Главная страница  |  Описание сайта  |  Контакты
Патент на изобретение №2476595

(19)

RU

(11)

2476595

(13)

C2

(51) МПК C12N7/04 (2006.01)

A61K39/00 (2006.01)

(12) ОПИСАНИЕ ИЗОБРЕТЕНИЯ К ПАТЕНТУ Статус: по данным на 18.02.2013 - нет данных Пошлина:

(21), (22) Заявка: 2008151507/10, 12.06.2007

(24) Дата начала отсчета срока действия патента:

12.06.2007

Приоритет(ы):

(30) Конвенционный приоритет:

12.06.2006 US 60/812,592

14.12.2006 EP PCT/EP2006/069734

(43) Дата публикации заявки: 20.07.2010

(45) Опубликовано: 27.02.2013

(56) Список документов, цитированных в отчете о

поиске: WO 2004084940 А, 07.10.2004. KERKMANN MIREN ЕТ AL. Spontaneous formation of nucleic acid-based nanoparticles is responsible for high interferon-alpha induction by CpG-A in plasmacytoid dendritic cells. JOURNAL OF BIOLOGICAL CHEMISTRY, v.280, 9, March 2005 (2005-03), p. 8086-8093. WO 03024480 A2, 27.03.2003.

(85) Дата начала рассмотрения заявки PCT на национальной фазе: 12.01.2009

(86) Заявка PCT:

EP 2007/005188 20070612

(87) Публикация заявки PCT:

WO 2007/144150 20071221

Адрес для переписки:

105082, Москва, Спартаковский пер., 2, стр. 1, секция 1, эт.3, "ЕВРОМАРКПАТ", пат.пов. И.А.Веселицкой

(72) Автор(ы):

КИНЦЛЕР Маттиас (CH),

ПРОБА Карл (CH)

(73) Патентообладатель(и):

ЦИТОС БИОТЕХНОЛОГИ АГ (CH)

(54) СПОСОБЫ УПАКОВКИ ОЛИГОНУКЛЕОТИДОВ В ВИРУСОПОДОБНЫЕ ЧАСТИЦЫ РНК-СОДЕРЖАЩИХ БАКТЕРИОФАГОВ

(57) Реферат:

Изобретение относится к области биотехнологии. Описан способ получения композиции, включающей (i) вирусоподобные частицы, причем указанные вирусоподобные частицы являются вирусоподобными частицами РНК-содержащего бактериофага, и (ii) олигонуклеотид, причем указанный олигонуклеотид упакован в указанные вирусоподобные частицы. Также описан способ получения нуклеотидной композиции, включающей олигонуклеотиды, применимые в указанном выше способе. Также описана нуклеотидная композиция, получаемая способом настоящего изобретения, и ее применение. Указанная композиция предпочтительно обладает чистотой по меньшей мере 98%, наиболее предпочтительно по меньшей мере 99%. Изобретение может быть использовано в медицине. 3 н. и 22 з.п. ф-лы, 6 ил., 1 табл., 14 пр.

Текст описания приведен в факсимильном виде.

Формула изобретения

1. Способ получения нуклеотидной композиции, содержащей олигонуклеотид, который включает следующие стадии:

(а) обеспечения олигонуклеотида в растворе I, причем указанный олигонуклеотид содержит по меньшей мере один участок поли-G, причем указанный раствор I имеет щелочной рН, причем предпочтительно величина указанного рН равна 8-13, более предпочтительно величина указанного рН равна 12,

(б) дезагрегации указанного олигонуклеотида, причем указанная дезагрегация включает стадии:

(i) регуляции температуры раствора I до температуры I, причем указанная температура I составляет 4-70°С, предпочтительно 45-70°С, более предпочтительно примерно 50°С, и наиболее предпочтительно 50°С,

(ii) инкубирования указанного олигонуклеотида в указанном растворе I при указанной температуре I, причем указанное инкубирование проводят до тех пор, пока указанный олигонуклеотид характеризуется относительным временем начала выхода пика примерно 110% в гель хроматографии с использованием капсида бактериофага Qв в качестве стандарта, и

(iii) регуляции температуры указанного раствора I до температуры II, причем указанная температура II составляет 0-70°С, причем предпочтительно указанная температура II ниже температуры I, и также предпочтительно температура II составляет 0-25°С, наиболее предпочтительно 0-2°С,

(в) регуляции рН указанного раствора I до величины 5-8, причем предпочтительно указанную регуляцию указанной величины рН указанного раствора I проводят до тех пор, пока указанный рН составляет величину 6-7, и

(г) агрегирования указанного олигонуклеотида, причем указанное агрегирование включает стадии:

(i) обеспечения указанного олигонуклеотида в растворе II, причем величина рН указанного раствора II составляет 5-8 и указанный раствор содержит по меньшей мере 20 мМ катиона, причем указанный катион выбран из группы, состоящей из Na + , K + , NH 4 + , Li + , Са 2+ и Mg 2+ , причем предпочтительно указанный раствор II содержит 200-275 мМ указанного катиона, предпочтительно 250 мМ,

(ii) регуляции температуры раствора II до температуры III, причем указанная температура III составляет 50-99°С, предпочтительно 80-90°С, более предпочтительно примерно 85°С, и наиболее предпочтительно 85°С, (iii) инкубирования указанного олигонуклеотида в растворе II при температуре III, причем указанное инкубирование проводят до тех пор, пока указанный олигонуклеотид характеризуется относительным временем начала выхода пика 50-110% в гель хроматографии с использованием капсида бактериофага Qв в качестве стандарта, и

(iv) регуляции температуры раствора II до температуры IV, причем указанная температура IV ниже 50°С, причем предпочтительно указанная температура IV составляет 0-25°С, более предпочтительно 0-2°С.

2. Способ по п.1, в котором указанную регуляцию температуры указанного раствор I до температуры II проводят со скоростью изменения температуры по меньшей мере 3,6°С/мин.

3. Способ по п.1, в котором указанную регуляцию температуры раствора II до температуры IV проводят со скоростью изменения температуры по меньшей мере 3,6°С/мин.

4. Способ по п.1, в котором указанный раствор I включает гидроксид щелочного металла, предпочтительно гидроксида калия или гидроксида натрия, наиболее предпочтительно гидроксида натрия, причем концентрация указанного гидрохлорида составляет 10-200 мМ, предпочтительно примерно 25 мМ, наиболее предпочтительно 25 мМ.

5. Способ по п.1, в котором указанную регуляцию рН указанного раствора I осуществляют добавлением кислоты в указанный раствор I, причем предпочтительно указанная кислота является фосфорной кислотой.

6. Способ по п.1, в котором указанный катион является Na + или K + , причем предпочтительно указанный катион является Na + .

7. Способ по п.1, в котором концентрация указанного олигонуклеотида в указанном растворе I составляет от 50 мкМ до 2 мМ, наиболее предпочтительно 260 мкМ.

8. Способ по п.1, в котором концентрация указанного олигонуклеотида в указанном растворе II составляет от 50 мкМ до 2 мМ, предпочтительно 100-300 мкМ, наиболее предпочтительно 175 мкМ.

9. Способ по п.1, в котором указанное инкубирование указанного олигонуклеотида в растворе II при температуре III проводят до тех пор, пока указанный олигонуклеотид характеризуется относительным временем начала выхода пика 80-95%, предпочтительно 80-90%, еще более предпочтительно 83-90%, еще более предпочтительно 85-90%, и наиболее предпочтительно 88% в гель хроматографии с использованием капсида бактериофага Qв в качестве стандарта.

10. Способ по п.1, в котором указанный олигонуклеотид содержит с 5'-конца по меньшей мере 3 и не более 15 единиц гуанозина, и с 3'-конца по меньшей мере 3 и не более 15 единиц гуанозина, причем предпочтительно указанный олигонуклеотид содержит палиндромную последовательность, также предпочтительно указанной палиндромной последовательностью является последовательность GACGATCGTC (SEQ ID NO:1).

11. Способ по п.1, в котором указанный олигонуклеотид имеет последовательность нуклеиновой кислоты, выбранную из группы, состоящей из:

(а) «G4-4» GGGGGACGATCGTCGGGG (SEQ ID NO:2);

(б) «G5-5» GGGGGGACGATCGTCGGGGG (SEQ ID NO:3);

(в) «G6-6» GGGGGGGACGATCGTCGGGGGG (SEQ ID NO:4);

(г) «G7-7» GGGGGGGGACGATCGTCGGGGGGG (SEQ ID NO:5);

(д) «G8-8» GGGGGGGGGACGATCGTCGGGGGGGG (SEQ ID NO:6);

(е) «G9-9» GGGGGGGGGGACGATCGTCGGGGGGGGG (SEQ ID NO:7);

(ж) «G10» GGGGGGGGGGGACGATCGTCGGGGGGGGGG (SEQ ID NO:8);

(з) «G11» GGGGGGGGGGGGACGATCGTCGGGGGGGGGGG (SEQ ID NO:9).

12. Способ по одному из предшествующих пунктов, в котором указанный олигонуклеотид имеет последовательность нуклеиновой кислоты «G8-8» GGGGGGGGGACGATCGTCGGGGGGGG (SEQ ID NO:6).

13. Способ по п.1, в котором указанный олигонуклеотид имеет последовательность нуклеиновой кислоты «G10» GGGGGGGGGGGACGATCGTCGGGGGGGGGG (SEQ ID NO:8).

14. Нуклеотидная композиция для упаковки в вирусоподобную частицу РНК бактериофага, включающая олигонуклеотид, причем указанная композиция может быть получена способом по одному из пп.1-13, причем предпочтительно указанный олигонуклеотид характеризуется относительным временем начала выхода пика 50-110%, предпочтительно 80-95%, более предпочтительно 80-90%, еще более предпочтительно 83-90%, еще более предпочтительно 85-90%, и наиболее предпочтительно 88% в гель хроматографии с использованием капсида бактериофага Qв в качестве стандарта.

15. Нуклеотидная композиция по п.14, в которой указанный олигонуклеотид имеет последовательность нуклеиновой кислоты «G8-8» GGGGGGGGGACGATCGTCGGGGGGGG (SEQ ID NO:6) или «G10» GGGGGGGGGG GACGATCGTCGGGGGGGGGG (SEQ ID NO:8), причем предпочтительно указанный олигонуклеотид имеет последовательность нуклеиновой кислоты «G10» GGGGGGGGGGGACGATCGTCGGGGGGGGGG (SEQ ID NO:8).

16. Способ получения композиции, включающей (i) вирусоподобную частицу, которая является вирусоподобной частицей РНК-содержащего бактериофага, и (ii) олигонуклеотид, причем указанный олигонуклеотид упакован в указанную вирусоподобную частицу, включающий стадии:

(а) обеспечения белка оболочки указанного РНК-содержащего бактериофага,

(б) обеспечения олигонуклеотида,

(i) причем указанный олигонуклеотид включает по меньшей мере один отрезок поли-G, и

(ii) причем указанный олигонуклеотид характеризуется относительным временем выхода пика 50-110% в гель хроматографии с использованием капсида бактериофага Qв в качестве стандарта,

(в) получения смеси, причем указанная смесь включает:

(i) указанный белок оболочки, причем предпочтительно концентрация указанного белка оболочки в указанной смеси составляет 1-4 мг/мл, более предпочтительно 2,5 мг/мл, и/или также предпочтительно концентрация указанного олигонуклеотида в указанной смеси составляет 25-100 мкМ, более предпочтительно 62,5 мкМ,

(ii) агент, способный предупреждать самосборку указанного белка оболочки, причем предпочтительно указанный агент является денатурирующим соединением, выбранным из мочевины и гуанидиния гидрохлорида, также предпочтительно указанное денатурирующее соединение является мочевиной, и также предпочтительно концентрация указанной мочевины в указанной смеси составляет 0,25-7,2 М, предпочтительно 1 М,

(iii) указанный олигонуклеотид,

(г) удаления указанного агента из указанной смеси, и

(д) допущения самосборки указанного белка оболочки в вирусоподобную частицу.

17. Способ по п.16, в котором указанный белок оболочки включает, или, в другом варианте, в значительной степени состоит из рекомбинантных белков или их фрагментов РНК-содержащего бактериофага, причем предпочтительно указанный бактериофаг выбран из группы, состоящей из:

(а) бактериофага Q ,

(б) бактериофага R17,

(в) бактериофага fr,

(г) бактериофага GA,

(д) бактериофага SP,

(е) бактериофага MS2,

(ж) бактериофага M11,

(з) бактериофага MX1,

(и) бактериофага NL95,

(к) бактериофага f2,

(л) бактериофага РР7 и

(м) бактериофага АР205.

18. Способ по п.16, в котором указанным РНК-содержащим бактериофагом является бактериофаг Q .

19. Способ по п.16, в котором указанный белок оболочки включает или предпочтительно состоит из последовательности, выбранной из группы, состоящей из:

(а) SEQ ID NO:10 (Q CP),

(б) смесь SEQ ID NO:10 и SEQ ID NO:11 (Q A1 белок),

(в) SEQ ID NO:12 (белок оболочки R17),

(г) SEQ ID NO:13 (белок оболочки fr),

(д) SEQ ID NO:14 (белок оболочки GA),

(е) SEQ ID NO:15 (белок оболочки SP),

(ж) смесь SEQ ID NO:15 и SEQ ID NO:16,

(з) SEQ ID NO:17 (белок оболочки MS2),

(и) SEQ ID NO:18 (белок оболочки M11),

(к) SEQ ID NO:19 (белок оболочки MX1),

(л) SEQ ID NO:20 (белок оболочки NL95),

(м) SEQ ID NO:21 (белок оболочки f2),

(н) SEQ ID NO:22 (белок оболочки РР7) и

(о) SEQ ID NO:23 (белок оболочки АР205).

20. Способ по п.16, в котором мольное соотношение указанного олигонуклеотида и указанного белка оболочки в указанной смеси составляет 0,5-1,2, предпочтительно 0,7.

21. Способ по п.16, в котором указанный агент также является окислительным агентом, причем предпочтительно указанным окислительным агентом является дитиоэритол (ДТЭ), и также предпочтительно концентрация указанного ДТЭ в указанной смеси составляет 1-25 мМ, более предпочтительно 2,5 мМ.

22. Способ по п.16, в котором указанное удаление указанного агента из указанной смеси осуществляют первой заменой буфера на первый буфер, причем указанный первый буфер включает натрий хлорид, причем предпочтительно концентрация указанного натрия хлорида в указанном первом буфере составляет 0-1 М, предпочтительно 0-550 мМ, более предпочтительно 0-350 мМ, еще более предпочтительно 50-350 мМ, и наиболее предпочтительно 250 мМ.

23. Способ по п.16, в котором указанный способ дополнительно включает стадию контакта указанной вирусоподобной частицы с окисляющим агентом, причем предпочтительно указанный окисляющий агент выбран из группы, включающей:

(а) перекись водорода, причем предпочтительно концентрация указанной перекиси водорода составляет 0,25-50 мМ, предпочтительно 2 мМ,

(б) кислород,

(в) глутатион,

(г) Cu 2+ и

(д) Fe 3+ .

24. Способ по п.16, причем указанный способ дополнительно включает стадию очистки указанной вирусоподобной частицы, и в котором предпочтительно указанная очистка включает вторую замену буфера на второй буфер, причем указанный второй буфер является фармацевтически приемлемым буфером.

25. Способ по п.16, в котором выход белка составляет по меньшей мере 75%, и/или в котором выход олигонуклеотида составляет по меньшей мере 75%.

РИСУНКИ