Forbidden

You don't have permission to access /zzz_siteguard.php on this server.

ПАРА СИНТЕТИЧЕСКИХ ОЛИГОНУКЛЕОТИДОВ-ПРАЙМЕРОВ, ИСПОЛЬЗУЕМЫХ ДЛЯ ВЫЯВЛЕНИЯ ДНК ВИРУСА ПРОСТОГО ГЕРПЕСА ЧЕЛОВЕКА 6 ТИПА - Патент РФ 2193067
Главная страница  |  Описание сайта  |  Контакты
ПАРА СИНТЕТИЧЕСКИХ ОЛИГОНУКЛЕОТИДОВ-ПРАЙМЕРОВ, ИСПОЛЬЗУЕМЫХ ДЛЯ ВЫЯВЛЕНИЯ ДНК ВИРУСА ПРОСТОГО ГЕРПЕСА ЧЕЛОВЕКА 6 ТИПА
ПАРА СИНТЕТИЧЕСКИХ ОЛИГОНУКЛЕОТИДОВ-ПРАЙМЕРОВ, ИСПОЛЬЗУЕМЫХ ДЛЯ ВЫЯВЛЕНИЯ ДНК ВИРУСА ПРОСТОГО ГЕРПЕСА ЧЕЛОВЕКА 6 ТИПА

ПАРА СИНТЕТИЧЕСКИХ ОЛИГОНУКЛЕОТИДОВ-ПРАЙМЕРОВ, ИСПОЛЬЗУЕМЫХ ДЛЯ ВЫЯВЛЕНИЯ ДНК ВИРУСА ПРОСТОГО ГЕРПЕСА ЧЕЛОВЕКА 6 ТИПА

Патент Российской Федерации
Суть изобретения: Изобретение относится к биотехнологии, в частности к генетической инженерии, и может быть использовано для идентификации ДНК вируса герпеса человека 6 типа (ВГЧ-6). Выбранная пара праймеров специфична к участку гена U-11 ВГЧ-6, консервативному для разных серотипов ВГЧ-6 и имеющему низкую гомологию с соответствующими генами других герпесвирусов. Амплифицируемый участок гена U-11 ВГЧ-6 кодирует часть белка тегумента р100, который является одним из основных антигенов ВГЧ-6. Предложенная уникальная пара олигонуклеотидов (нуклеотидная последовательность приведена в формуле) не дает перекрестных реакций с родственными видами, что позволяет, ограничиваясь одноступенчатой процедурой проведения реакции, быстро и надежно определять наличие или отсутствие ДНК ВГЧ-6 в пробе. 3 ил.
Поиск по сайту

1. С помощью поисковых систем

   С помощью Google:    

2. Экспресс-поиск по номеру патента


введите номер патента (7 цифр)

3. По номеру патента и году публикации

2000000 ... 2099999   (1994-1997 гг.)

2100000 ... 2199999   (1997-2003 гг.)
Номер патента: 2193067
Класс(ы) патента: C12P19/30, C12Q1/68, C07H21/04
Номер заявки: 2001118685/13
Дата подачи заявки: 05.07.2001
Дата публикации: 20.11.2002
Заявитель(и): Государственный научный центр вирусологии и биотехнологии "Вектор"
Автор(ы): Суслопаров М.А.; Суслопаров И.М.; Плясунов И.В.; Махова Н.М.; Бахтина М.М.
Патентообладатель(и): Государственный научный центр вирусологии и биотехнологии "Вектор"
Описание изобретения: Изобретение относится к биотехнологии, в частности к генетической инженерии, и может быть использовано для диагностической идентификации ДНК вируса герпеса человека 6 типа (ВГЧ-6), а также для решения научно-исследовательских задач по изучению герпесвирусов.
В последние годы разрабатываются методы диагностики вирусных инфекций, которые можно объединить понятием "генодиагностика". Эти методы позволяют обнаруживать специфичные гены или последовательности ДНК, являющиеся характерными для определенного вида возбудителя инфекционного заболевания. Следует заметить, что "генодиагностические" методы разрабатываются не для того, чтобы вытеснить уже имеющиеся иммунологические и другие методы, но наоборот, с целью дополнить их, позволяя решать те задачи диагностики инфекционных заболеваний, которые ранее были недоступны классическим методам (1, 2). Наиболее перспективным из методов "генодиагностики" является метод полимеразной цепной реакции (ПЦР), в основе которого лежит многократное копирование с помощью фермента ДНК-полимеразы определенного фрагмента ДНК, являющегося маркерным для данного вида возбудителя инфекционного заболевания. ПЦР является прямым методом выявления ДНК вируса и имеет высокую степень чувствительности. Данный метод незаменим в ряде случаев клинической практики (например, в практике трансплантологии, тестирование в женских консультациях).
Для проведения ПЦР необходимы праймеры, синтетические олигонуклеотиды, специфичные для определенного вида вируса. Праймеры должны быть комплементарны последовательностям ДНК на левой и правой границе специфического фрагмента и ориентированы таким образом, чтобы синтез ДНК, осуществляемый термофильной ДНК-полимеразой, протекал только между ними. В результате происходит экспоненциальное увеличение количества копий специфического фрагмента. От правильно выбранных праймеров, определяющих специфичность ПЦР, зависит строгость диагностики видоспецифичности ДНК. С помощью соответствующим образом подобранных праймеров можно выявить ДНК целых родов или семейств микроорганизмов.
Известен способ специфического определения ДНК вируса герпеса человека 6 типа, предусматривающий амплификацию ДНК в жидкой смеси, содержащей ДНК-полимеразу, водную жидкую пробу и комбинацию праймеров, при этом в качестве гена - мишени используют ген U57, кодирующий основной капсидный белок (3). Высокая специфичность ПЦР может быть достигнута за счет применения внутренних праймеров, т. н. "nested" ПЦР (4), а также способа ПЦР с дальнейшим использованием специфических рестриктаз (5). Недостатками описанных подходов выявления ДНК вируса герпеса человека 6 типа является дороговизна и недоступность покупных праймеров, особенно для "nested" ПЦР, предлагаемых зарубежными фирмами, а также трудоемкость проведения процедуры двуступенчатого анализа клинических образцов.
Технической задачей изобретения является выявление ДНК ВГЧ-6 с высокой степенью специфичности в клинических образцах, ограничиваясь одноступенчатой процедурой проведения ПЦР.
Поставленная задача решается посредством подбора пары праймеров для амплификации заданного отрезка нуклеотидной последовательности генома вируса герпеса человека 6 типа. Для подбора нужных праймеров с помощью компьютерной программы PC GENE были проанализированы последовательности ДНК уже известных в мире штаммов вирусов (4, 5). Были выявлены консервативные районы ДНК вируса герпеса человека 6 типа, не имеющие гомологии с другими вирусами герпеса с целью исключения перекрестного реагирования у близких видов. С помощью компьютерной программы "OLIGO" были подобраны синтетические олигонуклеотиды-праймеры следующего состава:
5' TGCTATATGGCAAGACATCACGA - 3'
3' ACCAGТТТCGATCТТТТCCAACG - 5'
Рассчитанная длина продукта ПЦР для данных праймеров составляет 405 пн. Выбранные праймеры специфичны к участку гена U-11 ВГЧ-6, консервативному для разных серотипов ВГЧ-6 и имеющему низкую гомологию с соответствующими генами других герпесвирусов. Амплифицируемый участок гена U-11 ВГЧ-6 кодирует часть белка p100 - основного антигенного структурного белка, который согласно данным литературы является одним из основных иммунногенных белков ВГЧ-6 (6, 7).
ПЕРЕЧЕНЬ ГРАФИЧЕСКИХ МАТЕРИАЛОВ
Фиг. 1. Нуклеотидная последовательность фрагмента гена U-11 ВГЧ-6, амплифицируемая патентуемыми олигонуклеотидами - праймерами. Позиции праймеров указаны подчеркиванием.
Фиг.2. Рестрикционная карта амплифицируемого фрагмента гена U-11 ВГЧ-6.
Фиг.3. Электрофореграмма амплифицируемого фрагмента гена U-11 ВГЧ-6.
Дорожки 1, 8 - pUC-18/Msp-l.
Дорожки 2-7 - амплификаты, полученные при проведении ПЦР с ДНК-матрицами, полученными из геномной ДНК следующих герпесвирусов: вируса простого герпеса 1 типа, вируса простого герпеса 2 типа, цитомегаловируса человека, вируса Эпштейна-Барра, вируса герпес зостер, вируса герпеса человека 6 типа соответственно.
Дорожки 9-12 рестрикты, полученные при проведении рестрикции амплифицируемого фрагмента гена U-11 ВГЧ-6 следующими рестриктазами: Vsp-1, Rsa-1, Pst-1, Cla-1, соответственно.
Идентификация ДНК вируса герпеса человека 6 типа показана на примерах 1 и 2.
Пример 1. Амплификация участка ДНК гена U-11. Полимеразную цепную реакцию проводили на амплификаторе марки Термоцик МС 16, производитель "ДНК-технология", г. Москва.
Реакцию проводили в следующем режиме:
1 цикл: денатурация при 94oС в течение 2 мин, отжиг при 52oС в течение 0,5 мин, синтез при 72oС в течение 0,6 мин.
40 циклов: денатурация при 94oС в течение 0,5 мин, отжиг при 52oС в течение 0,5 мин, синтез при 72oС в течение 0,6 мин.
1 цикл: синтез на конечной стадии при 72oС в течение 3 мин.
Инкубационная смесь конечным объемом 50 мкл содержала:
10 мМ ТрисНCl, рН 9.0
50 мМ КСl
2 мМ MgCl2
0,1% тритон Х-100
10 мM d NTP
2 мкл праймеров,
5 мкл ДНК-матрицы. В качестве ДНК- матрицы использовали вирусную геномную ДНК, полученную из культуры клеток МТ-4, инфицированных ВГЧ-6 штамм Z-29 (ATCC VR-1348). Вирусную ДНК выделяли по методике, описанной ранее (5).
0,5-1 ед. ДНК-полимеразы Taq,
вода до объема 50 мкл.
Поверх смеси наслаивали 25 мкл минерального масла.
На фиг.3 (дорожка 7) показан электрофоретический анализ результата ПЦР в 2% агарозном геле. Амплифицированный фрагмент, имеющий размер 405 пн, был обработан рестриктазами Vsp-1, Rsa-1, Pst-1, Cla-1. На фиг. 3 (дорожки 9-12) показан электрофоретический анализ полученных рестриктов, из которого следует, что размеры полученных фрагментов соответствуют ожидаемым.
Специфичность патентуемой пары праймеров показана на примере 2.
Пример 2. Для определения специфичности патентуемой пары праймеров были проведены ПЦР-реакции, в которых в качестве ДНК-матрицы были использованы вирусные геномные ДНК следующих вирусов герпеса: вируса герпеса человека 1-го типа (штамм HF), вируса герпеса человека 2-го типа (штамм MS), цитомегаловируса человека (штамм AD-169), вируса Эпштейна-Барра (штамм Raji), вируса ветряной оспы и опоясывающего лишая (собственный изолят), вируса герпеса человека 6-го типа (штамм Z-29). ПЦР проводили в условиях, описанных в 1 примере. На фиг. 3 (дорожки 2-7) показан электрофоретический анализ результата ПЦР в 2% агарозном геле, из которого следует, что нужный фрагмент размером 405 п.о. получается только при использовании, в качестве ДНК-матрицы ДНК ВГЧ-6.
Таким образом, поставленная задача по получению пары высоко специфичных праймеров, позволяющих выявлять ДНК ВПГ 6-го типа для проведения ПЦР из различных образцов, успешно решена. Выбранные уникальные олигонуклеотиды не дают перекрестных реакций с родственными видами, позволяют, ограничиваясь одноступенчатой процедурой проведения реакции, быстро и надежно определять наличие или отсутствие ДНК ВПГ 6-го типа.
СПИСОК ЛИТЕРАТУРЫ
1. PCR (Methods & Applications), 1993, v. 2, N. 4.
2. G. J. Nuovo. PCR in situ Hibridization (Protocols and Applications), Third Edition. 1997.
3. Huang L. M. et al. Detection of human herpesvirus-6 DNA in serum or plasma. J. Med. Virol. 1992; 38:7-10.
4. P. Seccheiro et al. Detection of human herpesvirus-6 in plasma of children with primary infection and immunosupressed patients by polymerase chain reaction. J. Infect. Dis. 1995; 171:273-280.
5. Kidd I.M. et al. A multiplex PCR assay for the simultaneous detection of human herpesvirus 6 and human herpesvirus 7, with typing by enzyme cleavage of PCR products. J. Virol. Methods 1998 Jan. 70: 1 29-36.
6. Neipel F, Ellinger К, Fleckenstein В. Gene for the major antigenic structural protein (p 100) of human herpesvirus 6. J. Virol 1992; 66:3918-3924.
7. Pellet P. et al. A Strongly Immunoreactive Virion Protein of Human Herpesvirus 6 Variant В Strain Z29: Identification and Characterization of the Gene and Mapping of a Variant-Specific Monoclonal Antibody Reactive Epitope. //Virology 1993. V. 195, p. 521-531.
Формула изобретения: Пара синтетических олигонуклеотидов-праймеров, используемых для выявления ДНК вируса герпеса человека 6 типа и имеющих следующие нуклеотидные последовательности:
5'TGCTATATGGCAAGACATCACGA - 3'
3' ACCAGTTTCGATCTTTTCCAACG -5'