Главная страница  |  Описание сайта  |  Контакты
Патент на изобретение №2470072

(19)

RU

(11)

2470072

(13)

C1

(51) МПК C12N15/00 (2006.01)

C12N15/62 (2006.01)

C12N15/23 (2006.01)

(12) ОПИСАНИЕ ИЗОБРЕТЕНИЯ К ПАТЕНТУ Статус: по данным на 17.12.2012 - нет данных Пошлина:

(21), (22) Заявка: 2011129525/10, 18.07.2011

(24) Дата начала отсчета срока действия патента:

18.07.2011

Приоритет(ы):

(22) Дата подачи заявки: 18.07.2011

(45) Опубликовано: 20.12.2012

(56) Список документов, цитированных в отчете о

поиске: RU 2009118273 A. 20.11.2010. ЛУНИН В.Г. РАЗРАБОТКА СИСТЕМЫ ТЕХНОЛОГИЧЕСКИХ РЕШЕНИЙ ДЛЯ КОНСТРУИРОВАНИЯ РЕКОМБИНАНТНЫХ БЕЛКОВЫХ АНТИГЕНОВ//Автореферат диссертации. - М.: 2010, с.9, 11, 44, 47. ГИНЦБУРГ А.Л. и др. ПОЛУЧЕНИЕ РЕКОМБИНАНТНОГО ИНТЕРФЕРОНА-бета ЧЕЛОВЕКА НА ОСНОВЕ ТЕХНОЛОГИИ АФФИННЫХ ДОМЕНОВ//Молекулярная генетика, микробиология и вирусология. - 2009, N 4, с.38-41.

Адрес для переписки:

109044, Москва, Лавров пер., 6, стр.5, ФБУ "Государственный институт кровезаменителей и медицинских препаратов"

(72) Автор(ы):

Гришин Дмитрий Викторович (RU),

Сдобнова Марина Юрьевна (RU)

(73) Патентообладатель(и):

ФГУ ГОСУДАРСТВЕННЫЙ ИНСТИТУТ КРОВЕЗАМЕНИТЕЛЕЙ И МЕДИЦИНСКИХ ПРЕПАРАТОВ (RU)

(54) РЕКОМБИНАНТНАЯ ПЛАЗМИДНАЯ ДНК pGD-14, СОДЕРЖАЩАЯ ГИБРИДНЫЙ ГЕН, ВКЛЮЧАЮЩИЙ НУКЛЕОТИДНУЮ ПОСЛЕДОВАТЕЛЬНОСТЬ ДЕКСТРАНСВЯЗЫВАЮЩЕГО ДОМЕНА БЕТА-КОККОВ, ОБЪЕДИНЕННУЮ С ГЕНОМ ГАММА-ИНТЕРФЕРОНА ЧЕЛОВЕКА ЧЕРЕЗ КИСЛОТОЛАБИЛЬНЫЙ СПЕЙСЕР, ОПРЕДЕЛЯЮЩАЯ БИОСИНТЕЗ ХИМЕРНОЙ БЕЛКОВОЙ КОНСТРУКЦИИ ДСД(сп)ЧГИФ

(57) Реферат:

Изобретение относится к области биотехнологии и может быть использовано для получения рекомбинантного гамма-интерферона человека (ЧГИФ). Сконструирована плазмидная ДНК pGD-14, определяющая экспрессию в клетках бактерии Escherichia coli гибридной генно-инженерной конструкции, состоящей из N-концевой последовательности декстрансвязывающего домена бетакокков (ДСД) и гена ЧГИФ, объединенных в одной рамке считывания через аспартат-пролиновый (сп) кислотолабильный спейсер. Изобретение обеспечивает стабильную экспрессию гена ДСД(сп)ЧГИФ на уровне 20% от тотального белка трансформированной клетки Escherichia coli. 3 ил., 3 пр.

Изобретение относится к биотехнологии, в частности к генетической инженерии.

Известна последовательность гена гамма-интерферона человека с соответствующими регуляторными элементами, обеспечивающая экспрессию чужеродного белка в прокариотических системах. Однако данная конструкция не обладает достаточным уровнем экспрессии в клетках Escherichia coli (E.coli), порядка 10% от тотального белка клетки-продуцента.

Известно, что некоторые функциональные белковые домены могут быть эффективными белками-носителями, не только обеспечивающими шаперонный эффект и способствующими увеличению растворимости химерных белков, но и увеличивающими уровень экспрессии сопутствующих рекомбинантных белков при их взаимном объединении в одной рамке считывания [1].

Известна также генная последовательность, определяющая биосинтез декстрансвязывающего домена (ДСД) декстрансахаразы бетакокков (Leuconostoc mesenteroides) [2].

Известна экспрессионная плазмида pGD-10, содержащая последовательность декстрансвязывающего домена бетакокков, объединенного с геном бета-галактозидазы [3], характеризующаяся последовательностью нуклеотидов, приведенной в виде SEQ ID NO:1.

Технический результат изобретения состоит в том, что предложена и получена гибридная генно-инженерная конструкция размером 932 п.н., включающая N-концевую последовательность декстрансвязывающего домена из бетакокков в качестве белка-носителя с потенциальными аффинными свойствами, объединенную с геном гамма-интерферона человека через двойной кислотолабильный аспартатпролиновый спейсер (Asp-Pro-Asp-Pro), чувствительный к воздействию муравьиной кислоты [4], для возможности последующего отщепления декстрансвязывающего домена от аутентичного белка интерферона гамма.

На фиг.1 изображена блок-схема гибридной генноинженерной конструкции ДСД(сп)ЧГИФ , где ДСД - декстрансвязывающий домен бетакокков, СП - кислотолабильный аспартатпролиновый спейсер (apsp), ЧГИФ - человеческий гамма-интерферон.

На фиг.2 представлена физическая карта рекомбинантной плазмиды pGD-10 (SEQ ID NO:1), содержащей гибридный ген, объединяющий в одной рамке декстрансвязывающий домен из бетакокков, связанный через глицин-сериновый спейсер с геном бета-галактозидазы, где сайты узнавания эндонуклеазами рестрикции обозначены: NcoI, BglII, PstI, PvuII, EcoRI, XbaI, SmaI и т.д.

На фиг.3 представлена физическая карта целевой рекомбинантной плазмиды pGD-14 (pQE[ДСД(сп)ЧГИФ]) (SEQ ID NO:2), где сайты узнавания рестриктазами обозначены: SmaI, HindIII, KpnI, PstI, PvuII, EcoRI, SacI и т.д.

Этапы создания и верификации целевой генноинженерной конструкции.

П р и м е р 1. Ген гамма-интерферона человека был получен посредством обратной транскрипции с M-MLV ревертазой (Moloney) тотальной РНК, выделенной из клеток крови человека стандартным протоколом, при помощи реактива TRIzol (Invitrogen), с последующим проведением ПЦР с прямым и обратным корректирующими праймерами (добавленные сайты рестриктаз и кислотолабильного спейсера (Asp-Pro-Asp-Pro) подчеркнуты). В качестве ДНК-матрицы для ПЦР использовалась кДНК, полученная в процессе обратной транскрипции.

Корректирующие праймеры для гена гамма-интерферона были синтезированы в ЗАО Евроген:

F INFG - 5'- CCATGGCCCGGGGATCCTGATCCT ATGGGCTGCAACCACCTTCGCCCCCAGGAT-3'

NcoI SmaI(Asp-Pro-Asp-Pro)

R INFG - 5'- AAGCTTAGATCT TTAAGATCTCGTGTTGCCTGTGA-3'

BglII HindIII

П р и м е р 2. ПЦР проводили на приборе Терцик (ДНК - технология, Россия). 25 мкл реакционной смеси содержали: 2,5 мкл Taq pol PCR buffer 10x (СибЭнзим), дНТФ в конечной концентрации 400 мкМ, 4x10 -7 M каждого праймера, 1 мкл Taq pol (СибЭнзим) 5 ед. активности на реакционный объем, в качестве ДНК-матрицы использовалась кДНК, полученная на предыдущем этапе. На реакционную смесь наслаивали 40 мкл вазелинового масла.

Параметры амплификации:

95°С - 5 мин; (94°С - 5 с, 60 °С - 30 с, 72°С - 40 c)x30; 72°С - 5 мин; 10°С - хранение. Режим амплификации - точный.

Продукт амплификации размером 524 п.н. обрабатывали хлороформом, переосаждали этанолом и ресуспендировали в буфере TrisHCl 0,05mM, pH7,5. ПЦР-продукт, представляющий собой ген гамма-интерферона человека, оптимизированный для интеграции в полилинкеры плазмидных векторов серии pQE, встраивался по уникальным сайтам рестрикции SmaI/BglII в вектор pGD-10, который уже содержал необходимый ген декстрансвязывающего домена. Лигирование рестрикционных фрагментов проводилось посредством ДНК-лигазы фага Т4 при 4°С в соответствующем буфере, в течение 24 часов. После лигирования получали новую экспрессионную плазмидную конструкцию pGD-14, характеризующуюся последовательностью нуклеотидов, приведенной в виде SEQ ID NO:2 и включающую гибридный ген размером 932 п.н., объединяющий генные последовательности ДСД и ЧГИФ в одной рамке считывания.

Лигазной смесью, методом электропорации (2,5кВ; 4 с), трансформировали компетентные клетки E.coli М15, которые затем отбирали на агаризованной среде LB с антибиотиками (ампициллин, канамицин). Впоследствии плазмидная ДНК (pGD-14) выделялась методом SDS щелочного лизиса и проверялась методом рестрикционного скрининга и секвенирования на автоматическом секвенаторе.

П р и м е р 3. Уровень экспрессии ДСД(сп)ЧГИФ в клетках трансформантов оценивался посредством гель-элестрофореза по Леммли в 12% ПААГ и составлял в среднем 20% от тотального белка клетки, что доказывает эффективность декстрансвязывающего домена декстрансахаразы бетакокков в качестве домена-носителя для увеличения продукции белков, ценных с биомедицинской и промышленной точек зрения, в клетках E.coli. Помимо экспрессии было также установлено, что полученная конструкция обладает 60-70% уровнем растворимости.

Таким образом, полученная экспрессионная плазмидная ДНК pGD-14, содержащая гибридную генно-инженерную конструкцию размером 932 п.н., включающую N-концевую последовательность декстрансвязывающего домена из бетакокков, объединенную с геном гамма-интерферона человека через кислотолабильный аспартат-пролиновый спейсер, характеризуется значительной экспрессией гена ДСД(сп)ЧГИФ (20% от тотального белка E.coli). Настоящее изобретение может быть применено в научных исследованиях, а также для трансформации бактериальных клеток при создании продуцентов фармакологически ценных рекомбинантных белков.

Литература

1. Choi, J. H., and Lee, S. Y. Secretory and extracellular productin of recombinant protein using Escherichia coli./ Appl. Microbiol. Biotechnol. - 2004. V. 64. - P.625-635.

2. Suwannarangseea, S., Chulalaksananukula, W. Search for a dextransucrase minimal motif involved in dextran binding. FEBS Letters 581. - 2007. - P.4675-4680.

3. Гришин Д.В. Химерная белковая конструкция ДСД-сп- -ГАЛ, имеющая активность фермента бета-галактозидазы и способная аффинно связываться с сорбентами на базе декстрана, рекомбинантная плазмидная ДНК pGD-10, определяющая синтез белка ДСД-сп- -ГАЛ, штамм E.coli DH5a - продуцент белка ДСД-сп- -ГАЛ. Положительное решение о выдаче патента по заявке 2009118273.

4. Yifeng Li, Xia Li et al. Cloning, expression, isotope labeling, and purification of human antimicrobial peptide LL-37 in Escherichia coli for NMR studies Protein Expression and Purification. - 2005. - P.1-8.

Приложение

SEQ ID NO:1 Нуклеотидная последовательность рекомбинантной плазмиды pGD-10 размером 5111 п.н.

SEQ ID NO:2 Нуклеотидная последовательность рекомбинантной плазмиды pGD-10 размером 3346 п.н.

SEQ ID NO:3 Смысловая нуклеотидная последовательность, кодирующая гибридный ген, объединяющий в рамке считывания декстрансвязывающий домен бетакокков и ген человеческого гамма- интерферона, и соответствующая ей и аминокислотная последовательность.

Формула изобретения

Плазмидная ДНК pGD-14, определяющая экспрессию в клетках бактерии Escherichia coli гибридной генно-инженерной конструкции, состоящей из N-концевой последовательности декстрансвязывающего домена бета-кокков (ДСД) и гена человеческого гамма-интерферона (ЧГИФ), объединенных на генно-инженерном уровне в одной рамке считывания через аспартат-пролиновый кислотолабильный спейсер (сп) и характеризующаяся последовательностью нуклеотидов, приведенную в виде SEQ ID NO:2.

РИСУНКИ