимости от времени после заражения.
Фиг. 23. 4-недельных самок BALB/с мышей иммунизировали внутримышечно 200 мкг ДНК NP трижды при 3-недельных интервалах. Мышей заражали через 3 недели после третьей иммунизации 2000 TCID50 А/НК/68, вводимыми под наркозом (заражение верхних дыхательных путей). Мышей убивали через 7 дней после заражения, легкие извлекали и гомогенизировали и определяли титры вируса серийным титрованием на клетках MDCK.
Фиг. 24. 4-недельных самок BALB/с мышей иммунизировали внутримышечно 6,25, 25, 100 или 200 мкг ДНК NP трижды с 3-недельными интервалами. Мышей заражали через 3 недели после третьей иммунизации 300 TCID50 А/НК/68, вводимыми под наркозом (общее заражение дыхательных путей). Процент выживших мышей (10 мышей на группу) наносили на график в зависимости от времени после заражения.
Фиг.25. 4-недельных самок BALB/с мышей иммунизировали внутримышечно трижды с 3-недельными интервалами 200 мкг A/PR/34 ДНК NP, контрольный ДНК или ложно инъецировали. Затем мышей заражали 300 TCID50 А/НК/68 под наркозом через 6, 12 и 25 недель после третьей инъекции ДНК. Выбранных мышей реиммунизировали 200 мкг ДНК NP при 22-ой неделе и затем заражали на 25-ой неделе ("реиммунизация"). Средние массы представлены в виде процентов от исходной общей массы для каждой группы. Контрольная масса является средним из масс всех контрольных групп из 6, 12 и 25-недельных заражений, всего 6 групп, получавших контрольную ДНК или ложную инъекцию. Группы исходно содержали по 10 животных; мышей исключали из дальнейшего анализа массы после смерти.
Фиг. 26. Взрослых самцов хорьков (22-28-недельных) иммунизировали внутримышечно 1 мг ДНК, кодирующей NP из A/Beijing/89, 1 мг ДНК, кодирующей М1 из A/Beijing/89 или 1 мг этих объединенных ДНК в дни 0-й и 42-й. Контрольные хорьки получали некодирующую ДНК или полную дозу, применяемую для человека (15 мкг/штамм), лицензированной вакцины целого вируса гриппа (препарат 92-93 г.), содержащей A/Beijing/89, в дни 0-й и 42-й. Хорьков заражали A/Georgia/93 на 5-ый день. Выделение вируса в назальных промывках определяли, как описано выше. Выделение вируса на 3 - 5-й дни сравнивали с выделением в хорьках, которым давали контрольную ДНК, при помощи двухфакторного дисперсионного анализа. Выделение вируса в хорьках, которым давали ДНК NP, ДНК М1 или ДНК NP + М1, было значительно ниже (р<0,0001, 0,0016 и 0,0001 соответственно), чем выделение вируса в контрольных хорьках. Выделение в хорьках, получавших NP (данные не представлены), М1 или NP + М1, незначительно отличалось от выделения в хорьках, получавших лицензированную вакцину (р= 0,104, 0,533 и 0,145 соответственно). Доза иммунизации 1 мг была выбрана произвольно; исследования диапазона доз проводили на приматах.
Фиг. 27. Группы из 8 22-25-недельных самцов хорьков иммунизировали внутримышечно контрольной ДНК, солевым раствором или ДНК, кодирующей белки А/PR/8/34 гриппа в дни 0-й, 21-й; 121-й и заражали интраназально 200 TCID50 A/PR/8/34 на 148-й день. Иммунизированные животные получали 1 мг ДНК NP или 2 мг ДНК NP, NS1, PB1, PB2 и М1 в комбинации (400 мкг каждой конструкции). Контроли получали 0,5 мл на ногу солевого раствора или 1 мг контрольной ДНК. Для целей анализа группы, получившие солевой раствор и контрольную ДНК, были объединены (контроль), так же как и группы, получившие только ДНК NP или эту ДНК в сочетании с генами других внутренних белков (внутренние белки). График показывает инфекционные титры назальных промывок в ТСID50 на 50 мкл 3-миллилитрового объема жидкости назальной промывки. Предполагается, что неразведенная промывная жидкость (тестировали самое малое разведение) имела разведение 1: 10 от исходного назального экссудата и положительная неразведенная проба была принята за величину 1 log. Титры выше 1 log были определены на основе интерполяции Рида Мюнха из трех повторностей, давая конечную точку инфекционности 50%. Пробы, которые были отрицательными при тестировании в неразведенном виде, имели величину 0 log. Величины для р, показанные на графике, рассчитывают для иммунизированных хорьков против контролей на указанные дни при помощи Т-теста для двух средних. Величины для р для целых кривых рассчитывали двухфакторным дисперсионным анализом и они были менее 0,0001 для NP против контроля и менее 0,001 для объединенных ДНК против контроля.
Фиг.28. Выживание мышей, иммунизированных ДНК и затем зараженных вирусом гриппа. Мышей инъецировали внутримышечно 200 мкг ДНК, кодирующей НА из A/PR/34, или контрольной (некодирующей) ДНК три раза с 3-недельными интервалами. Через 3 недели после последней иммунизации мышей заражали общим заражением дыхательных путей (интраназальным закапыванием под наркозом) 1000 ТСID50 A/PR/34. Данные строили в виде графика в виде % выживания в зависимости от времени после заражения (n=9 или 10 мышей на группу).
Фиг. 29. Потеря массы у мышей, иммунизированных ДНК и затем зараженных вирусом гриппа. Мышей инъецировали внутримышечно 200 мкг ДНК, кодирующей НА из A/PR/34 или контрольной (некодирующей) ДНК трижды с 3-недельными интервалами. Через 3 недели после конечной иммунизации проводили общее заражение дыхательных путей (интраназальным закапыванием при анестезии) 1000 ТСID50 A/PR/34. Данные наносили на график в виде % от исходной массы для каждого отдельного животного, усредняя для каждой группы, в зависимости от времени (умерших животных исключали из средних значений).
Фиг.30. Выживание мышей, иммунизированных ДНК и затем зараженных вирусом гриппа. Мышей инъецировали внутримышечно 1, 10 или 100 мкг ДНК, кодирующей НА из A/PR/34 или контрольной (некодирующей) ДНК трижды с 3-недельными интервалами. Через 3 недели после конечной иммунизации проводили общее заражение дыхательных путей (интраназальным закапыванием при анестезии) 1000 ТСID50 A/PR/34. Данные наносили на график в виде % выживания в зависимости от времени после заражения (n=9 или 10 мышей на группу).
Фиг. 31. Группы из 8 22-25-недельных самцов хорьков иммунизировали внутримышечно контрольной ДНК, солевым раствором или ДНК, кодирующей белки вируса гриппа А/PR/8/34 в дни 0-й, 21-й и 121-й и заражали интраназально 200 TCID50 A/PR/8/34 на 148-й день. Иммунизированные животные получали 1 мг ДНК НА или 2 мг ДНК НА, NP, NS1, PB1, PB2 и М1 в комбинации (330 мкг каждой конструкции). Контроли получали 0,5 мл на ногу солевого раствора или 1 мг контрольной ДНК. Для анализа группы, получившие солевой раствор и контрольную ДНК, объединяли (Контроль), так же как группы, получавшие только ДНК НА или эту ДНК в комбинации с другими генами внутренних белков (НА, НА+ ДНК внутренних белков). График показывает инфекционные титры назальных промывок в ТСID50 на 50 мкл из объема 3 мл назальной промывной жидкости. Предполагалось, что неразбавленная промывная жидкость (самое низкое испытанное разведение) имело разведение 1:10 исходного назального экссудата и положительная неразведенная проба была взята как величина 1 log. Титры выше 1 log были определены на основе интерполяции Рида-Мюнха из трех повторностей и дали конечную точку инфекционности 50%. Пробы, которые были отрицательны при тестировании в неразведенном виде, имели величину 0 log. Величины для р для целых кривых рассчитывали двухфакторным дисперсионным анализом и они были менее 0,0001 для НА против контроля и менее 0,0001 для комбинированных ДНК против контроля.
Фиг.32. Взрослых (22-28-недельных) самцов хорьков иммунизировали внутримышечно 1 мг ДНК, кодирующей HA на А/Georgia/93 в дни 0-й и 42-й. Контрольные хорьки получали некодирующую ДНК или полную дозу, применяемую для человека (15 мкг/штамм), лицензированной вакцины гриппа, содержащей целый вирус (препарат 92-93 г.), содержащей A/Beijing/89, в 0-й и 42-й дни. Хорьков заражали A/Georgia/93 на 56-й день. Выделение вируса в назальных промывках определяли, как описано выше. Выделение вируса на 1-6 дни сравнивали с выделением в хорьках, получавших контрольную ДНК, при помощи двухфакторного дисперсионного анализа. Выделение вируса в хорьках, получавших ДНК НА, было значительно ниже (р < 0,0001), чем выделение в контрольных хорьках.
Фиг. 33. Взрослых (22-28-недельных) самцов хорьков иммунизировали внутримышечно 1 мг ДНК, кодирующей НА из А/Hawaii/91 или A/Beijing/89 (данные не показаны) в 0-й и 42-й дни. Контрольные хорьки получали некодирующую ДНК или полную применяемую для человека дозу (15 мкг/штамм) лицензированной, содержащей целый вирус вакцины гриппа (препарат 92-93 г. ), содержащей A/Beijing/89, на 0-й и 42-й дни. Хорьков заражали A/Georgia/93 на 56-й день. Выделение вируса в назальных промывках определяли, как описано выше. Выделение вируса на 1-6 дни сравнивали с выделением в хорьках, получавших контрольную ДНК, при помощи двухфакторного дисперсионного анализа. Выделение в хорьках, получавших ДНК НА А/Hawaii/91, было значительно ниже (р < 0,0001), чем выделение в контрольных хорьках. Выделение в хорьках, получавших ДНК НА А/Hawaii/91, было значительно ниже, чем выделение в хорьках, получавших лицензированный продукт (р=0,021 для А/Hawaii/91 ДНК НА; двухфакторный ANOVA для 1-6 дней); выделение в хорьках, получавших А/Beijing/89 ДНК НА (данные не представлены), не отличалось от выделения в хорьках, получавших лицензированный продукт (р=0,058; двухфакторный ANOVA для 1-6 дней).
Фиг.34. Взрослых (22-28-недельных) самцов хорьков иммунизировали внутримышечно 1 мг ДНК, кодирующей НА из А/Hawaii/91 (см. фиг.13), или 330 мкг каждой из ДНК, кодирующих НА из А/Hawaii/91 и NP и М1 из A/Beijing/89, на 0-й и 42-й дни. Контрольные хорьки получали некодирующую ДНК или полную применяемую для человека дозу (15 мкг/штамм) лицензированной вакцины, содержащей целый вирус гриппа (препарат 92-93 г.), содержащей A/Beijing/89, в 0-й и 42-й дни. Хорьков заражали A/Georgia/93 на 56-й день. Выделение вируса в назальных промывках определяли, как описано выше. Выделение вируса на 1-6 дни сравнивали с выделением в хорьках, получавших контрольную ДНК, при помощи двухфакторного дисперсионного анализа. Выделение в хорьках, получавших ДНК НА+NP+М1, было значительно ниже чем выделение в хорьках, получавших лицензированную вакцину (р менее 0,0001) или только ДНК НА (р=0,0053).
Фиг.35. Взрослых (22-28-недельных) самцов хорьков иммунизировали внутримышечно 1 мг ДНК, кодирующей НА из A/Georgia/93, или 330 мкг каждой ДНК, кодирующей НА из А/Hawaii/91, и NP и М1 из A/Beijing/89, в 0-й и 42-й дни.
Контрольные хорьки получали некодирующую ДНК или полную применяемую для человека дозу (15 мкг/штамм) лицензированной вакцины, содержащей целый вирус гриппа (препарат 92-93 г.), содержащей A/Beijing/89, в 0-й и 42-й дни. Хорьков заражали A/Georgia/93 на 56-й день. Выделение вируса в назальных промывках определяли, как описано выше. Выделение вируса на 1-6 дни сравнивали с выделением в хорьках, получавших контрольную ДНК, при помощи двухфакторного дисперсионного анализа. Выделение в хорьках, получавших ДНК НА+NP+М1, не отличалось значительно от выделения вируса в хорьках, получавших гомологичную ДНК НА (р=0,064).
Фиг.36. Последовательность VIR.
Детальное описание изобретения
Данное изобретение обеспечивает содержащие нуклеиновую кислоту фармацевтические препараты, которые при прямом введении в животное, в том числе в позвоночное животное, такое как млекопитающие и человек, индуцирует экспрессию кодируемых белков внутри этого животного. Если таким белком является белок, не встречающийся в норме в этом животном, за исключением патологических состояний, такой как белки, связанные с вирусом гриппа, например (но не только), нуклеопротеин вируса гриппа, нейраминидаза, гемагглютинин, полимераза, матричные или неструктурные белки, то иммунная система животного активируется для запуска защитной реакции. Поскольку эти экзогенные белки продуцируются собственными тканями животного, экспрессируемые белки процессируются и предоставляются главным комплексом гистосовместимости, МНС. Это узнавание аналогично узнаванию, которое происходит при истинной инфекции соответствующим организмом. Результатом, как показано в этой заявке, является индукция иммунного ответа, который защищает против вирулентной инфекции.
Данное изобретение обеспечивает нуклеиновые кислоты, которые при введении в ткани животных in vivo, инъекцией, ингаляцией или восприятием при помощи аналогичного механизма (см. предпосылки изобретения выше), индуцируют экспрессию генных продуктов вируса гриппа человека. Так, например, инъекция конструкций ДНК данного изобретения в мышцы мышей индуцирует экспрессию кодируемых генных продуктов. То же самое происходит в хорьках и макаках-резусах. При последующем заражении вирулентным вирусом гриппа с применением доз, неизменно убивающих контрольных животных, животные, инъецированные полинуклеотидной вакциной, обнаруживают значительно пониженную заболеваемость и смертность. Таким образом, это изобретение описывает вакцину, применимую для человека для предотвращения инфекций вирусом гриппа.
Мы показали, что конструкции ДНК, кодирующие белки вируса гриппа, вызывают защитные иммунные реакции в животных. Как будет описано более детально ниже, иммунные ответные реакции в животных включали в себя генерирование антител и CTL в мышах, генерирование антител в хорьках и приматах и защиту от вирусного заражения в мышах и хорьках гомологичными, имеющими антигенный дрейф и антигенную изменчивость штамма гриппа. Возможно, наиболее поразительным результатом иммунизации ДНК, кодирующей вирусные белки, была способность создавать защиту против отличающихся подтипов вируса. Это предполагает, что добавление индуцирующего СТL компонента к вакцине должно способствовать ослаблению действия новых разновидностей, которые возникают в середине сезона или являются непредвиденными при выборе вакционных штаммов каждый год для следующего года. Важно то, что иммунизация векторами к ДНК, кодирующими гены НА, NP и М1, была способна защищать более эффективно против штамма с антигенным дрейфом в хорьках, чем лицензированная вакцина. Это оправдывает использование конструкций, кодирующих внутренние гены, в РNV.
В одном варианте вакцинный продукт будет состоять из отдельных плазмид ДНК, кодирующих, например, НА из 3 широко распространенных клинических штаммов, представляющих вирусы А/H1N1 (A/Texas/91), N/H3N2 (A/Georgia/93) и B (B/Panama/90), а также конструкций ДНК, кодирующих внутренние консервативные белки NP и М1 (матричный белок) из А (Beijing/89; H3N2) и В штаммов, для обеспечения общей для группы защиты против антигенов, подвергшихся дрейфу и изменчивости. ДНК НА будут функционировать, обеспечивая НА и приводя к образованию нейтрализующих антител против НА. Они будут специфическими для типа с несколько увеличенной широтой защиты против штамма с антигенным дрейфом по сравнению с существующей лицензированной вакциной на основе белка. Конструкции ДНК для NP и М1 будут приводить к образованию CTL, которые будут обеспечивать перекрестную в отношении штаммов защиту с потенциально более низкими вирусными нагрузками и ускорением выздоровления. Ожидается, что сохраняемость конструкций ДНК (в эписомальной, нереплицирующейся, неинтегрированной форме в мышечных клетках) обеспечит увеличенную продолжительность защиты по сравнению с существующей вакциной.
Ожидаемые преимущества над существующими лицензированными вакцинами включают в себя: увеличенную широту защиты вследствие ответных CTL-реакций ± широту антител и увеличенную продолжительность защиты. Подход с применением PNV устраняет необходимость приготовления, отбора и размножения рекомбинантов, как это делалось для лицензированной вакцины, поскольку новая конструкция ДНК может быть приготовлена непосредственно из клинического изолята.
В одном варианте изобретения последовательность гена нуклеопротеина вируса гриппа человека, NP, полученная из штамма A-PR/8, 34, клонирована в экспрессирующий вектор. Этот вектор содержит промотор для транскрипции РНК-полимеразой и терминатор транскрипции на конце кодирующей NP последовательности. В одном предпочтительном варианте промотором является длинный концевой повтор (LTR) вируса саркомы Ру (RSV), который является сильным транскрипционным промотором. Более предпочтителен промотор цитомегаловируса с последовательностью интрона А (CMVintA), Предпочтительным терминатором транскрипции является терминатор бычьего гормона роста. Особенно предпочтительна комбинация терминатором (СМVintA - BGH). Кроме того, для облегчения приготовления фармацевтического препарата предпочтительно включать в экспрессирующий вектор маркер устойчивости к антибиотикам. Можно использовать гены устойчивости к ампициллину, гены устойчивости к неомицину или любой другой фармацевтически приемлемый маркер устойчивости к антибиотику. В предпочтительном варианте изобретения ген устойчивости к антибиотику кодирует генный продукт для устойчивости к неомицину. Далее, для обеспечения высокого уровня получения фармацевтического препарата путем ферментации в прокариотических организмах выгодно, чтобы вектор содержал затравку репликации и обладал высокой копийностью. Любое число коммерчески доступных прокариотических клонирующих векторов могут обеспечить эти предпочтительные свойства. В предпочтительном варианте изобретения эти свойства обеспечиваются коммерчески доступными векторами, известными как рUC. Желательно удаление несущественных последовательностей ДНК: так, в одном из вариантов удалены lacZ и lacI кодирующие последовательности рUC.
В одном варианте применяют экспрессирующий вектор рn RSV, в котором в качестве промотора используют длинный концевой повтор (LTR) вируса саркомы Рауса (RSV). В другом варианте применяют V1, мутированный вектор рВR322, в который были клонированы промотры СМV и терминатор транскрипции ВGH. Конструкцию V1-NP применяли для иммунизации мышей и индукции CTL, которые зашивают против гетерологичного заражения. В особенно предпочтительном варианте данного изобретения элементы V1 комбинировали для получения экспрессирующего вектора, названного VIJ. В VIJ клонирован ген вируса гриппа, такой как ген А/РR/8/34 NP, РВ1, NS1, НА, РВ2 или М1. Еще в одном варианте ген устойчивости к ампициллину удален из VIJ и заменен геном устойчивости к неомицину для получения VIJneo (SEQ.ID:18:, фиг.7), в который могли быть клонированы любые из большого числа различных генов вируса гриппа для применения в соответствии с данным изобретением. Еще в одном варианте применяют вектор VIJns, который похож на VIJ, за исключением того, что уникальный сайт рестрикции SfiI был встроен в единственный КрnI сайт в положении 2114 VIJ - neo. Встречаемость сайтов SfiI в геномной ДНК человека очень низка (приблизительно 1 сайт на 100000 оснований). Поэтому этот вектор делает возможным тщательное наблюдение интеграции экспрессирующего вектора в ДНК хозяина просто путем расщепления SfiI экстрагированной геномной ДНК. Дальнейшим усовершенствованием является вектор VIR. В этом векторе столько, сколько возможно, несущественной ДНК было "вычищено" из вектора, что дало очень компактный вектор. Этот вектор является производным VIJns и показан на фиг.36 (SEQ.ID:45). Этот вектор позволяет использовать более крупные инсерции, не заботясь о том, что кодируются нежелательные последовательности, и оптимизирует поглощение клетками при введении этой конструкции, кодирующей специфические гены вируса группа, в окружающие ткани. На фиг.36 части VIJneo (фиг.7), которые делетируются, показаны в виде промежутка и встроенная последовательность показана жирным текстом, но нумерация VIJneo является неизменной. Вышеупомянутые модификация вектора и процедуры усовершенствования могут быть выполнены согласно способам, известным специалистам в этой области. Однако определенные из описанных продуктов, хотя и получаемые общепринятыми способами, особенно пригодны для той конкретной цели, к которой они приспособлены.
Хотя один вариант этого изобретения включает в себя ген NP вируса группа из штамма А/РR/8/34, более предпочтительные варианты включают в себя ген NP, ген НА, ген NA, ген РВ, ген М или ген NS не более недавних изолятов вируса гриппа. Это выполняется приготовлением копий ДНК вирусных генов с последующим субликлонированием индивидуальных генов. Последовательности для многих генов многих штаммов вируса гриппа в настоящее время открыто доступны в GENBANK (приблизительно 509 таких последовательностей для генов вируса гриппа А). Таким образом, любые из этих генов, клонированных из недавних Texas-, Beijing- или Panama-изолятов вируса, которые являются штаммами, рекомендованными. Центром контроля заболеваний как желательные в противогриппозных вакцинах, предпочтительны в этом изобретении (см. FLU-IMMUNE® influenza virus vaccine of Lederle, - Physicians Desk Reference, 1993, р.1232, трехвалентная очищенная, содержащая поверхностный антиген вируса гриппа вакцина, содержащая белок гемагглютинина из А/Texas/36/91, H1N1, A/Beijing, 353/89, H3N2 и B/Panama, 45/90). Для сохранения согласования терминологии здесь поддерживается следующий обычай для описания конструкций ДНК: "Название вектора - штамм гриппа - ген". Так, конструкция, в которой ген NP штамма А/PR/8/34 клонирован в экспрессирующий вектор VIJneo, имеет здесь название: "VIJneo-PR-NP". Конечно, так как этиологический штамм этого вируса изменяется, точный ген, оптимальный для введения в фармацевтический препарат, может изменяться. Однако, как будет показано ниже, вследствие того, что индуцируются ответные реакции в виде цитоксических лимфоцитов, которые способны защищать против гетерологичных штаммов, вариабельность штаммов менее критична в новых вакцинах по сравнению с вакцинами на основе целого вируса или субъединичного полипептида. Кроме того, поскольку этот фармацевтический препарат легок в манипулировании для встраивания нового гена, это может легко выполняться стандартными способами молекулярной биологии.
Поскольку последовательность нуклеопротеина консервативна среди разнообразных штаммов гриппа, достигается защита против последующего заражения вирулентным штаммом гриппа А, который гетерологичен для штамма, из которого клонирован ген для нуклеопротеина. Сравнивая NP из многочисленных штаммов гриппа А, не показали значительных различий во вторичной структуре [M. Gammelin et al. , Virol. 170, 71, 1989] и очень небольшие изменения в аминокислотной последовательности [O.T. Gorman et al., J. Virol. 65, 3704, 1991]. В течение приблизительно 50-летнего периода NP в штаммах человека эволюционировал при скорости только 0,66 изменений аминокислот в год. Более того, наши результаты, показавшие, что специфические для А/НК/68 CTL узнают клетки-мишени, импульсно-меченные синтетическим пептидом NP(147-155), полученным из последовательности NP А/РR/8/34, показывают, что этот Н-2Кd-ограниченный эпитоп СТL оставался функционально интактным в течение промежутка времени 34 года (см. фиг.2). Следует отметить, что если ген кодирует вирусный поверхностный антиген, такой как гемагглютинин или даже нейраминидаза, генерируется значительная ответная реакция в виде образования нейтрализующих гуморальных антител в дополнение к очень важной ответной реакции в виде цитотоксических Т-лимфоцитов.
Внутримышечная инъекция экспрессирующего ДНК-вектора, кодирующего консервативный внутренний белок вируса гриппа А, приводила к образованию значительного защитного иммунитета против последующего вирусного заражения. В частности, продуцируются NP-специфические антитела и первичные CTL. Иммунизация ДНК NP приводила к пониженным вирусным титрам в легких, ингибированию потери веса и повышенному выживанию по сравнению с контролями. Эта защитная иммунная ответная реакция не была опосредована NP-специфическими антителами, как показано отсутствием действия одним из NP-антител (см. пример 4) в борьбе с вирусной инфекцией, и была, следовательно, обусловлена NP-специфическим клеточным иммунитетом. Более того, образовались значительные уровни первичных CTL, направленных против NP. Эта защита была против вирулентного штамма А, который гетерологичен к штамму, из которого клонировали ДНК. Кроме того, заражающий штамм возник более, чем через три декады, после штамма А/PR/8/34, что свидетельствует о том, что иммунные ответные реакции, направленные против консервативных белков, могут быть эффективными несмотря на антигенную изменчивость и антигенный дрейф вариабельных белков оболочки. Поскольку каждый из генных продуктов вируса гриппа обнаруживает некоторую степень консервативности и поскольку СТL могут быть образованы в ответ на внутриклеточную экспрессию и МНС процессинг, можно предсказать, что другие гены вируса гриппа будут давать повышение ответных реакций, аналогично ответам, достигаемым для NP. Способы идентификации иммуногенных эпитопов сейчас хорошо известны в данной области [см., например, Shirai et al., J. Immunol. 148: 1657-1667, 1992; Choppin et al., J. Immunol., 147: 575-583, 1991; Calin - Laurens et al. , Vaccine 11: 974-978, 1993]. Таким образом, многие из этих генов были клонированы, как показано клонированными и секвенированными участками соединения в экспрессирующем векторе (см. ниже), так что эти конструкции представляют собой профилактические средства в доступной форме.
Таким образом, это изобретение обеспечивает экспрессирующие векторы, кодирующие белок вируса гриппа в качестве иммуногена. Изобретение предлагает средства для индукции перекрестного в отношении штаммов защитного иммунитета без необходимости применения самореплицирующихся агентов или адъювантов. Кроме того, иммунизация ДНК предоставляет большое число других преимуществ. Во-первых, этот подход к вакцинации должен быть применим к опухолям, так же, как к инфекционным агентам, так как ответ в виде CD8+ CTL важен для обоих патофизиологических процессов [K. Tanaka et al., Annu. Rev. Immunol. 6, 359 (1988)] . Поэтому индуцирование иммунного ответа против белка, критического для процесса трансформации, может быть эффективным средством защиты против рака или иммунотерапии. Во-вторых, образование антител с высоким титром против экспрессированных белков после инфекции ДНК вирусного белка (NP и гемагглютинина) и ДНК человеческого гормона роста [см., например, D.-c. Tang et al. , Nature 356, 152, 1992] указывает, что это быстрый и высокоэффективный способ получения вакцин на основе антител, либо отдельных, либо в комбинации с вакцинами на основе цитотоксических Т-лимфоцитов, направленных против консервативных антигенов.
Легкость получения и очистки конструкций ДНК выше, чем в случае традиционной очистки белка, что облегчает получение комбинированных вакцин. Так, можно приготовить многие конструкции, например ген, кодирующий NP, HA, M1, PB1, NS1 или любой другой ген вируса гриппа, смешанные и вводимые вместе. Наконец, поскольку экспрессия белка поддерживается после инъекции ДНК [H. Lin et al., Circulation 82, 4138 (1991); E. Hansen et al., FEBS Zett. 290, 73 (1991); S. Jiao et al., Hum. Gene Therapy 3, 21 (1992); J. A. Wolff et al. , Human Mol. Genet. 1, 363 (1992)], постоянство В- и Т-клеточной памяти может быть усилено [D. Gray and P. Matzinger, J. Exp. Med. 174, 969 (1991); S. Oehen et al., ibid. 176, 1273 (1992)], что вызывает образование длительного гуморального и опосредованного клеткой иммунитета.
Существующие недостатки лицензированных вакцин против гриппа усиливают необходимость разработки эффективных средств для предотвращения инфекции и ослабления заболевания. Более старые вакцины обеспечивают ограниченную защиту, эффективны только против небольшого числа выбранных штаммов вируса и снижают свою эффективность после короткого периода времени. Таким образом, существующие вакцины должны быть приготовлены заново для ежегодного введения, чтобы быть эффективными. Генерирование улучшенной ответной реакции в виде образования CTL против внутренних белков могло бы, по-видимому, обеспечить длительно действующий перекрестно-реактивный иммунитет, не обеспечиваемый существующей в настоящее время вакциной.
Мы продемонстрировали экспрессию белка из конструкций PNV в мышах, хорьках и приматах, кроме человека, путем детектирования иммунного ответа хозяина, направленного против антигенов вируса гриппа. Инъецирование мышей ДНК, кодирующей NP гриппа, приводило к улучшенному выживанию, уменьшенным вирусным титрам в легких и меньшей потере массы по сравнению с контрольными животными после заражения подтипами гриппа (штамма с антигенной изменчивостью), отличающимися от штаммов, из которых клонировали ДНК для конструкций.
Мы также наблюдали уменьшенное выделение вируса в среду после заражения измененными штаммами в хорьках, инокулированных ДНК NP. Эти результаты показывают, что защита против основного смешения (изменчивости) в штаммах гриппа создается вакциной ДНК, которая включает в себя гены, кодирующие NP. Инъекция ДНК НА с последующим заражением экспериментальных животных штаммами вируса с антигенным дрейфом приводила даже к более сильному уменьшению в выделении вируса в среду. Добавление ДНК, кодирующей внутренний белок, слегка увеличивало высокую степень защиты, наблюдаемую после инъекции только ДНК НА.
Иммунный ответ на ДНК вируса гриппа прослеживался в мышах в течение 6 месяцев после инъекции, с сохраняемостью антител, активности CTL и защиты in vivo. Повторная инъекция ДНК далее увеличила выживание после заражения при 25 неделях штаммом гриппа отличающегося подтипа и показала возможность повторной иммунизации для получения защитного опосредованного клеткой иммунитета. Сохраняемость антител была также документирована в течение по меньшей мере одного года после двух инъекций ДНК НА, с сохраняемостью в течение по меньшей мере в течение девяти месяцев после однократной инъекции ДНК НА в африканских зеленых мартышках.
Результаты этих экспериментов на животных показывают, что прямая инъекция ДНК обеспечивает усовершенствованный способ для защиты людей против инфекции гриппом и заболеваемости. Следует заметить, что экспериментальная защита посредством инъекции ДНК достигалась вакцинацией не инфицированных ранее мышей и хорьков. Взрослые люди, вакцинированные ДНК, ранее уже могли быть инфицированы гриппом. Эти люди будут демонстрировать даже более существенный иммунный ответ, возможно, более продолжительный, после иммунизации конструкциями ДНК.
Диапазон доз сравнивают по иммуногенности для оптимизации концентраций для использования. В экспериментах на небольших млекопитающих всего лишь 1 мкг ДНК NP вызывал иммунный ответ в виде образования антител и CTL. Иммунизация макак-резусов продемонстрировала ответ в виде антител в 2 из 2 животных с дозами 100 и 1000 мкг ДНК НА (A/PR/08/34), тогда как 1 из 2 животных отвечало на однократную инъекцию 10 мкг. В отдельных экспериментах не инфицированные ранее африканские зеленые мартышки были инъецированы смесью 5 различных конструкций ДНК, кодирующих НА из трех вирусных подтипов, а также ДНК, кодирующей NP и М1 из вируса гриппа А. 3 из 3 мартышек в каждой группе отвечали на вакцины, которые содержали 10 мкг или 100 мкг каждой из 5 конструкций. На основании этих открытий можно предсказать, что дозы 10, 50, 100 и 200 мкг ДНК являются эффективными для человека.
Предотвращение инфекции лицензированной, инактивированной вакциной коррелирует с уровнями антител в сыворотке и слизистой оболочке, направленных против НА, но не коррелирует с уровнем антител, направленных на внутренние белки вируса. Таким образом, НА должен быть включен в разработку содержащей ДНК вакцины против гриппа. Однако иммунная ответная реакция на NP усиливает образование антител к НА, а внутренние белки вируса гриппа обеспечивают ответ в виде CTL, перекрестно-реактивных с антигенно различными штаммами гриппа. Как упоминалось выше, проведение экспериментов на животных свидетельствует также об улучшенной иммуногенности и защите, когда инъекции содержали конструкции ДНК, кодирующие внутренние белки вместе с НА. Включение в вакцину конструкций ДНК, кодирующих внутренние белки будет, вероятно, усиливать эффективность содержащих ДНК вакцин в человеке. Поскольку уровни доз, по-видимому, зависят от взаимодействия этих компонентов, рутинное испытание позволит специалисту в этой области определить количество ДНК в вакцине, чтобы сделать смесь конструкций ДНК, кодирующих НА, NP и М1. Ответ хозяина на каждый из этих компонентов можно измерить отдельно, со сравнением титров ингибирования гемагглютинина (Н1) и нейтрализации против НА компонентов и CTL реакций против М1 и NP эпитопов. Результаты сравнивают с образованием антител после инъекции конструкций, экспрессирующих только НА. Эти исследования позволяют оценить потенциально повышенную ответную реакцию на вакцину, содержащую ДНК, кодирующую как НА, так и внутренние белки.
Эффективность для человека была показана на добровольцах, получавших ДНК вакцину гриппа с последующим интраназальным заражением, для того чтобы показать эффективность вакцины против сходных вирусных штаммов гриппа отличающегося подтипа. Состав, дозы и схемы введения для этой вакцины основаны на предшествующих исследованиях. Клиническая эффективность показана скоростью инфекции, бальными оценками заболевания и продолжительностью заболевания. Эти клинические результаты сравнивают с лабораторной оценкой иммунного ответа хозяина и выделения вируса в среду, чтобы определить маркеры-заменители, коррелирующие с защитой.
Стандартные способы молекулярной биологии для получения и очистки конструкций ДНК позволяют приготовить терапевтические ДНК данного изобретения. Таким образом, в то время как стандартные способы молекулярной биологии достаточны для получения продуктов этого изобретения, описанные в нем специфические конструкции обеспечивают новые терапевтические средства, которые неожиданным образом индуцируют перекрестную в отношении разных штаммов защиту, результат, до сих пор недостижимый со стандартными вакцинами, содержащими инактивированный целый вирус или белок его субъединицы.
Количество экспрессируемой ДНК, которое должно быть введено в реципиентную вакцину, будет зависеть от силы промоторов транскрипции и трансляции, применяемых в данной конструкции ДНК, и от иммуногенности экспрессируемого генного продукта. В общих чертах, иммунологически или профилактически эффективную дозу приблизительно 1 мкг - 1 мг и предпочтительно приблизительно 10 мкг - 300 мкг вводят непосредственно в мышечную ткань. Также ожидаются пригодными подкожная инъекция, внутрикожная инъекция, чрескожное введение, внутривенное введение или введение ингаляцией. Также ожидается, что можно будет применять бустер-вакцинации.
ДНК может быть обнаженной, т. е. не связанной с какими-либо белками, адъювантами или иными агентами, воздействующими на иммунную систему реципиента. В этом случае желательно, чтобы ДНК находилась в физиологически приемлемом растворе, таком как (но не только) стерильный солевой раствор или стерильный содержащий буфер солевой раствор. Альтернативно, ДНК может быть связана с липосомами, такими как лецитиновые липосомы или другие известные в этой области липосомы, в виде ДНК-липосомной смеси (см., например, WO 93/24640) или ДНК может быть связана с адъювантом, известным в этой области и усиливающим иммунный ответ, таким как белок или другой носитель. Удобно также использовать агенты, способствующие поглощению ДНК клеткой, такие как (но не только) ионы кальция, вирусные белки и другие облегчающие трансфекцию агенты. Эти агенты обычно называют облегчающими трансфекцию агентами и фармацевтически приемлемыми носителями. Термин ген в применении здесь обозначает сегмент нуклеиновой кислоты, кодирующий отдельный полипептид. Термин фармацевтический агент и вакцина применяют здесь взаимозаменяемо для обозначения композиций, применимых для индуцирования иммунных ответов. Термины конструкция и плазмида применяют взаимозаменяемо. Термин вектор применяют для обозначения ДНК, в которую могут быть клонированы гены для использования в соответствии со способом данного изобретения.
Таким образом, одним из вариантов этого изобретения является способ применения генов вируса гриппа для индуцирования иммунных ответов in vivo в позвоночном животном, таком как млекопитающее, в том числе человек, предусматривающий:
а) выделение гена,
b) соединение гена с регуляторными последовательностями таким образом, что этот ген оперативно связан с контрольными последовательностями, которые при введении в живую ткань индуцируют инициацию транскрипции и последующую трансляцию этого гена,
с) введение гена в живую ткань, и
d) необязательный бустинг дополнительным геном вируса гриппа.
Предпочтительный вариант этого изобретения представляет собой способ защиты против гетерологичных штаммов вируса гриппа. Это выполняют введением иммунологически эффективного количества нуклеиновой кислоты, кодирующей консервативный эпитоп вируса гриппа. Например, эту функцию обеспечивает целый ген нуклеопротеина вируса гриппа и ожидается, что кодирующие последовательности других генов гриппа и их части, кодирующие консервативные эпитопы, внутри этих генов также обеспечивают перекрестную в отношении разных штаммов защиту.
В другом варианте этого изобретения ДНК-вакцина кодирует нуклеопротеин, гемагглютинин, матричный белок, неструктурный белок или продукт гена полимеразы вируса гриппа человека. Ниже даны характерные примеры этого варианта, в которых ген вируса гриппа человека кодирует нуклеопротеин, основную полимеразу 1, неструктурный белок 1, гемагглютинин, матричный белок 1, основную полимеразу 2 изолята вируса гриппа человека A/PR/8/34, нуклеопротеин изолята вируса гриппа человека A/Beijing/353/89, гемагглютинин изолята вируса гриппа человека А/Texas/36/91 или гемагглютинин изолята вируса гриппа человека В/Panama/46/90.
В характерных вариантах этого изобретения конструкция ДНК содержит ген вируса гриппа, причем эта конструкция ДНК способна экспрессироваться при введении в ткани животных in vivo и генерировать иммунный ответ против экспрессированного продукта кодирующего гена вируса гриппа. Кроме того, изобретение рассматривает комбинации, содержащие такие конструкции с полинуклеотидами, кодирующими другие антигены, не относящиеся к вирусу гриппа. Примерами предпочтительных конструкций ДНК, содержащих ген вируса гриппа, являются:
а) pnRSV-PR-NP,
b) V1-PR-NP,
c) VIJ-PR-NP, 5'-конец которой является SEQ.ID: 12:,
d) VIJ-PR-PB1, 5'-конец которой является SEQ.ID: 13:,
e) VIJ-PR-NS, 5'-конец которой является SEQ.ID: 14:,
f) VIJ-PR-HA, 5'-конец которой является SEQ.ID: 15:,
g) VIJ-PR-PB2, 5'-конец которой является SEQ.ID: 16:,
h) VIJ-PR-M1, 5'-конец которой является SEQ.ID: 17:,
i) VIJneo-BJ-NP, 5'-конец которой является SEQ.ID: 20:, и 3' - конец которой является SEQ.ID: 21:,
j) VIJneo-TX-NP, 5'-конец которой является SEQ.ID: 24: и 3' - конец которой является SEQ.ID: 25,
k) VIJneo-PA-HA, 5'-конец которой является SEQ.ID: 26: и 3' - конец которой является SEQ.ID: 27,
l) VIJns-GA-HA (A/Georgia/03/93), размер конструкции 6,56 т.п.н., 5'-конец является SEQ.ID: 46: и 3'-конец является SEQ.ID: 47:,
m) VIJns-TX-HA (A/Texas/36/91), размер конструкции 6,56 т.п.н., 5'-конец является SEQ.ID: 48: и 3'-конец является SEQ.ID: 49:,
n) VIJns-PA-HA (B/Panama/45/90), размер конструкции 6,61 т.п.н., 5'-конец является SEQ.ID: 50: и 3'-конец является SEQ.ID: 51:,
o) VIJns-BJ-NP (A/Beijing/353/89), размер конструкции 6,42 т.п.н., 5'-конец является SEQ.ID: 52: и 3'-конец является SEQ.ID: 53:,
p) VIJns-BJ-M1 (A/Beijing/353/89), размер конструкции 5,62 т.п.н., 5'-конец является SEQ.ID: 54: и 3'-конец является SEQ.ID: 55:,
q) VIJns-PA-NP (B/Panama/45/90), размер конструкции 6,54 т.п.н., 5'-конец является SEQ.ID: 56: и 3'-конец является SEQ.ID: 57:,
r) VIJns-PA-M1 (B/Panama/45/90), размер конструкции 5,61 т.п.н., 5'-конец является SEQ.ID: 58: и 3'-конец является SEQ.ID: 59:.
Следующие далее примеры даются для дальнейшего раскрытия изобретения, без ограничения изобретения характерными чертами этих примеров.
Пример 1
Получение конструкций ДНК, кодирующих белки гриппа человека
i) pnRSV-PRNP: Ген NP A/PR/8/34 выделяли из pAPR-501 [J.F. Young et al., The Origin of Pandemic Influenza Viruses, W.G. Laver, Ed. (Elsevier Science Publishing Co., Inc., 1983)] в виде EcoRI фрагмента 1565 п.н., заполняли при помощи фрагмента Кленова и клонировали в заполненный фрагментом Кленова и обработанный фосфатазой XbaI сайт pRSV-BL. pRSV-BL конструировали расщеплением вектора рВL-САТ3 [B. Luckow and G. Schutz, Nuc. Acids Res. 15, 5490 (1987)] XhoI и NcoI для удаления САТ кодирующей последовательности и заполняли фрагментом Кленова и самолигировали. Фрагмент промотора RSV выделяли в виде фрагмента NdeI и ASp718 из p Rshgrnx [V. Giguere et al., Nature 330, 624 (1987)], заполняли при помощи фрагмента Кленова и клонировали в сайт Hind III полученного, как описано выше, вектора (рBL-САТ без САТ последовательности).
ii) V1-NP: Экспрессирующий вектор V1 конструировали из pCMV1E-AK1-DHFR [J. Whang et al., J. Virol. 61, 1796 (1987)]. Гены АК1 и DHFR удаляли разрезанием вектора EcoRI и самолигированием. Этот вектор не содержит интрона А в промоторе CMV, поэтому его добавляли в виде фрагмента РСR, который имел делетированный внутренний сайт SacI [на 1855 в нумерации В.S. Chapman et al., Nuc. Acids Res. 19, 3979 (1991)]. В качестве матрицы для реакции РСR применяли pCMVintA-Lux, полученную легированием фрагмента HindIII и NheI из рСМV-6а120 [см. B. S. Chapman et al., ibid.], содержащей hСМV-IEI энхансер/промотор и интрон А, в сайты HindIII и XbaI pBL3, получая pCMVintBL. Фрагмент гена люциферазы 1881 п.н. (HindIII - SmaI, заполненный фрагментом Кленова) из RSV-Lux [J. R. de Wet et al., Mol. Cell Biol. 7, 725, 1987] клонировали в сайт SalI pCMVintВ, который заполняли фрагментом Кленова и обрабатывали фосфатазой. Праймерами, которые перекрывают интрон А, являются:
5'-праймер, SEQ.ID:5:
5'-CTATATAAGCAGAGCTGTTTAG-3'
3'-праймер, SEQ.ID:6:
5'-GTAGCAAAGATCTAAGGACGGTGAGCTGCAG-3'
Праймерами, применяемыми для удаления сайта SacI, являются:
смысловой праймер SEQ.ID:7:

и антисмысловой праймер, SEQ.ID:8:

Фрагмент PCR разрезали SacI и BglII и встраивали в вектор, разрезанный теми же самыми ферментами. Ген NP из вируса гриппа А (А/PR/8/34) вырезали из pAPR501 [J.F. Young et al., в The Origin of Pandemic Influenza Viruses, W.G. Laver, Ed. (Elsevier Science Publishing Co., Inc., 1983)] ввиду EcoRI фрагмента 1565 п.н. и затупляли. Его встраивали в V1 при затупленном сайте BglII, получая V1-NP. Плазмиды размножали в E. coli и очищали способом щелочного лизиза [J. Sambrook, E.F. Fritisch and T. Maniatis, в Molecular Cloning, A Laboratory Manual, Second edition (Cold Spring Harbor Laboratory Press, 1989)] . Полученную при помощи градиента CsCl ДНК осаждали этанолом и ресуспендировали в 0,9% солевом растворе при концентрации 2 мг/мл для инъекции.
Пример 2
Тест для цитотоксических Т-лимфоцитов вируса гриппа человека
Цитотоксические Т-лимфоциты получали из мышей, иммунизированных ДНК или выздоровевших после инфекции А/НК/68. Контрольные культуры получали из мышей, инъецированных контрольной ДНК, и из неинъецированных мышей. Готовили клеточные суспензии, эритроциты удаляли лизисом с хлористым аммонием и клетки селезенки культивировали в RPM1 1640 с добавлением 10% фетальной телячьей сыворотки (FBS), 10 Е/мл пенициллина, 100 мкг/мл стрептомицина, 0,01 М HEPES (рН 7,5) и 2 мМ l-глутамина. Равное количество аутологичных облученных стимуляторных клеток, импульсно-меченных в течение 60 минут Н-2Kd-рестриктированным пептидным эпитопом NP147-155 (Thr-Tyr Gln Arg Thr Arg Ala Leu Val, SEQ. ID: 9: ) при 10 мкМ или инфицированных вирусом гриппа A/PR8/34 (H1N1), и 10 Е/мл рекомбинантного IL-2 человека (Cellular Products, Buffalo, NY) добавляли и культуры выдерживали в течение 7 дней при 37oС с 5% СО2 и относительной влажности 100%. В выбранных экспериментах вместо аутологичных стимуляторных клеток добавляли rhIL-2 (20 Е/мл) и ConA (2 мкг/мл). Цитотоксическую Т-клеточную эффекторную активность определяли с клетками Р815, меченными в течение 3 часов 60 мкКи 51Cr на 106 клеток, и обрабатывали, как описано выше, NР147-155 или инфицировали вирусом гриппа A/Victoria/73 (H3N2). Контрольные мишени (меченые) клетки Р815 без пептида (или вируса) не лизировали. Мишени высевали при концентрации 1•104 клеток/лунку в круглодонные 96-луночные планшеты и инкубировали с эффекторами в течение 4 часов в трех повтроностях. Супернатант удаляли из каждой лунки и считали в сцинтилляционном счетчике Betaplate (LkB Wallac, Turku, Finland). Максимальный счет, полученный при добавлении 6 М НСl, и спонтанный счет без CTL определяли для каждого препарата-мишени. Процент специфического лизиса рассчитывали как: [(экспериментальный-спонтанный)/ (максимальный-спонтанный)] • 100.
Пример 3
Получение NP-специфических CTL и антител in vivo
BALB/с мышей инъецировали в четырехглавые мышцы обеих ног плазмидной ДНК, кодирующей нуклеопротеин A/PR/8/34 и регулируемой промотором саркомы Рауса или промотором цитомегаловируса.
Экспрессирующими векторами были:
i) pnRSV-PRNS, см. пример 1;
ii) V1-NP, см. пример 1.
Применяемыми животными были самки BALB/с мышей, полученные из лабораторий Charles River, Raleigh, NC. Мышей получали в возрасте 4-5 недель и исходно инъецировали ДНК в возрасте 5-6 недель. Если нет других указаний, инъекции ДНК вводили в четырехглавые мышцы обеих ног, каждая нога получала 50 мкл стерильного солевого раствора, содержащего 100 мкг ДНК. Мыши получали 1, 2 или 3 серии инокуляций с 3-недельными интервалами. Отрицательные контрольные животные были неинъецированными или инъецировались соответствующим пустым вектором, не содержащим встроенного гена NP.
Присутствие или отсутствие плазмидной ДНК NP в мышцах выбранных животных анализировали при помощи PCR (фиг. 1). Плазмидную ДНК (ДНК либо NP, либо люциферазы) детектировали в 44 из 48 инъецированных тестированных мышц. В мышцах, инъецированных ДНК люциферазы, экспрессия белка демонстрировалась активностью люцеферазы, обнаруженной в мышечных экстрактах, согласно способам, известным в этой области [J. A. Wolff et al., Science 247, 1465 (1990); G. Ascadi et al., Nature 352, 815 (1991); H. Lin et al., Circulation 82, 2217 (1990); R.N. Kitsis et al., Proc. Natl. Acad. Sci. (USA) 88, 4138 (1991); E. Hansen et al., FEBS Lett. 290, 73 (1991); S. Jiao et al., Hum. Gene Therapy 3, 21 (1992); J. A. Wolff et al., Human Mol. Genet. 1, 363 (1992)].
Экспрессия NP в мышцах после инъекции ДНК NP была ниже порога детектирования для вестерн-блоттинга (<1 нг), но обнаруживалась по образованию NP-специфических антител (см. фиг.2). Для анализа образования NP-специфических CTL селезенки извлекали через 1-4 недели после иммунизации и клетки селезенки рестимулировали рекомбинантными человеческими IL-2+ аутологичными клетками селезенки, которые либо инфицированы гриппом A/(A/PR/8/34), либо импульсно метились H-2Kd-рестриктированным пептидным эпитопом нуклеопротеина (NP остатки 147-155, см. O. K. Rotzscke et al., Nature 348, 252 (1990)). Клетки селезенки, рестимулированные инфицированным вирусом или импульсно-меченными эпитопом сингенными клетками, были способны убивать меченные эпитопом клетки-мишени (фиг.3А). Это свидетельствует о том, что внутримышечная инъекция ДНК NP генерировала соответствующий полученный из NP пептид в ассоциации с МНС класса I для индуцирования специфического CTL ответа. Эти CTL были способны узнавать и лизировать инфицированные вирусом клетки-мишени (фиг. 3В) или клетки-мишени, импульсно-меченные Н-2Кd-рестриктированным пептидным эпитопом нуклеопротеина и инфицированные вирусом клетки-мишени. Это показывает их специфичность, а также их способность детектировать эпитоп, генерируемый природно в инфицированных клетках.
Более строгим измерением иммуногенности содержащей ДНК NP вакцины была оценка первичного CTL ответа. Клетки селезенки, взятые из инъецированных ДНК NP мышей, активировали экспозицией с ConA и IL-2, но не подвергали рестимуляции in vitro экспрессирующими антиген клетками перед тестированием их способности убивать подходящие мишени. Спленоциты из мышей, иммунизированных ДНК NP при активации ConA и IL-2 in vitro без антигенспецифической рестимуляции лизировали как импульсно-меченные эпитопом, так и инфицированные вирусом клетки-мишени (фиг.3С и D). Эта литическая активность как рестимулированных, так и активированных клеток селезенки выгодно отличается от литической активности подобным образом обработанных спленоцитов, полученных из мышей, которые были ранее инфицированы вирусом гриппа А/НК/68, вирулентным адаптированным к мышам штаммом H3N2, возникшим спустя 34 года после A/PR/8/34 (H1N1). Таким образом, инъекция ДНК NP генерировала CTL, которые были специфичны для эпитопа нуклепротеина и которые были способны идентифицировать природно процессируемый антиген (т.е. могли убивать инфицированные вирусом клетки). NP CTL образовывались также в С3Р и В6 трансгенных мышах, экспрессирующих человеческий HLA-A2. NP CTL были обнаружены в селезенках BALB/с мышей, инъецированных всего лишь 1 дозой 1 мкг ДНК NP (самая низкая тестированная доза) (см. табл. 1).
Таблица 1: Самок ВАLB/с мышей (4-6-недельных) инъецировали с однократной дозой ДНК NP A/PR/34 (VIJ-NP) или контрольной ДНК (VIJ) при указанных дозах. Для сравнения мышей инфицировали вирусом гриппа A/PR/34. CTL получали после 8 недель, рестимулировали in vitro сингенными клетками селезенки, импульсно-меченными NP-пептидом, и тестировали против импульсно-меченных NP-пептидом клеток Р815 при отношении эффектор:мишень 50:1. Данные представлены в виде процентов специфического лизиса для характерных индивидуальных мышей.
Последующие эксперименты показали, что мыши, получившие 1 дозу 1 мкг NP ДНК сохраняли NP CTL в течение по меньшей мере 4,5 месяцев (самое позднее тестированное время). Диапазон CTL ответов после инъекции ДНК был сравним с диапазоном в инфицированных гриппом мышах. Однако следует отметить, что анализ CTL после рестимуляции антигена in vitro не является строго количественным. Поэтому в настоящее время мы разработали тесты лимитирующего разведения для более количественной оценки уровней NP-специфических CTL в мышах. В мышах, инъецированных 3 дозами 100 мкг NP ДНК, ответы CTL детектировались по меньшей мере через 6 месяцев после иммунизации (фиг.19). Таким образом, полинуклеотидная вакцина (РNV) против гриппа способна генерировать долгоживущие CTL-ответы, направленные на консервативные антигены гриппа.
Инъекция мышей NP ДНК приводила к образованию высокого титра А анти-NP IgG антител (фиг.2). Считают, что образования высокого титра IgG антител в мышах требует помощи CD4+ Т-клеток (P. Vieira and K. Rajewsky, Int. Immunol, 2, 487 (1990); J.J. Donnelly et al., J. Immunol. 145, 3071 (1990)). Это свидетельствует о том, что NP, экспрессированный из плазмид in situ, был процессирован для предоставления как МНС класса I, так и МНС класса II.
Пример 4.
Защита мышей при заражении вирулентным вирусом гриппа человека
Роль NP антител в защитном иммунитете к гриппу показана при помощи двух подходов. Во-первых, определяли титры вируса в легких в эксперименте пассивного переноса. Самок BALB/с мышей ≥ 10-недельного возраста инъецировали интраперитонеально 0,5 мл слитой сыворотки (разведенной в 2,0 мл PBS) из мышей, инъецированных 3 раза 200 мкг NP ДНК. Контрольных мышей инъецировали равным объемом слитой (объединенной) сыворотки из мышей, перенесших инфекцию А/НК/68, также в 2,0 мл PBS. Дозу А/НК/68 иммунной сыворотки доводили таким образом, чтобы ELISA титр анти-NP антител был равен титру в объединенной сыворотке мышей, инъецированных NP ДНК. Мышей заражали без анестезии безвыборочным способом 104 ТСID50 А/НК/68 через 2 часа после инъекции сыворотки и следующую инъекцию равным количеством сыворотки давали через 3 дня. Мышей убивали через 6-7 дней после инфекции и определяли титры вируса в легких в TCID50 на мл, как описано Moran [J. Immunol. 146, 321, 1991].
Мышам, не инфицированным ранее, вливали анитисыворотку против NP, полученную из мышей, инъецированных NP ДНК, и затем заражали А/НК/68. Заражение вирусом проводили адаптированным для мышей штаммом А/НК/68 и поддерживали затем посредством in vivo пассажа в мышах (Др. I., Mbawuike, личное сообщение). Хранящийся вирусный посевной материл использовали в виде гомогената легких из инфицированных мышей. Гомогенат имел инфекционный титр 5•108 ТСID50/мл на клетках MDCK. Для определений титра вируса в легких и исследований потери массы заражения вирусом проводили безвыборочным способом путем интраназального закапывания 20 мкл, содержащих 104 TCID50 на ноздрю неанестезированных мышей, что приводит к прогрессирующей инфекции легких вирусом, но не является летальным для BALB/с мышей [Getter, R.A. et al., Infect. Immunity 29, 654, 1980]. В экспериментах по выживанию мышей заражали закапыванием 20 мкл, содержащих 102,5 TCID50 на ноздрю при полной анестезии кетамином и ксилазином; инфицирование анестезированных мышей этой дозой вызывает быстрое заражение легких, которое летально до 90-100% для неиммунизированных мышей [J.L. Schulman and E.D. Kilbaerne, J. Exp. Med., 118, 257, 1963; G.H. Scott and R.J. Sydiskis, Infect. Immunity 14, 696, 1976; R.A. Getter et al., Infect. Immunity 29, 654, 1980]. Вирусные титры в легких определяли серийным титрованием на клетках MDCK (полученных из АТСС, Rockville, MD) в 96-луночных планшетах, как описано Moran et al. [ibid.].
Не наблюдали снижения вирусного титра в легких в мышах, которые получали антисыворотку против NP (6,3±0,2; среднее ± SEM, n=4) по сравнению с контрольными мышами, получавшими нормальную сыворотку (6,1±0,3; среднее ± SEM, n= 4). В качестве положительного контроля сыворотку собирали из мышей, инфицированных А/НК/68, и пассивно переносили четырем неинфицированным мышам. После заражения А/НК/68 в легких не обнаруживали вирусной инфекции, что свидетельствует о том, что сыворотка против целого вируса была полностью защищающей от заражения гомологичным вирусом. Во-вторых, неинфицированных мышей иммунизировали очищенным NP (5 мкг/ногу, 3 раза в течение периода 6 недель) внутримышечной инъекцией. Эти мыши генерировали высокий титр NP-специфических антител, но не продуцировали NP-специфических CTL и не были защищены от летальной дозы вируса. Таким образом, хотя циркулирующие антитела IgG против NP проявляют нейтрализирующее действие на целый вирус, они не индуцируют защитный иммунитет в мышах.
Защитную эффективность in vivo инъекций NP ДНК оценивали для определения, была ли опосредованная клетками иммунная ответная реакция функционально значимой. Одной из прямых мер эффективности иммунного ответа была способность мышей, впервые иммунизированных NP ДНК, устранять прогрессирующую сублетальную инфекцию легкого гетерологичным штаммом гриппа (A/HK/68, H3N2). Заражение вирусом проводили как описано выше. Мыши, иммунизированные NP ДНК имели вирусные титры в легких после заражения, которые были на 3 порядка ниже на 7-й день (1,0±1,0; среднее ± SEM; n=4), чем титры контрольных мышей, которых не иммунизировали (4,1±0,3; среднее ± SEM; n=4) или которые были иммунизированы пустым вектором (4,5±0,0; среднее ± SEM; n=4). Фактически три из четырех иммунизированных мышей имели недетектируемые уровни вируса
в их легких, тогда как ни одна из контрольных мышей не устраняла вирус в этой временной точке. Значительное различие в вирусных титрах в легких, наблюдаемое в этом эксперименте и шести других, демонстрирует, что иммунный ответ ускорял устранение вируса. Отсутствие защитного действия контроля с пустым вектором подтверждает, что ДНК per se не является ответственной за иммунный ответ. Кроме того, поскольку используемый для заражения штамм вируса А/НК/68 (вирулентный, адаптированный для мышей штамм H3N2) был гетерологичным для штамма А/PR/8/34 (H1N1), из которого клонировали ген NP, иммунитет был явно гетеротипичным.
В качестве критерия индуцируемой вирусом заболеваемости наблюдали потерю массы в мышах, инфицированных сублетально вирусом А/НК/68 после иммунизации NP ДНК (фиг.4). Неинъецируемые мыши или мыши, инъецированные пустым вектором, служили контролями. Мыши, иммунизированные NP ДНК, обнаружили меньшую потерю массы и более быстрый возврат к массам до заражения после инфицирования вирусом гриппа А по сравнению с контрольными мышами.
Интраназальное инфицирование полностью анестезированных мышей гриппом А вызывает быстрое широко распространяющееся размножение вируса в легких и смерть в пределах 6-8 дней, если инфекция не контролируется (R.A. Yetter et al. , Infect. Immunity 29, 654 (1980)). Выживание мышей, зараженных этим способом, отражает их способность ограничивать тяжесть острой легочной инфекции. Способность мышей выживать при заражении двумя различными штаммами гриппа, А/НК/68 (см. фиг.5) и A/PR/8/34, была исследована. Мыши, предварительно иммунизированные NP ДНК, обнаружили 90% скорость выживания по сравнению с 0% в инъецированных пустым вектором и 20% в неинъецированных контрольных животных (фиг. 5). В 14 таких исследованиях мыши, иммунизированные NP ДНК, показали не менее 50% превышения скорости выживания по сравнению с контролями. Таким образом, способность индуцируемого NP ДНК иммунного ответа эффективно ускорять выздоровление и ослаблять заболевание, вызываемое вирусом отличающегося штамма, возникшего на 34 года позже, подтверждает рациональность использования консервативного белка для генерированной CTL-ответной реакции.
Пример 5
Выделение генов из изолятов вируса гриппа
Многие из более старых вирусных штаммов депонированы в АТСС (Каталог вирусов и антисывороток животных, Chlamydiae и Rockettsiae 1990, 6-ое издание, перечни 20 штаммов гриппа А и 14 штаммов гриппа В).
А. Вирусные штаммы и очистка:
Штаммы гриппа, содержащиеся в вакцине сезона гриппа 1992 года, были получены от Доктора Nancy J. Cox (отдел вызываемых вирусами и риккетсиями заболеваний, Центр борьбы с заболеваниями, Атланта, GA). Этими штаммами являются:
(1) A/Beijing/353/89 (H3N2),
(2) A/Texas/36/91 (H1N1),
(3) B/Panama/45/90,
(4) A/Georgia/03/93.
Все эти вирусы выращивали пассажем в 9-10-дневных содержащих эмбрион яйцах (за исключением того, что A/Georgia выращивали в клетках MDCK) (100-200 на вирусный препарат) и очищали модификацией способа, описанного Massicot et al. (Virology 101, 242-249 (1980)). Вкратце, вирусные суспензии осветляли центрифугированием при 8000 об/мин (центрифуга Sorvall RC5C, ротор GS-3) и затем осаждали центрифугированием при 18000 об/мин, в течение 2 часов в роторе Beckman Type 19. Осажденный вирус ресуспендировали в STE (0,1 M NaCl, 20 Мм Трис, рН 7,4, 1 мМ ЭДТА) и центрифугировали при 4000 об/мин в течение 10 минут (центрифуга Hermle Z 360 K) для удаления агрегатов, 2 мл супернатанта наносили на прерывистый сахарозный градиент, состоящий из 2 мл 60% сахарозы, на которую наслоены 7 мл 30% сахарозы с буфером STE, и центрифугировали при 36000 об/мин (ротор SW-40, Beckman) в течение 90 минут. Образующий полосу в интерфазе вирус собирали, разбавляли в 10 раз при помощи STE и осаждали при 30000 об/мин в течение 2 часов (ротор Beckman Ti 45). Затем осажденный вирус замораживали при -70oС.
В. Экстракция вирусной РНК и синтез кДНК:
Вирусную РНК очищали из замороженного вируса экстракцией изотиоцианатом гуанидиния с применением коммерчески доступного кита (Stratagene, La Jolla, СА) и способа Chomczynski u Sacchi (Anal. Biochem. 162, 156-159 (1987)). Двухцепочечную кДНК готовили из вирусной РНК с применением коммерчески доступного набора для синтеза кДНК (Pharmacia) согласно инструкциям изготовителей с некоторыми модификациями. Для первой цепи кДНК использовали в качестве праймера синтетический олигонуклеотид, 5'-AGCAAAAGCAGG-3', SEQ.ID: 30:, который комплементарен консервативной последовательности, расположенной при 3'-конце вирусной РНК для всех генов штамма А. Эта последовательность является общей для всех РНК вирусов гриппа типа А и поэтому обеспечивает способ клонирования любого гена вирусных штаммов А. После синтеза первой и второй цепей кДНК реакционные смеси экстрагировали смесью фенол/хлороформ и осаждали этанолом, не следуя далее инструкциям набора. Эти кДНК с затупленными концами затем непосредственно лигировали в вектор VIJneo или VIJns, который был расщеплен рестриктазой BglII, затупляли концы Т4 ДНК-полимеразой и обрабатывали кишечной щелочной фосфатазой теленка.
Для скрининга на определенные полноразмерные вирусные гены мы использовали синтетические олигодезоксирибонуклеотиды, которые были сконструированы комплементарными к 3'-концу трансляционной открытой рамки считывания данного вирусного гена. Пробы, предоставлявшие, по-видимому, и полноразмерные гены согласно рестрикционному картированию и определению размеров на агарозных гелях при электрофорезе, проверяли дидезоксинуклеотидным секвенированием на обоих участках соединения вирусного гена с VIJneo. Соединяющие последовательности для каждого гена, клонированного из этих вирусов, даны ниже в примере 8.
Подобные стратегии использовали для клонирования кДНК из каждого из названных выше вирусов, за исключением кДНК для В/Panama/45/90, который не имеет общих последовательностей на каждом конце вирусной РНК; для примирования синтеза первой цепи кДНК применяли смесь олигодезоксирибонуклеотидов. Такими праймерами были:
(1) 5'-AGCAGAAGCGGAGC-3', SEQ.ID:31: для PB1 и PB2;
(2) 5'-AGCAGAAGCAGCGCA-3', SEQ.ID:19: для NS и HA;
(3) 5'-AGCAGAAGCACGCAC-3', SEQ.ID:22: для M1 и
(4) 5'-AGCAGAAGCACAGCA-3', SEQ.ID:23: для NP.
Для генов, которые клонировали при помощи PCR, раствор кДНК с тупыми концами использовали непосредственно в реакциях PCR в качестве ДНК-матрицы. Праймерами, применяемыми для клонирования 6 генов вируса гриппа, получаемых при помощи PCR, были следующие праймеры:
1. Ген НА из А/Georgia/03/93
смысловой праймер: SEQ.ID:33:
5'-GGT ACA ACC ATG AAG ACT ATC ATT GCT TTG AGC-3'
антисмысловой праймер: SEQ.ID:34:
5'-CCA CAT AGA TCT TCA AAT GCA AAT GTT GCA CCT AAT-3'.
2. Ген НА из А/Texas/36/91
смысловой праймер: SEQ.ID:35:
5'-GGT ACA ACC ATG AAA GCA AAA CTA CTA GTC CTGTTA TG-3'
антисмысловой праймер: SEQ.ID:36:
5'-CCA CAT TCA GAT GCA TAT TCT ACA CTG CAA AG-3'.
3. Ген НА из B/Panama/45/90
смысловой праймер: SEQ.ID:37:
5'-GGT ACA ACC ATG AAG GCA ATA ATT GTA CTA CTC CTG-3'
антисмысловой праймер: SEQ.ID:38:
5'-CCA CAT TTA TAG ACA GAT GGA GCA AGA AAC ATTGTC-3'.
4. Ген M1 из А/Beijing/353/89
смысловой праймер: SEQ.ID:39:
5'-GGT ACA AGA TCT ACC ATG CTT CTA ACC GAG GTC-3'
антисмысловой праймер: SEQ.ID:40:
5'-CCA CAT AGA TCT TCA CTT GAA CCG TTG CAT CTG CAC-3'.
5. Ген NP из B/Panama/45/90
смысловой праймер: SEQ.ID:41:
5'-GGT ACA GGA TCC ACC ATG TCC AAC ATG GAT ATT GAC GGC-3'
антисмысловой праймер: SEQ.ID:41:
5'-CCA CAT GGA TCC TTA ATA ATC GAG GTC ATC ATA ATC CTC-3'.
6. Ген M1 из B/Panama/45/90
смысловой праймер: SEQ.ID:43:
5'-GGT ACA GGA TCC ACC ATG TCG CTG TTT GGA GAC ACA ATTGCC-3'
антисмысловой праймер: SEQ.ID:44:
5'-CCA CAT GGA TCC TTA TAG GTA TTT CTT CAC AAG AGC TG-3'.
Все клоны генов вируса гриппа, полученные при помощи кДНК или PCR, были проверены секвенированием через сайты лигирования в ген и экспрессией гена в трансфицированных клетках RD. Экспрессию детектировали при помощи иммуноблоттинга.
Конструкции NP и М1 для штамма А/Н3N2 (векторы 4 и 5) готовили из генов А/Beijing/353/89. Эти гены были выбраны вследствие ожидаемой высокой степени консервативности как гена NP, так и гена М1 и вследствие их доступности.
На основании предшествующей работы особенно предпочтительная группа из 7 экспрессирующих векторов, которые комбинируют для получения вакцины, включает в себя:
1. VIJns - HA (A/Georgia/03/93) - 6,56 т.п.н.
2. VIJns - HA (A/Texas/36/91) - 6,56 т.п.н.
3. VIJns - HA (B/Panama/45/90) - 6,61 т.п.н.
4. VIJns - NP (A/Beijing/353/89) - 6,42 т.п.н.
5. VIJns - M1 (A/Beijing/353/89) - 5,62 т.п.н.
6. VIJns - NP (B/Panama/45/90) - 6,54 т.п.н.
7. VIJns - M1 (B/Panama/45/90) - 5,61 т.п.н.
Ниже представлены соответствующие последовательности для соединения этих генов в экспрессирующие векторы. Только небольшие части этих конструкций требуют секвенирования для подтверждения, что был клонирован правильный ген. Путем сравнения близких известных генов легко подтвердить, что данный ген является NP геном, НА геном, М1 геном и т.д. Например, последовательность гена НА А/Texas очень похожа на последовательность гена НА А/Kiev/59/79,которая доступная в GENBANK под номером М38353. Также последовательность гена НА В/Panama очень похожа на последовательность НА В/England/222/82, которая доступная в GENBANK под номером М18384.
Подобным образом можно подтвердить идентичность для данного гена из любого вируса гриппа человека. В каждом случае ниже подтверждали как 5'-последовательность, так и 3'-последовательность для гарантии, что присутствует целый ген. В каждом случае обозначенная жирным шрифтом ATG указывает стартовый кодон гена вируса гриппа, а последовательность, обозначенная жирным шрифтом в 3'-последовательности, обозначает стоп-кодон:
1. VIJns-HA (A/Georgia/03/93) 6,56 т.п.н.:
5'-последовательность: (SEQ.ID:46:)
. ..TCA CCG TCC TTA GAT C/GG TAC AAC CAT GAA GAC TAT CAT TGC TTT GAG CTA CAT TTT ATG TCT GGT TTT CGC...
3'-последовательность: (SEQ.ID:47:)
. . . TCA TGC TTT TTG CTT TGT GTT GTT TTG CTG GGGTTC ATC ATG TGG GCC TGC CAA AAA GGC AAC ATT AGG TGC AAC ATT TGC ATT TGA A/GA TCT ATG TGG GAT CTG CTG TGC...
2. VIJns-HA (A/Texas/36/91) 6,56 т.п.н.:
5'-последовательность: (SEQ.ID:48:)
. . .TTA GAT C/GG AAC ATG AAA GCA AAACTA CTA GTC CTG TTA TGT GCA TTT ACA GCT ACA TAT GCA...
3'-последовательность: (SEQ.ID:49:)
. . . CTG GTG CTT TTG GTC TCC CTG GGGGCA ATC AGC TTC TGG ATG TGT TCT AAT GGG TCT TTG CAG TGT AGA ATA GGC ATC TGA ATG TGG /GAT CTG CTG TGC CTT...
3. VIJns-HA (B/Panama/45/90) 6,61 т.п.н.:
5'-последовательность: (SEQ.ID:50:)
. . .CCT TAG ATC/GGT ACA ACC ATG AAG GCA ATA ATT GTA CTA CTA ATG GTA GTA ACA TCC AAC GCA GAT CGA ATC TGC ACT GGG ATA ACA TCT TCA AAC TCA CCT CAT GTG. ..
3'-последовательность: (SEQ.ID:51:)
. . .TTG GCT GTA ACA TTG ATG ATA GCT ATT TTT ATT GTT TAT ATG GTC TCC AGA GAC AAT GTT TCT TGC TCC ATC TGT CTA TAA ATG TGG/GAT CTG CTG TGC CTT...
4. VIJns-NP (A/Beijing/353/89) 6,42 т.п.н.:
5'-последовательность: (SEQ.ID:52:)
. ..GTC CTT AGA TC/C ACC ATG GCG TCC CAA GGC ACC AAA CGG TCT TAT GAA CAG ATG GAA ACA GAT GGGGAA CGC CAG AAT GCA ACT..
3'-последовательность: (SEQ.ID:53:)
. . .GAA AAG GCA ACG AAC CCG ATC GTG CCC TCT TTT GAC ATG AGT AAT GAA GGA TCT TAT TTC TTC GGA GAC AAT GCA GAA GAG TAC GAC AAT TAA G/GA TCT GCT GTG CCT...
5. VIJns-M1 (A/Beijing/353/89) 5,62 т.п.н.:
5'-последовательность: (SEQ.ID:54:)
. ..CTT AGA TC/C AGA TCT ACC ATG AGT CTT CTA ACC GAG GTC GAA ACG TAT GTT CTC TCT ATC GTT CCA TCA GGC CCC CTC AAA GCC GAA ATC GCG CAG AGA CTT GAA GAT GTC TTT GCT GGG AAA AAC ACA GAT...
3'-последовательность: (SEQ.ID:55:)
. . .GGG ACT CAT CCT AGC TCC AGT ACT GGT CTA AAA GAT GAT CTT CTT GAA AAT TTG CAG ACC TAT CAG AAA CGA ATG GGG GTG CAG ATG CAA CGG TTC AAG TGA AGA TCT ATG TGG/GAT CTG CTG TGC CTT...
6. VIJns-NP (B/Panama/45/90) 6,54 т.п.н.:
5'-последовательность: (SEQ.ID:56:)
. ..CCT AGA TC/C ACC ATG TCC AAC ATG GAT ATT GAC GGT ATC AAC ACT GGG ACA ATT GAC AAA ACA CCG GAA GAA ATA ACT TCT...
3'-последовательность: (SEQ. ID:57:)
. . .GTT GAA ATT CCA ATT AAG CAG ACC ATC CCC AAT TTC TTC TTT GGG AGG GAC ACA GCA GAG GAT TAT GAT GAC CTC GAT TAT TAA G/GA TCT GCT GTG...
7. VIJns-M1 (B/Panama/45/90) 5,91 т.п.н.:
5'-последовательность: (SEQ.ID:58:)
. ..CCT AGA TC/C ACC ATG TCG CTG TTT GGA GAC ACA ATT GCC TAC CTG CTT TCA TTG ACA GAA GAT GGA GAA GGC AAA GCA GAA CTA GCA GAA AAA TTA...
3'-последовательность: (SEQ.ID:59:)
. . . AGA TCT CTT GGGGCA AGT CAA GAG AAT GGG GAA GGA ATT GCA AAG GAT GTG ATG GAA GTG CTA AAG CAG AGC TCT ATG GGA AAT TCA GCT CTT GTG AAG AAA TAC CTA TAA G/GA TCT GCT GTG...
Пример 6
Экспрессирующий вектор VIJ, SEQ.ID:10:
Нашей целью в создании VIJ было удаление промотора и элементов терминации транскрипции из нашего вектора, V1, чтобы поместить их в более определенном контексте и получить более компактный вектор и улучшить выходы очистки плазмиды.
VIJ получен из векторов V1 (см. пример 1) и pU С18, коммерчески доступной плазмиды. V1 расщепляли SspI и EcoRI с образованием двух фрагментов ДНК. Меньший из этих фрагментов, содержащий промотор СМVintА и элементы терминации транскрипции бычьего гормона роста (BGH), которые контролируют экспрессию гетерологичных генов (SEQ.ID:11:), очищали из агарозного геля для электрофореза. Концы этого фрагмента ДНК "затупляли" при помощи фермента ДНК-полимеразы Т4 для облегчения лигирования этого фрагмента с другим фрагментом ДНК с "тупыми" концами.
Для обеспечения "каркаса" этого экспрессирующего вектора была выбрана плазмида pUС10. Известно, что она дает высокие выходы плазмиды, хорошо охарактеризована по ее последовательности и функции и имеет минимальный размер. Мы удалили весь lac оперон из этого вектора, который был необязательным для наших целей и мог бы мешать выходам плазмиды и экспрессии гетерологичных генов. Удаление проводили частичным расщеплением ферментом НаеII. Оставшаяся плазмида была очищена из агарозного геля, ее концы затупляли Т4 ДНК-полимеразой, затем ее обрабатывали кишечной щелочной фосфатазой теленка и лигировали с элементом СМVintA/BGH, описанным выше. Получали плазмиды, проявляющие любую из двух возможных ориентаций промоторных элементов в каркасе pUC. Одна из этих плазмид дала значительно большие выходы ДНК в E. coli и была названа VIJ (SEQ.ID:10). Эту структуру вектора проверяли секвенированием соединяющих участков. Затем было показано, что эта плазмида дает сравнимую или более высокую экспрессию гетерологичных генов по сравнению с V1.
Пример 7
Конструкции гена вируса гриппа в экспрессирующем векторе VIJ:
Многие из генов штамма A/PR/8/34 вируса гриппа клонировали в экспрессирующий вектор VIJ, который, как отмечено в примере 4, повышал экспрессию до уровней таких же высоких или более высоких, чем уровни в векторе V1. Последовательности гена PR8 известны и доступны в базах данных GENBANK. Для каждого из этих генов, клонированных, как описано ниже, размер клонированного фрагмента проверяли при помощи определяющего размер геля и обеспечивали номер GENBANK, с которым сравнивали частичную последовательность. Способ получения этих генов из вирусных штаммов, например из вируса, полученного из АТСС (А/PR/8/34 представляет собой АТСС VR-95; многие другие штаммы также депонированы в АТСС) см. пример 5.
А. Субклонирование генов PR8 в VIJ:
1. Ген NP
Ген NP субклонировали из pАPR501 (J.F. Young, U. Desselberber, P. Graves, P. Palese, A. Shatzman и M. Rosenberg (1983), в "The Origins of Pandemic Influenza Viruses", ed. W.G. Laver. (Elsevier, Amsterdam) pp.129-138). Он был вырезан путем разрезания pАPR501 при помощи EcoRI, фрагмент очищали на геле и затупляли Т4 ДНК-полимеразой. Клонированный фрагмент имел длину 1,6 т.п.н.
2. Ген NS
Ген NS субклонировали из pАPR801 (J.F. Young, U. Desselberber, P. Graves, P. Palese, A. Shatzman and M. Rosenberg (1983), в "The Origins of Pandemic Influenza Viruses", ed. W.G. Laver. (Elsevier, Amsterdam) pp.129-138). Его вырезали разрезанием pАPR801 при помощи EcoRI, очищали на геле и затупляли Т4 ДНК-полимеразой. Затупленный фрагмент встраивали в VIJ, разрезанный BglII и также затупленный Т4 ДНК-полимеразой. Клонированный фрагмент имел длину 0,9 т.п.н. (полный кодирующий район NS, включающий в себя NS1 и NS2).
3. Ген НА
Ген НА субклонировали из pJZ102 (J.F. Young, U. Desselberber, P. Graves, P. Palese, A. Shatzman u M. Rosenberg (1983), в "The Origins of Pandemic Influenza Viruses", ed. W.G. Laver (Elsevier, Amsterdam) pp.129-138). Его вырезали разрезанием pJZ102 при помощи HindIII, фрагмент очищали на геле и затупляли Т4 ДНК-полимеразой. Затупленный фрагмент встраивали в VIJ, разрезанный BglII и также затупленный Т4 ДНК-полимеразой. Клонированный фрагмент имел длину 1,75 т.п.н.
4. Ген РВ1
Ген РВ1 субклонировали из pGemI-PB1 (5'- и 3'-соединения этих генов с вектором секвенировали для проверки их идентичности. См. J.F. Young, U. Desselberber, P. Graves, P. Palese, A. Shatzman и M. Rosenberg (1983), в "The Origins of Pandemic Influenza Viruses", ed. W.G. Laver (Elsevier, Amsterdam) pp. 129-138). Его вырезали разрезанием pGem-PB1 HindIII, фрагмент очищали на геле и затупляли ДНК-полимеразой T4. Затупленный фрагмент встраивали в VIJ, разрезанный при помощи BglII и также затупленный Т4 ДНК-полимеразой. Клонированный фрагмент имел длину 2,3 т.п.н.
5. Ген РВ2
Ген РВ2 субклонировали из pGemI-PB2 (5'- и 3'-соединения этих генов с вектором секвенировали для проверки их идентичности. См. J.F. Young, U. Desselberber, P. Graves, P. Palese, A. Shatzman и M. Rosenberg (1983), в "The Origins of Pandemic Influenza Viruses", ed. W.G. Laver (Elsevier, Amsterdam) pp.129-138). Его вырезали разрезанием pGem-PB2 BamHI и очищали на геле. Фрагмент с липкими концами встраивали в VIJ, разрезанную BglII. Клонированный фрагмент имел длину 2,3 т.п.н.
6. Ген М1
Ген М1 получали при помощи PCR из плазмиды p8901 М1ТЕ. М-последовательность в этой плазмиде генерировали PCR из pАPR701 (J.F. Young, U. Desselberber, P. Graves, P. Palese, A. Shatzman и M. Rosenberg (1983), в "The Origins of Pandemic Influenza Viruses", ed. W.G. Laver (Elsevier, Amsterdam) pp. 129-138). с применением олигомера 5'-GGT ACA AGA TCT ACC ATG CTT CTA ACC GAG GTC-3', SEQ. ID:3:, для смыслового праймера и олигомера 5'-CCA CAT AGA TCT TCA CTT GAA CCG TTG CAT CTG CAC-3', SEQ.ID:4:, для антисмыслового праймера. Фрагмент PCR очищали на геле, разрезали BglII и лигировали в VIJ, разрезанный BglII. Клонированный фрагмент имел длину 0,7 т.п.н. Аминокислотный конец кодируемого М1 кодируется в смысловом праймере, показанном выше, как кодон ATG, тогда как кодон остановки трансляции М1 (стоп-кодон) кодируется обращением кодона ТСА, который в смысловом направлении является стоп-кодоном TGA.
В. Экспрессирующие конструкции ген вируса гриппа VIJ:
В каждом случае показана соединяющая последовательность от 5'-промоторного района (CMVintA) в клонированный ген. Последовательности были генерированы секвенированием праймера: праймер CMVintA: 5'-CTA ACA GAC TGT TCC TTT CCA TG-3', SEQ.ID:28:, который генерирует кодирующую последовательность. Положение, в котором находится соединение, отмечено "/", что не означает прерывания последовательности. Способ получения этих конструкций суммирован после представленных ниже последовательностей. Каждая представленная последовательность обозначает полную пригодную экспрессируемую конструкцию ДНК для обозначения гена вируса гриппа.
Каждую конструкцию временно трансфицировали в RD клетки (ATCC CCL 136), линии клеток рабдомиосаркомы человека в культуре. Спустя 48 часов после трансфекции клетки собирали, лизировали и получали вестерн-блоты (за исключением конструкции VIJ-PR-НА, которую тестировали в мышах и давали специфические против НА антитела перед вестерн-блоттингом, что позволяло избежать необходимости вестерн-блоттинга, так как экспрессию можно было наблюдать in vivo). Антитела, специфические для РВ1, РВ2 и NS белков получали у Stephen Inglis в Университете Кембриджа, который использовал очищенные белки, экспрессированные в виде слитых с β-галактозидазой белков, для получения поликлональных антисывороток. Поликлональную антисыворотку против NP получали иммунизацией кроликов целым вирусом А/PR/8/34. Антитела против М1 коммерчески доступны в Biodesign в виде козьей антисыворотки против гриппа А, номер по каталогу B65245G. В каждом случае наблюдали белок предсказанного размера, что подтверждало экспрессию in vitro кодируемого белка вируса гриппа.
Номенклатура этих конструкций соответствует общепринятой: "Название вектора - штамм гриппа - ген". В каждом случае последовательность проверяли сравнением с известным последовательностями из GENBANK для клонированных и секвенированных последовательностей генов A/PR/8/34. Биологическая эффективность каждой из этих конструкций демонстрируется в примерах 2, 3 и 4 (см. в конце описания).
Последовательность через 5'-соединения CMVintA и гены гриппа из A/PR/8/34 приведены в конце описания.
Как соединены фрагменты:
1. VIJ-PR-NP: Затупленный BglII (вектор) с затупленной ЕсоRI (NР)
2. VIJ-PR-PB1: Затупленный BglII (вектор) с затупленной HindIII (PB1)
3. VIJ-PR-NS: Затупленный BglII (вектор) с затупленной ЕсоRI (NS1)
4. VIJ-РR-НА: Затупленный BglII (вектор) с затупленной HindIII (HA)
5. VIJ-РR-РB2: Липкий BglII (вектор) с липкой BamHI (РВ2)
6. VIJ-PR-M1: Липкий BglII (вектор) с липкой BglII (M1).
М1 получали при помощи PCR с применением P8901-M1TE в качестве матрицы и праймеров, которые добавляют сайт BglII на обоих концах и начинаются за 3 основания перед АТG и заканчиваются сразу после терминирующего кодона для М1 (TGА).
Пример 8
Экспрессирующий вектор VIJneo SEQ.ID:18:
Было необходимо удалить ampr ген, применяемый для отбора при помощи антибиотиков бактерий, захватывающих VIJ, поскольку ампициллин нельзя применять в широкомасштабных ферментерах. Ampr ген из структуры pUC VIJ удаляли расщеплением рестриктазами SspI и Eam 11051. Оставшуюся плазмиду очищали при помощи электрофореза в агарозных гелях, концы затупляли T4 ДНК-полимеразой и затем обрабатывали кишечной щелочной фосфатазой теленка. Коммерчески доступный kanr ген, произведенный из транспозона 903 и содержащийся в плазмиде рUC4K, вырезали рестриктазой PstI, очищали электрофорезом в агарозных гелях и затупляли Т4 ДНК-полимеразой. Этот фрагмент лигировали с каркасом VIJ и получали плазмиды с kanr геном в любой ориентации, которые были обозначены как VIJnео 1 и 3. Каждую из этих плазмид проверяли рестрикционным анализом, секвенированием ДНК соединяющих участков. Было показано, что они продуцировали близкие количества по сравнению с VIJ. Экспрессия продуктов гетерологичных генов была сравнима с экспрессией VIJ для этих векторов VIJneo. Мы произвольно выбрали VIJneo 3, называемую далее VIJneo (SEQ.ID:I8:), которая содержит kanr ген в той же ориентации, что и ampr ген в VIJ, в качестве экспрессирующей конструкции.
Гены из каждого из штаммов А/Beijing/353/39, А/Texas/36/91 и В/Panama/46/90 клонировали в вектор VIJneo в виде кДНК. В каждом случае соединяющие последовательности от 5'-промоторного района (CMVintА) в клонированный ген секвенировали при помощи праймера: СМVintA праймер: 5'-СТА АСА GAC Т GT ТСС ТТТ CCA TG-3', SEQ.ID:28:, который генерирует кодирующую последовательность. Она смежна с терминатором, соединение которого также показано. Эта последовательность генерируется с применением праймера: праймер BGH: 5'-GGA GTG GCA ССТ ТСС AGG-3', SEQ.ID:29:, который генерирует некодирующую цепь. В каждом случае последовательность проверяли, сравнивая с известными последовательностями из GENBANK для клонирования и секвенирования генов из этих или других изолятов гриппа. Положение, при котором происходит соединение, разграничено в виде "/", что не означает какого-либо прерывания последовательности. В случае соединения VIJneo-TX-НА секвенирующий гель был сжатым и начальную последовательность было трудно прочесть. Поэтому первые 8 оснований при этом соединении показаны как "N". Эти нуклеотиды были подтверждены и идентифицированы. Первый кодон "АТG", встречаемый в каждой последовательности, является кодоном инициации трансляции для соответствующего клонированного гена. Каждая из обеспеченных последовательностей представляет собой полную доступную экспрессируемую конструкцию ДНК для обозначенного гена вируса гриппа. Номенклатура соответствует общепринятой: "Название вектора - штамм гриппа - ген". Биологическую эффективность каждой из этих последовательностей демонстрировали таким же образом, как в примерах 2, 3 и 4 выше.
Последовательность через 5'-соединения CMVintA и гены гриппа и через 3'-соединения генов гриппа и терминатор ВGH экспрессирующих конструкций для различных штаммов вируса гриппа и белков приведены в конце описания.
Пример 9
Интрадермальные инъекции генов вируса гриппа:
Протокол для интрадермального введения генов был таким же, каким он был для внутримышечных введений: три инъекции по 200 мкг с интервалами 3 недели V1-PR-NР. Селезенки собирали для анализа in vitro спустя 55 дней после третьей инъекции, рестимулировали нонапептидным эпитопом нуклеопротеина 147-155, SEQ.ID:9:. Клетки-мишени (P815 клетки, мышиная мастоцитома, сингенная с Н-2d ВALB/с мышей) инфицировали гетерологичным вирусом А/Victoria/73 и проводили специфический лизис с применением клеток селезенки в качестве эффектора при отношении эффектор:мишень в диапазоне между 5:1 и 40:1. Отрицательные контроли получали путем измерения лизиса клеток-мишеней, не инфицированных вирусом гриппа. Положительные контроли получали измерением лизиса инфицированных вирусом гриппа клеток-мишеней, полученных из мыши, которую инъецировали три раза 130 мкг V1-РR-NР и которая выжила после инфицирования живым штаммом вируса гриппа А/НК/68.
Результаты: Специфический лизис достигался с применением клеток селезенки из интрадермально инъецированных мышей при всех отношениях эффектор:мишень. Не было специфического лизиса, когда клетки селезенки, полученные из неинъецированных мышей или мышей, инъецированных вектором V1 без встроенного РR-NP гена (пустым вектором), использовали в качестве эффекторных клеток. Кроме того, специфический лизис, достигнутый при помощи интрадермальной доставки, был сравним при всех отношениях эффектор:мишень с результатами, полученными с применением внутримышечной доставки. Также измеряли вирусные титры в легких в мышах, инъецированных интрадермально или внутримышечно. Результаты с применением 5 мышей на группу, 3•200 мкг дозы с интервалами 3 недели и заражения через 3 недели после последней дозы приведены в табл. 2.
Наконец, тестировали процент выживания мышей к 28-му дню. На 28-ой день из мышей, получивших V1-NР-РR, выжили 89% внутримышечных реципиентов и 50% интрадермальных реципиентов. Ни одна из мышей, получавших V1 вектор, не выжила и только 30% выжили из необработанных мышей. Этот эксперимент демонстрирует, что ДНК, кодирующая нуклеопротеин из штамма А/РR/8/34, была способна индуцировать CTL, узнающие нуклеопротеин из гетерологичного штамма А/Victoria, и защитную иммунную реакцию против гетерологичного штамма А/НК/68.
Пример 10
Вакцинация полинуклеотидами в приматах
1. Антитела к NP в макаках-резусах: Макак-резусов (006 NP, 009 NP или контроль 101; 021) инъецировали 1 мг/сайт RSV-NР внутримышечно в 3 места в 1-ый день. Инъекции по 1 мг RSV-Lux и CMV-int-Lux, конструкций для экспрессии репортерного гена люциферазы светлячка, давали в то же самое время в другие места. Животных повторно инъецировали на 15-ый день теми же самыми количествами ДНК, что и в 1-ый раз, и также 1 мг рD5-САТ, конструкцией для экспрессии репортерного гена хлорамфеникол-ацетилтрансферазы, в 1 сайт каждая. Места мышц, содержащие репортерные гены, брали для биопсии и анализировали на активность репортерного гена. Сыворотку собирали через 2, 5, 9, 11, 13 и 15 недель после первой инъекции. Первая положительная проба на антитела против NР была собрана на 11-й неделе и положительные пробы были также получены на 13 и 15-й неделях. Антитела против NР определяли при помощи ЕLISA. Результаты представлены на фиг.9.
2. Ингибирующие гемагглютинацию (H1) антитела в макаках-резусах: Макаки были инъецированы внутримышечно VIJ-PR-НА на 1-й день. Два животных получали (каждый) 1 мг, 100 мкг или 10 мкг ДНК в каждую четырехглавую мышцу. Каждую инъекцию вводили в объеме 0,5 мл. У животных извлекали кровь перед инъекцией в 1-й день. Всех животных инъецировали повторно ДНК на 15-й день и кровь собирали после этого с 2-4-недельными интервалами. Титры ингибирования гемагглютинации (Н1) против А/РR/8/34 были положительными при 5, 9 и 12 неделях после первой инъекции ДНК VIJ-РR-НА. Результаты показаны в табл. 3.
Пример 11
Исследования полинуклеотидной вакцины на хорьках
1. Исследование полинуклеотидной вакцины на хорьках было начато с целью определения, могут ли быть животные защищены от инфекции вирусом гриппа путем иммунизации генами, кодирующими либо НА (поверхностный белок, способный индуцировать образование штамм-специфических нейтрализующих антител), либо внутренний белок NP, NS1, PB1, М (которые могли бы индуцировать опосредованный клеткой иммунный ответ, который был бы независимым от штамма). Животных инъецировали ДНК, кодирующей различные гены вируса гриппа, в нашем векторе VIJ, как показано в табл. 4.
2. На 22-й и 43-й дни после иммунизации сыворотку собирали из иммунизированных животных и анализировали на нейтрализующие (ингибирующие гемагглютинацию - Н1) антитела и на антитела к нуклеопротеину (NP) при помощи ELISA, животные, инъецированные ДНК, образовывали антитела к соответствующим генам. Это показано на фиг.10, 11 и 16.
3. На 128-й день выбранных иммунизированных животных заражали 1200 ТСID50 вируса гриппа А/НК/68. Этот штамм гетерологичен по отношению к штамму А/РR/8/34, который был источником кодирующих последовательностей, примененных для иммунизации, и, следовательно, защита свидетельствует об иммунитете, основанном на опосредованных клетками, независимых от штамма иммунных механизмах. Как показано в фиг.12, в животных, иммунизированных ДНК, кодирующей внутренние белки, наблюдали статистически значимое уменьшение выделения вируса в среду по сравнению с контролями, что является подтверждением того, что иммунизация полинуклеотидами в хорьках способна индуцировать иммунный ответ и такой иммунный ответ является защитным.
4. Подобным образом тестировали гомологичное заражение при помощи А/РR/8/34 и защитная эффективность нейтрализующих антител, индуцированных вакцинацией полинуклеотидами, также была продемонстрирована.
Пример 12
Получение VIJns
Сайт SfiI добавляли к VIJneo для облегчения исследований по интеграции. Коммерчески доступный SfiI линкер из 13 п.н. (New England BioLabs) добавляли в сайте KpnI внутри последовательности BGH этого вектора. VIJneo линеаризовали при помощи KpnI, очищали на геле, затупляли Т4 ДНК-полимеразой и лигировали с затупленным SfiI линкером. Изоляты клонов выбирали при помощи рестрикционного картирования и проверяли секвенированием через линкер. Новый вектор обозначали VIJns (фиг.17). Экспрессия гетерологичных генов в VIJns (с SfiI) была сравнима с экспрессией тех же самых генов в VIJnео (с KpnI).
Пример 13
Иммуногенность
1. Гуморальные иммунные ответы
Инъекция ДНК, кодирующей белки НА, NР и М1 гриппа, приводила к гуморальным иммунным ответным реакциям в мышах, хорьках или приматах кроме человека (в том числе африканских зеленых мартышках и макаках-резусах). К настоящему времени показано, что PNV, содержащие гены НА, клонированные из штаммов вируса гриппа А/PR/34, B/Panama/90, A/Beijing/89, А/Texas/91, А/Hawaii/91 и А/Georgia/93, вызывают образование антител.
а) Мыши: Антитела к NP и М1 были обнаружены при помощи ЕLISA в сыворотках из мышей после инъекции ДНК. Существенные титры антител (104-106) были образованы всего
лишь с 1 мкг ДНК (А/PR/34), введенной однократно (самая низкая тестированная доза), они возникали уже спустя 2 недели после инъекции (самое раннее тестированное время) и не уменьшались по меньшей мере в течение 6 месяцев после инъекции. Эти антитела к NP не являются нейтрализующими и не участвуют в защите. Однако они действительно демонстрируют экспрессию белка NP in vivo после инъекции ДНК. В противоположность этому, антитела к НА действительно обеспечивают защитный иммунитет против гомологичного штамма вируса гриппа. Инъекция НА ДНК, клонированной из штамма А/PR/34, приводила к образованию нейтрализующих антител, как измерено in vitro в тесте ингибирования гемагглютинации (Н1). Титры Н1≥1280 были измерены во многих мышах, получивших 3 дозы по 100 мкг НА ДНК, и детектируемые титры наблюдали в некоторых животных, получивших всего 2 дозы по 0,1 мкг. Существовала зависимость дозы-ответа между титром Н1 и дозой ДНК, а также между титром Н1 и числом инъекций (табл. 5).
Таблица 5: Самок ВALB/с мышей (4-6-недельных) инъецировали НА ДНК А/PR/34 (VIJ НА) при указанных дозах 1, 2 или 3 раза с 3-недельными интервалами. Отрицательными контролями были мыши, инъецированные контрольной ДНК, состоящей из вектора без инсерции гена (VIJ), и не инфицированные ранее, неинъецированные мыши. Пробы сыворотки брали при 7 неделях после инъекции и анализировали на присутствие вызывающих ингибирование гемагглютинации (Н1) антител. Данные представлены в виде геометрических средних титра H1, где n= 10.
В каждой из испытанных мышей присутствие Н1 антител коррелировало с защитой в модели гомологичного заражения. Ингибирующие гемагглютинацию антитела (H1 антитела) в мышах, инъецированных НА ДНК (А/РR/34) оставались практически неизменными в течение по меньшей мере шести месяцев. НА антитела, как измерено при помощи ЕLISA, образовывались также в мышах при использовании НА ДНК из штаммов вируса гриппа А/Beijing/89, B/Panama /90 и А/Texas/91.
На основании сообщения в литературе, показавшего, что после инъекции ДНК экспрессия репортерного гена была ниже в старых мышах, исследовали влияние возраста на гуморальные иммунные ответы на НА. Из-за недоступности старейших неоплодотворенных самок мышей применяли непроизводящих мышей возраста приблизительно 10 месяцев. Этих мышей и 4-6-недельных неоплодотворенных мышей сравнивали на их способность образовывать антитела к НА. Более старые мыши были способны образовывать НА антитела после инъекции НА ДНК при таких низких дозах, как 1 мкг (самая низкая испытанная доза), хотя с более низким титром, чем более молодые мыши (см. табл. 6).
Таблица 6: Самок BALB/с мышей (4-6-недельных неоплодотворенных и 10-месячных непроизводящих) инъецировали НА ДНК А/PR/34 (VIJ НА) при указанных дозах три раза с 3-недельными интервалами. Отрицательными контролями были мыши, инъецированные контрольной ДНК (VIJ), и не инфицированные ранее, неинъецированные мыши. Для сравнения других мышей инъецировали сублетальной дозой А/РR/34. Пробы сыворотки брали при 9 неделях после инъекций 1 и анализировали на титр H1. Данные представлены в виде геометрических средних H1 титра, где n=15.
Однако это не было результатом самой РNV вакцины, а скорее связано с пониженной способностью в старых мышах генерировать вообще гуморальные иммунные ответные реакции, поскольку старые мыши обнаружили такие более низкие Н1 ответы, чем молодые мыши, после инфицирования живым вирусом А/РR/34. В самом деле, Н1 антитела, по-видимому, менее понижены в вакцинированных ДНК старых мышах, чем в инфицированных вирусом гриппа старых мышах. Кроме того, непроизводящие старые мыши, примененные в этих исследованиях, были приблизительно на 50% тяжелее, чем типичные неоплодотворенные мыши того же возраста, что, на основании исследований других авторов с применением диет с ограничением калорий в мышах, могло бы оказывать неблагоприятное действие на иммунные ответы этих животных. По этой и другим причинам иммунные ответные реакции этих мышей могут быть нерепрезентативными. Тем не менее, возраст (по меньшей мере до 10 месяцев), по-видимому, не снижает значительно способность вакцинации полинуклеотидами индуцировать гуморальные иммунные реакции, даже при дозах таких низких, как 1 мкг.
b) Хорьки: Гуморальные иммунные ответы были получены в хорьках, инъецированных НА ДНК из А/PR/34, А/Beijing/89, А/Hawaii/91 и А/Georgia/93 штаммами гриппа. H1 антитела против А/PR/34 и ELILA антитела против НА из других штаммов были индуцированы соответствующими PNV. Сыворотки из хорьков, инъецированных НА ДНК А/Beijing/89, А/Hawaii/91 и А/Georgia/93, содержали H1 антитела и нейтрализующие антитела, так как эти животные были защищены против заражения вирусом.
с) Приматы кроме человека: (см. также пример 10 выше). Макаки-резусы были иммунизированы дважды НА ДНК (А/PR/34) при дозах 10, 100 и 1000 мкг на ногу. Н1 титры до 320 были обнаружены в животных, которые получали 100 или 1000 мкг и один из двух получавших дозы 10 мкг макак имел H1 80. Пока сыворотки анализировались до 13 месяцев; титры H1 не снижались заметно при сравнении с 6-13 месяцев (см. табл. 7).
Таблица 7: Макаки-резусы (как самцы, так и самки) размером в диапазоне от 4,3 до 8,8 кг были инъецированы НА ДНК А/РR/34 (VIJ НА) при указанных дозах при 0 и 2 неделях. Пробы сыворотки брали в указанные точки времени после первой дозы и анализировали на Н1 титр. Данные представляют собой Н1 титры для отдельных животных.
В африканских зеленых мартышках, инъецированных комбинацией PNV, содержащей 100 мкг НА ДНК (А/Beijing/89), оценка сывороток через 4-6 недель после 1-й дозы обнаружила GМТ (геометрическое среднее титра) 29 (8 из 9). Это лучше ответных реакций на лицензированную вакцину, содержащую субвирион (GМТ= 16, 5/6), и на лицензированную вакцину, содержащую целый вирион (МТ=36, 6/6) в той же временной точке (фиг.18). Заметный бустерный эффект второй иммунизации был обнаружен в животных, получающих дозу 10 мкг НА ДНК (GMT 1,9 после 1 дозы и 199 после 2 доз). Лицензированная вакцина с целым вирионом показала подобный эффект ревакцинации, в то время как Н1 титры, продуцируемые вакциной с субвирионом, были лишь временными. К настоящему времени сходные уровни Н1 антител измерялись до 18 недель в животных, иммунизированных как дозами 10 мкг, так и дозами 100 мкг НА ДНК при сравнении с лучшей лицензированной вакциной с целым вирионом. Эти результаты показывают, что PNV была по меньшей мере так же эффективна в генерировании нейтрализующих антител, как вакцина с целым вирионом, и более эффективна, чем вакцина с субвирионом. Очищенная субъединичная вакцина не была детектируемой иммуногенной в мышах; поэтому субъединичные вакцины не испытывались в приматах кроме человека. В этом исследовании PNV содержала 5-валентную смесь (коктейль) ДНК, кодирующих НА из А/Beijing/89, B/Panama/90 и А/Texas/91, и NP и М1 из А/РR/34, чтобы она была похожа на возможную (кандидат) вакцину. Этих животных также тестировали на генерирование гуморальных иммунных реакций против других компонентов этой вакцины и детектировали антитела к НА В/Panama/90 и к NP А/РR/34. В отдельном эксперименте инъекция двух доз клонированной при помощи PСR ДНК НА индуцировала как Н1 антитела, так и нейтрализующие антитела против НА А/Texas/91.
2. Клеточно-опосредованные иммунные ответы
См. пример 3 выше.
3. Образование имунных ответных реакций
а) Гуморальный иммунитет: События, ведущие к образованию гуморальных и клеточно-опосредованных иммунных ответов после инъекции ДНК, пока еще не выяснены. Вероятно, что для образования нейтрализующих антител (например, против НА вируса гриппа) клетки должны экспрессировать этот антиген на плазменной мембране или секретировать его во внеклеточную среду. Кроме того, трансфицированные клетки должны экспрессировать НА со вторичной, третичной и четвертичной структурой, подобной структуре в вирионе. В тесте розеткообразования экспрессия НА клеточной поверхностью была продемонстрирована в RD клетках (рабдомиосаркома; миобластного происхождения), временно трансфицированных НА ДНК. Эритроциты агглютинировались на поверхности трансфицированных НА клеток, но не ложнотрансфицированных клеток, показывая, что НА не только экспрессируется на поверхности клеток, но и сохраняет правильную конформацию для связывания с содержавшими сиаловую кислоту белками.
b) Клеточно-опосредованный иммунитет: Образование клеточно-опосредованных иммунных ответных реакций (например, против NР вируса гриппа) требует протеолитического процессинга и предоставления пептидов, произведенных в результате процессинга, в ассоциации славным комплексом тканевой совместимости класса I. Природа предоставляющих антиген клеток, приводящих к образованию иммунных ответов после инъекции ДНК, пока неизвестна. Мышечные клетки экспрессируют низкие уровни МНС класса I и, как считают, не экспрессируют ко-стимуляторные молекулы на их поверхности. Поэтому мышечные клетки не считают предоставлявшими антиген клетками.
Однако некоторые линии доказательств предполагают, что мышечные клетки участвуют в генерировании иммунных ответов после внутримышечной инъекции ДНК. Во-первых, ограниченное обследование тканей, способных интернализовать голую плазмидную ДНК с последующей экспрессией белка in situ, показало, что многие типы клеток могут экспрессировать репортерные гены при инъекции такой плазмиды непосредственно в эту ткань, но эти ткани были значительно менее эффективны, чем мышечные клетки. Полный анализ поглощения ДНК немышечными клетками после внутримышечной инъекции пока не сообщался, но, возможно, это поглощение было бы даже менее эффективным. Во-вторых, экспрессия репортерных генов после внутримышечной инъекции ДНК была продемонстрирована в скелетных и сердечных мышечных клетках во многих различных видах. В-третьих, хотя CTL-ответы могли быть получены после инъекции ДНК другими способами (внутривенно и интрадермально), наилучшие защитные именные ответы в мышах индуцировались после внутримышечной инъекции ДНК. В-четвертых, миобласты и миоциты могли узнаваться и лизироваться CTL in vitro, и этот лизис мог усиливаться предобработкой γ-интерфероном, который стимулирует экспрессию МНС класса I. Наконец, трансплантация стабильно трансфицированных, экспрессирующих NP миобластов в не инфицированных ранее сингенных мышей приводила к образованию защитных клеточно-опосредованных иммунных реакций in vivo (фиг. 20). Таким образом, экспрессия антигенов мышечными клетками достаточна для индуцирования защитных иммунных реакций, обнаруживаемых после инъекции ДНК. Кроме того, поглощение и экспрессия ДНК немышечными клетками могут не требоваться для генерирования защитного иммунитета. С точки зрения полинуклеотидов в качестве вакцин, потенциально было бы выгодно ограничить поглощение ДНК только мышечными клетками. Во-первых, миоциты полностью дифференцированы и не делятся. Это могло бы быть важным для уменьшения возможности интеграции плазмидной ДНК в хромосомную ДНК и поддержания экспрессии антигена, что могло бы приводить к длительным иммунным ответам. Во-вторых, миоциты представляют собой большие, многоядерные клетки, которые могут быть регенерированы слиянием миобластов. Это может помочь объяснить, почему инъекция ДНК приводит к экспрессии белка, которая может потенциально сохраняться в течение длительных периодов времени без обнаружения цитолитического разрушения под влиянием СТL.
Пример 14
Исследования защиты
Иммунизация ДНК, кодирующей антигены вируса гриппа, обеспечивала защиту от смерти и заболеваемости и снижала вирусные нагрузки при множестве комбинаций штаммов вируса гриппа при применении двух широко признанных моделей для инфекции гриппа человека (мышей и хорьков).
1. Гетерологичная (гетеротипичная, общая для группы) защита (иммунитет) не обеспечивается эффективно лицензированной вакциной с убитым вирусом, но обеспечивается вакцинацией ДНК в моделях животных. Эта защита была продемонстрирована при инъекции в лабораторных животных ДНК, кодирующей NP или М1. Перекрестно-реактивный клеточно-опосредованный иммунный ответ (СМI), индуцированный вакцинацией этих ДНК, обеспечивал защитный ответ.
а). Мыши: ВALB/с и С3H мышей инъецировали внутримышечно ДНК, кодирующей NР из А/PR/34; эти мыши были защищены от смерти и от болезни (оцениваемой по снижению массы тела) при заражении всех дыхательных путей LD90 А/Hong kong/68 (Н3N2), гетеротипичным штаммом (Н3 против H1 для А/PR/34). Фиг.21 показывает выживание ВALВ/с мышей, иммунизированных 3 раза NP ДНК (200 мкг на дозу) с 3-недельными интервалами и зараженными через 3 недели после последней иммунизации. Фиг.22 показывает подавление потери массы после заражения в иммунизированных мышах по сравнению с тяжелой потерей массы тела, испытываемой контрольными мышами. Фиг.23 показывает уменьшение в вирусной нагрузке в легких спустя 7 дней после заражения верхних дыхательных путей мышей, иммунизированных NP ДНК, по сравнению с мышами, получавшими контрольную ДНК. Мыши, иммунизированные NP ДНК были полностью защищены от смерти, испытывали пониженную потерю массы и обнаружили меньшую вирусную нагрузку (вирусный титр) в легких при сравнении с контрольными мышами. Было найдено, что количество NP ДНК, требуемое для защиты мышей от смерти и потери массы, составляет ≤6,35 мкг на инъекцию при предоставлении 3 инъекций (фиг.24). Было обнаружено, что зашита, создаваемая иммунизацией NР ДНК, сохраняется практически неизменной в течение по меньшей мере 3 месяцев в иммунизированных мышах. Уровень защиты сохранялся до 6 месяцев, но слегка снижался между 3-м и 6-м месяцами после последней иммунизации. Однако повторная вакцинация однократной инъекцией NP ДНК при 22 неделях, за 3 недели перед заражением на 25-й неделе, восстанавливала полную защиту (фиг.25). Таким образом, иммунизация мышей NP ДНК продуцировала длительную, усиливаемую повторной иммунизацией гетерологичную защиту. Способность генерировать анамнестический ответ при повторной вакцинации этих животных предполагает, что иммунизация NP ДНК индуцировала иммунологическую память.
b). Хорьки: Хорьков обычно применяют в качестве модели для инфицирования вирусом гриппа человека, поскольку они восприимчивы к инфицированию большим разнообразием изолятов вируса гриппа человека. Репликация вируса в хорьке осуществляется преимущественно в ноздрях и трахее и в гораздо меньшей степени в легких, в противоположность мышам, в которых вирусная нагрузка (титр) очень велика в легких. Инфицирование в хорьках прослеживается наиболее легко титрованием вируса в назальной промывной жидкости. Хорьки, иммунизированные NР ДНК или М1 ДНК, отдельно или в комбинации, из штамма, недавно полученного из людей (А/Beijing/89, Н3N2) обнаружили значительно уменьшенное выделение вируса на 1-6-й дни при заражении культурой А/Georgia/93 (Н3N2) (фиг.26). Этот изолят обнаруживал антигенный дрейф от штамма А/Beijing/89, так что лицензированная вакцина против А/Beijing/89 давал слабую защиту или вообще не давал защиты у людей против заболевания, вызываемого А/Georgia/93. Хорьки, иммунизированные ДНК, кодирующей внутренние белки А/PR/34, обнаружили значительно уменьшенное выделение вируса в носу на 5-6-й дни после инфицирования гомологичным штаммом, А/РR/34 (фиг.27). Снижение выделения вируса наблюдали после заражения А/Georgia/9З в ранних и более поздних временных точках, в то время как только позднее уменьшение в выделении вируса наблюдали после заражения А/РR/34; это может быть обусловлено различием в вирулентности между этими двумя штаммами для хорьков.
2. Гомологичная (гомотипическая, типоспецифическая) защита была легко продемонстрирована как в мышах, так и в хорьках, иммунизированных НА ДНК.
а) Мыши: BALB/с мыши, иммунизированные НА ДНК (А/PR/34), были полностью защищены против заражения LD90 A/PR/34. Иммунизированные мыши не умирали (фиг.28) и не испытывали потери массы более чем 5% (фиг.29) после заражения, тогда как 90-100% мышей умирали и испытывали тяжелые потери массы тела. Титрование дозы HА ДНК, требуемой для достижения защиты, показало, что 3 инъекции по 1 мкг НА ДНК были достаточны для достижения полной защиты (фиг.30).
b) Хорьки, иммунизированные ДНК, кодирующей НА из А/РR/34, имели значительно более низкое выделение вируса на 1-6-й дни после гомологичного заражения, чем хорьки, получавшие контрольную ДНК (фиг.31). Также хорьки, иммунизированные НА ДНК А/Georgia/93, имели уменьшенное выделение вируса на 1-й день и на 3-7-й дни после гомологичной инфекции (фиг.32). H1 антитела присутствовали против соответствующих штаммов в сыворотках из всех иммунизированных хорьков (vide supra). Таким образом, иммунизация НА ДНК продуцирует гомологичную защиту.
3. Вакционные комбинации: На хорьках испытывали способность НА ДНК обеспечивать лучшую широту (диапазон) защиты при комбинировании с ДНК NP и M1.
а) Диапазон защиты против разновидностей с антигенным дрейфом: Антигенный дрейф, происходящий между штаммами А/Beijing/89 и А/Beijing/92 был достаточного диапазона, чтобы многие люди, иммунизированные лицензированной вакциной, содержащей штамм А/Beijing/89, не были защищены против заболевания, вызываемого разновидностью А/Beijing/92. В Северной Америке широко распространенное заболевание было вызвано полевыми штаммами А/Beijing/92-подобного вируса, например A/Georgia/93. Полевые изоляты Северной Америки антигенно сходны со штаммом типа А/Beijing/92, но отличаются по географическому месту их выделения и в их истории пассирования, так как их пассировали в культуре клеток млекопитающих, а не в яйцах. Однако по аминокислотной последовательности НА А/Beijing/92-подобные штаммы отличались от А/Beijing/89-подобных штаммов только 11 точковыми мутациями (положения 133, 135, 145, 156, 157, 186, 190, 191, 193, 226 и 262) в районе НАI. Поэтому мы пытались определить, сможет ли комбинирование гомотипических иммунных ответов, индуцируемых НА ДНК, с перекрестно-реактивными СMI ответами, индуцируемыми ДНК NP и M1, обеспечить большую степень защиты против этой разновидности с антигенным дрейфом. Иммунизация хорьков лицензированной вакциной, содержащей штамм А/Beijing/89, или НА ДНК из А/Beijing/89 или А/Beijing/89-подобным полевым изолятом (А/Hawaii/91) дала уменьшение выделения вируса при заражении хорьков A/Georgia/93 (фиг. 33). Хорьки, иммунизированные комбинированной РNV, содержащей ДHK NP, М1 и НА, имели значительно меньшее выделение вируса, чем хорьки, иммунизированные лицензированным продуктом или одной НА ДНК (фиг. 34). В случае НА ДНК А/Hawaii/91, комбинированной с ДНК NP и М1 А/Beijing/89, полученная защита не отличалась значительно от максимальной защиты, обеспечиваемой НА ДНК гомологичного А/Georgia/93 (фиг.35). Таким образом, комбинирование ДНК НА, NP и МI дало улучшенную защиту (иммунитет) против разновидности с антигенным дрейфом по сравнению с лицензированной вакциной.
b) Влияние истории пассирования вакционного антигена: Хорьки, иммунизированные вакциной, состоящей из НА последовательности ДНК, полученной из полевого изолята США, пассированного в клетках МDСК в культуре ткани (A/Hawaii/91), обнаружили меньшее (р=0,021 согласно двухфакторному АNOVA) выделение вируса, чем хорьки, получавшие лицензированную вакцину с убитым вирусом, содержащую пассированный в яйцах штамм А/Beijing/89, при заражении штаммом с антигенным дрейфом А/Georgia/93 (фиг.33). B противоположность этому, хорьки, получавшие НА ДНК из А/ Beijing/89, не испытывали отличающегося значительно выделения вируса (р=0,058) после заражения A/Georgia/93 по сравнению с хорьками, получавшими лицензированную вакцину, содержащую идентичный вирус. Росшие в яйцах и в клетках млекопитающих штаммы отличаются двумя точковыми мутациями в районе HAI НА (положения 186 и 193), обе из которых расположены в антигенном сайте В, вблизи к апексу мономера НА в районе, который считают важным для связывания H1-антител и нейтрализующих антител. В некоторых случаях способность некоторых изолятов вируса гриппа связываться с RBC цыпленка является исходно очень низкой, но увеличивается последующими пассажами в яйцах, что позволяет предположить, что район связывания рецептора НА может подвергаться существенному отбору путем выращивания в птичьих клетках. Влияние небольших изменений в последовательности на эффективность вакцин против гриппа на основе НА в лабораторных животных указывает на потенциальную важность сохранения по возможности последовательности вируса дикого типа при изготовлении таких вакцин.
с) Приматы кроме человека: Приматы кроме человека не используются обычно для моделей заражения гриппом из-за отсутствия клинических ответных реакций на инфекцию. Однако мы исследовали иммуногенность РNV вакцинных комбинаций в приматах кроме человека по сравнению с лицензированными вакцинами, содержащими убитый вирус. Титры антител, индуцируемых комбинированной PNV, содержащей гены НА и внутренних белков, были по меньшей мере равноценны титрам лицензированного продукта при одинаковой продолжительности ответной реакции (vide supra). Африканские зеленые мартышки, иммунизированные PNV, отвечали на НА РNV для разновидности с антигенным дрейфом, показывая, что тип-специфические ответные реакции на PNV могут образовываться в ранее иммунизированных индивидуумах. Мартышки, иммунизированные PNV, также отвечали на последующую иммунизацию общепринятой содержащей убитый вирус вакциной.
4. Заключение: Полинуклеотидные вакцины против гриппа эффективны в моделях лабораторных животных инфекции гриппа. Гомологичная защита может достигаться с применением ДНК-векторов, кодирующих НА, наиболее вероятно, посредством иммунологического механизма, аналогичного механизму, индуцируемому белком НА, применяемым в существующей лицензированной вакцине против гриппа. Гетерологичная защита может достигаться против штаммов с антигенной изменчивостью и антигенным дрейфом также включением в вакцину ДНК, кодирующих внутренние белки вируса гриппа. Комбинирование этих подходов улучшало защиту против разновидностей с антигенным дрейфом по сравнению с существующей лицензированной вакциной в модели хорьков.
Пример 15
Получение векторов VIR
Пытаясь оптимизировать далее наш основной вектор, применяемый для вакцинации, мы приготовили производное VIJns, которое обозначали как VIR. Целью конструирования этого вектора было получение вектора минимального размера для вакцины, т. е. без необязательных последовательностей ДНК, который все еще сохраняет все оптимизированные характеристики гетерологических генов и высокие выходы плазмиды, которые характерны для VIJ и VIJns. Мы определили из литературы, а также посредством эксперимента, что (1) районы внутри структуры pUC, содержащей затравку репликации Е.coli, можно было бы удалить без влияния на выход плазмиды из бактерий; (2) 3'-район гена kanr после открытой рамки считывания канамицина мог бы быть удален, если бы вместо него был встроен бактериальный терминатор; и (3) ~ 300 п.н. из 3'-половины терминатора BGН можно было бы удалить без влияния на его регуляторную функцию (после сайта исходного фермента KpnI внутри элемента BGH).
VIR был сконструирован при помощи PCR, синтезирующей 3 сегмента ДНК из VIJns, представляющие собой СМVintA промотор/ВGH терминатор, затравку репликации и элементы устойчивости к канамицину соответственно. Рестриктазы, уникальные для каждого сегмента добавляли к концу каждого сегмента с применением РСR олигомеров: SspI и XhoI для CMVintA/BGH; EcoRV и BamНI для kanr гена; и ВсlI и SalI для orir. Эти ферменты были выбраны, поскольку они позволяют направленно лигировать каждый из полученных при помощи РСR сегментов ДНК с последующей потерей каждого сайта: EcoRV и SspI покидают ДНК с тупыми концами, которые пригодны для лигирования, тогда как BamHI и ВсlI покидают комплементарные выступы, так же как SalI и XhoI. После получения этих сегментов при помощи PCR каждый сегмент расщепляют подходящими рестриктазами, указанными выше, и затем лигируют вместе в одной реакционной смеси, содержащей все три сегмента ДНК. 5'-конец orir был сконструирован таким образом, чтобы он включал в себя T2 rho независимую терминаторную последовательность, которую нормально обнаруживают в этом районе, так чтобы она могла обеспечить информацию о терминации для гена устойчивости к канамицину. Лигированный продукт проверяли расщеплением рестриктазами (более 8 ферментов), а также секвенированием ДНК лигирующих соединений. Выходы плазмиды и гетерологичная экспрессия с применением вирусных генов внутри VIR, по-видимому, сходны с VIJns. В целом было достигнуто уменьшение в размере вектора на 1346 п.н. (VIJns - 4,86 т.п.н.; VIR - 3,52 т.п.н.) см. фиг.36, SEQ.ID:45:.
PCR-олигомерные последовательности, примененные для синтеза VIR (сайты рестриктаз подчеркнуты и идентифицированы в квадратных скобках после последовательности):
(1) 5'-GGT ACA AAT ATT GG CTA TTG GCC ATT GCA TAC-G-3' [SspI], SEQ.ID: 60:,
(2) 5'-CCA CAT CTC GAG GАА ССG GGТ CAA TTC TTC АGC АСС-3' [XhoI], SEQ. ID:61:
(для сегмента CMVintA/BGH),
(3) 5'-GGT АСА GAT ATC GGА ААG ССА CGT TGT GTC TCА ААА TC-3 [EcoRY], SEQ.ID:62:,
(4) 5'-CCA CAT GGA TCC G ТАА TGC ТСТ GСС AGT GTT ACA ACC-3' [ВаmНI], SEQ.ID:63:
(для сегмента гена устойчивости к канамицину),
(5) 5'-GGТ АСА TGA TCA СGТ AGA ААА GАТ САА АGG АТС ТТС TTG-3' [BсlI], SEQ.ID:64:,
(6) 5'-ССА САТ GTC GAC CC GТА ААА АGG ССG CGТ TGC TGG-3' [SalI], SEQ.ID: 32:
(для затравки репликации Е.coli).
Формула изобретения: 1. Конструкция ДНК, кодирующая белок вируса гриппа, выбираемая из плазмид V1Jns-BJ-NP или V1Jns-PA-NP (В/Раnama/45/90), содержащая промотор цитомегаловируса с последовательностью интрона А (1,64 kb); область терминации транскрипции гормона роста быка (0,55 kb), в КрnI-сайт которого встроен уникальный SfiI-cайт (13 п. н. ); ген нуклеопротеина соответствующего вируса гриппа; область начала репликации (0,64 kb); ген устойчивости к канамицину (1,30 kb).
2. Конструкция ДНК, кодирующая белок вируса гриппа, выбранная из плазмиды V1Jns-GA-HA (A/Georgia/03/93) размером 6,56 т. п. н. , в которой 5'-конец представляет собой SEQ. ID : 46, a 3'-конец - SEQ. ID : 47; плазмиды V1Jns-ТХ-НА (А/Texas/36/91) размером 6,56 т. п. н. , в которой 5'-конец представляет собой SEQ. ID : 48, а 3'-конец - SEQ. ID : 49; и плазмиды V1Jns-PA-HA (В/Раnama/45/90) размером 6,61 т. п. н. , в которой 5'-конец представляет собой SEQ. ID : 50, а 3'-конец - SEQ. ID : 51, включающая промотор цитомегаловируса с последовательностью интрона А (1,64 kb); область терминации транскрипции гормона роста быка (0,55 kb), в КрnI-сайт которого встроен уникальный SfiI-сайт (13 п. н. ); ген гемагглютинина соответствующего вируса гриппа; область начала репликации (0,64 kb); ген устойчивости к канамицину (1,30 kb).
3. Конструкция ДНК, кодирующая белок вируса гриппа, выбранная из плазмиды V1Jns-BJ-M1 (A/Beijing/353/89) размером 5,62 т. п. н. , в которой 5'-конец представляет собой SEQ. ID : 54, а 3'-конец - SEQ. ID : 55; и плазмиды V1Jns-Ра-M1 (В/Раnama/45/90) размером 5,61 т. п. н. , в которой 5'-конец представляет собой SEQ. ID : 58, а 3'-конец - SEQ. ID : 59, включающая промотор цитомегаловируса с последовательностью интрона А (1,64 kb); область терминации транскрипции гормона роста быка (0,55 kb), в KрnI-сайт которого встроен уникальный SfiI-сайт (13 п. н. ); ген матричного белка соответствующего вируса гриппа; область начала репликации (0,64 kb); ген устойчивости к канамицину (1,30 kb).
4. ДНК-вектор для применения в качестве основы для вакцины, представляющий собой V1Jns, включающий промотор цитомегаловируса с последовательностью интрона А (1,64 kb); область терминации транскрипции гормона роста быка (0,55 kb), в КрnI-сайт которого встроен уникальный SfiI-cайт (13 п. н. ); область начала репликации (0,64 kb); ген устойчивости к канамицину (1,30 kb), как представлено на фиг. 17.
5. Иммуногенная композиция для индукции специфического для вируса гриппа иммунитета, содержащая в качестве активного агента эффективное количество нуклеиновой кислоты, отличающаяся тем, что для индукции иммунитета используют конструкцию ДНК по любому из пп. 1-3.
6. Вакцина против вируса гриппа, содержащая конструкцию ДНК по любому из пп. 1-3.
7. Способ индукции специфического для вируса гриппа иммунного ответа у субъекта, отличающийся тем, что включает введение субъекту конструкции ДНК по п. 1.
8. Способ вакцинации субъекта, отличающийся тем, что включает введение субъекту конструкции ДНК по п. 1.