Главная страница  |  Описание сайта  |  Контакты
СПОСОБ ПОЛУЧЕНИЯ ПРОРЕННИНА, СПОСОБ ПОЛУЧЕНИЯ ШТАММА ДРОЖЖЕЙ - ПРОДУЦЕНТА ПРОРЕННИНА, СПОСОБ ПОЛУЧЕНИЯ РЕКОМБИНАНТНОЙ ПЛАЗМИДНОЙ ДНК РХХ-33, СПОСОБ ПОЛУЧЕНИЯ РЕКОМБИНАНТНОЙ ПЛАЗМИДНОЙ ДНК РХХ-22, СПОСОБ ПОЛУЧЕНИЯ РЕКОМБИНАНТНОЙ ПЛАЗМИДНОЙ НК РХХ-11
СПОСОБ ПОЛУЧЕНИЯ ПРОРЕННИНА, СПОСОБ ПОЛУЧЕНИЯ ШТАММА ДРОЖЖЕЙ - ПРОДУЦЕНТА ПРОРЕННИНА, СПОСОБ ПОЛУЧЕНИЯ РЕКОМБИНАНТНОЙ ПЛАЗМИДНОЙ ДНК РХХ-33, СПОСОБ ПОЛУЧЕНИЯ РЕКОМБИНАНТНОЙ ПЛАЗМИДНОЙ ДНК РХХ-22, СПОСОБ ПОЛУЧЕНИЯ РЕКОМБИНАНТНОЙ ПЛАЗМИДНОЙ НК РХХ-11

СПОСОБ ПОЛУЧЕНИЯ ПРОРЕННИНА, СПОСОБ ПОЛУЧЕНИЯ ШТАММА ДРОЖЖЕЙ - ПРОДУЦЕНТА ПРОРЕННИНА, СПОСОБ ПОЛУЧЕНИЯ РЕКОМБИНАНТНОЙ ПЛАЗМИДНОЙ ДНК РХХ-33, СПОСОБ ПОЛУЧЕНИЯ РЕКОМБИНАНТНОЙ ПЛАЗМИДНОЙ ДНК РХХ-22, СПОСОБ ПОЛУЧЕНИЯ РЕКОМБИНАНТНОЙ ПЛАЗМИДНОЙ НК РХХ-11

Патент Российской Федерации
Суть изобретения: Использование: биотехнология, молекулярная биология, в частности получение проренинна генно-инженерным путем. Сущность изобретения: прореннин получают путем конструирования рекомбинантных плазмидных ДНК PLS/3 или РХХ-11, или РХХ-22, или РХХ-33, или PLX-34, трансформации полученными рекомбинантными ДНК штаммов J.lipolytica с последующим культивированием трансформантов, выделением и очисткой целевого продукта. При этом выделены штаммы L.lipolytica АTCC-206.88, или 20774, или 20794. Раскрыто конструирование плазмид РХХ 33, РХХ-22 и РХХ-11. 5 с. и 1 з.п. ф-лы, 17 ил., 8 табл.
Поиск по сайту

1. С помощью поисковых систем

   С помощью Google:    

2. Экспресс-поиск по номеру патента


введите номер патента (7 цифр)

3. По номеру патента и году публикации

2000000 ... 2099999   (1994-1997 гг.)

2100000 ... 2199999   (1997-2003 гг.)
Номер патента: 2069694
Класс(ы) патента: C12N15/52
Номер заявки: 4028319/13
Дата подачи заявки: 17.10.1986
Дата публикации: 27.11.1996
Заявитель(и): Пфайзер Инк. (US)
Автор(ы): Лэнс Стивен Дэвидов[US]; Джон Роберт Дизиув[US]; Артур Эрнст Фрэнке[US]
Патентообладатель(и): Пфайзер Инк. (US)
Описание изобретения: Изобретение относится к получению гетерологичных протеинов в клетках дрожжей с использованием рекомбинантных векторов клонирования Jattowia lipolytica, содержащих чужеродную ДНК, кодирующую экспрессию и секрецию протеинов млекопитающих, векторов экспрессии, содержащих промотор гена Y.lipolytica (например XPR2 или LEU2), сигнальную (или предсигнальную) последовательность щелочной протеазы, область pro и участок терминатора XPR2, а также их вариантов и функциональных эквивалентов, учитывая вырожденность генетического кода, или с использованием других генетических компонентов Y.lipolytica.
S. cerevisiae имеет ряд ограничений как система секреции протеинов. Европейская патентная заявка N 0123544, опубликованная 31 октября 1984, описывает выделение генов α-фактора и использование их промотор и/или сигнальный пептид частей в сочетании с ДНК, кодирующей чужеродные для дрожжей протеины, в плазмиде для трансформации клеток дрожжей, способных продуцировать отдельный зрелый протеин в клеточной культуре. Европейская заявка N 0088632, опубликованная 14 сентября 1983, описывает способ экспрессии и выделения чужеродного протеина в S.cerevisiae. Однако размер протеинов, которые S.cerevisiae эффективно секретирует с использованием с данных и других систем секреции, ограничен примерно 20000 дальтон. Преодоление этой неэффективности S.cerevisiae как секретирующего организма потребовало многих мутационных изменений как описано Smith и др. Science 229, 1219-1224 (1985). Единственным исключением для этого направления является наблюдение, что ферменты Aspergillus величиной более 20000, очевидно могут секретироваться S.cerevisiae, но эти ферменты в значительной степени гликозилируются S.cerevisiae, что может влиять на эффективность секреции.
Особый интерес представляет Yarrowia lipolytica, промышленно важный вид дрожжей, используемый для производства лимонной кислоты и клеточных протеинов. Он также может быть использован для получения эритрита, таннита и изопропиляблочной кислоты. В противоположность S.cerevisiae, Y.lipolytica представляет особый интерес и ценность из-за своей способности эффективно выделять высокомолекулярные протеины (щелочную протеазу, кислую протеазу и ДНК-азу) в культуральную среду, представляя таким образом потенциальную возможность извлечения чужеродных протеинов в нативном состоянии без необходимости разрушения продуцирующих клеток. Кроме того, Y.lipolytica количественно выделяет очень мало протеинов, таким образом предоставляя возможность получения нужного чужеродного протеина в питательной среде в качестве доминирующей разновидности протеинов и облегчая извлечение указанного чужеродного протеина.
Y. lipolytica производит большое количество внеклеточной протеазы. Это доминирующий протеин, выделяемый Y.lipolytica. Вид протеазы (щелочная, кислая или нейтральная) зависит от используемого штамма Y.lipolytica (Ogrydziak и др. I.Gen. Microbiol (1982) 128, 1225-1234). Частичный анализ N-концевой аминокислотной последовательности щелочной внеклеточной протеазы описан Ogrydziak и др. (местное цитирование).
Находящаяся на рассмотрении заявка N 634505, поданная 25 июля 1984, описывает методы трансформации Y.lipolytica и клонирования генов Y.lipolytica путем комплементации мутаций. В ней описано клонирование гена XРR2, который кодирует секретируемую щелочную протеазу, путем комплементации xpr2 мутаций Y.lipolytica. Метод включает трансформацию штамма-хозяина Y.lipolytica частичным Bg1II-переваром библиотеки генов Y.lipolytica в векторе pLD 40, описанный в Европейской заявке N 0138508, опубликованный 24 апреля 1985, являющейся частью вышеуказанной заявки США.
Предложенное изобретение раскрывают процесс экспрессии и секреции зрелых гетерологичных протеинов, в частности прореннина и анафилатоксина с 5 человек в культурах Y.lipolytica. Способ, раскрытый в настоящей заявке, может быть применен с соответствующими необходимыми изменениями для получения и выделения любых известных чужеродных протеинов, перечисленных в патенте США N 4532207, опубликованном 30 июля 1985 г. Кроме того, любой другой ген Y.lipolytica для секреции протеинов, такой как гены рибонуклеазы и кислой протеазы, может быть использован вместо гена XPR2, а также гибридные гены, сконструированные путем объединения фрагментов двух или более указанных генов, например сигнальной последовательности гена XPR2 и промоторной последовательности гена рибонуклеазы.
Экспрессия и секреция в Y.lipolytica прореннина и анафилатоксина С5а человека достигнута с использованием сигналов экспрессии и секреции генов Y. lipolytica XPR2 и/или LEU2. ДНК-последовательности для прореннина и человеческого анафилатоксина С5а были "сшиты" с помощью синтетических олигонуклеотидов с генной последовательностью XPR2 в сайтах, предположительно кодируемых сигнальный пептид щелочной протеазы, или в сайтах процессинга предшественника протеазы, обозначенных здесь как proI и pro2, и использованы для получения генных конструктов, которые были затем введены в Y.lipolytica путем интегративной трансформации. Рекомбинантные культуры экспрессировали и секретировали в питательную среду чужеродные протеины, имеющие молекулярный вес и иммунореактивность прореннина и человеческого анафилатоксина С5а. Прореннин, полученный таким образом находится в нативной конфигурации, так как после удаления пропептида он обнаруживает полную ферментативную активность.
Использовались следующие материалы и методы
Материалы. Рестрикционные эндонуклеазы и Т4 лигаза были получены из New Englang Biolabs, бактериальная щелочная фосфатаза из Bethesda Research Laboratories, Т4 полинуклеотидкиназа из PL-Biochemicals и [гамма-32р] АТФ из New Englang Nuclear. Все ферменты использовались при условиях, рекомендованных поставщиком.
Среды. Среда ГПП (среда глицерин/протеаза-пептон) содержала (на литр): 6,7 г глицерина, 1,6 г Difco протеазы-пептона, 1,7 г Difco азотистого основания дрожжей без аминокислот и сульфата аммония, 30 мг урацила и 0,5 мл/л полипропиленгликоля мол.в. 2000 (Polyscienses) в 40 мМ-фосфатном буфере (рН 6,8) (полипропиленгликоль не был включен, когда среда использовалась для выращивания культур для анализа ферментной активности реннина). Протеаза-пептон был отдельно обработан в автоклаве в фосфатном буфере.
Cреда ДЭПД (среда дрожжи-экстракт/пептон/декстроза) содержала (на литр): 5 г экстракта дрожжей, 10 г пептона и 20 г декстрозы.
Е. coli выращивалась в среде LB при 37o C. Среда LB содержала (на литр): 10 г Бактотриптона, 10 г Бактодрожжевого экстракта, 10 г хлористого натрия, доводилась до рН 7,5 гидроокисью натрия.
Анализ последовательности ДНК. Фрагменты ДНК из различных здесь описанных плазмид изолировались на геле из полиакриламида и секвенировались по методу Maxam и др. Methods in Enzymology 65, 499 (1980).
Процедуры лигирования. Фрагменты ДНК, включая расщепленные векторные плазмиды, лигировались путем смешения нужных компонентов (фрагменты ДНК с концевыми участками, специально сконструированными для обеспечения правильного спаривания) с Т4 ДНК-лигазой. Добавлялось примерно 10 единиц лигазы на мкг количества вектора и вводимых фрагментов. Реакционная лигирующая смесь трансформировалась в компетентные клетки штаммов ММ294 (АТСС-33625) или НВ101 (АТСС-33694) E.coli K12.
Получение химически синтезированной ДНК. Для конструирования гибридных генов для экспрессии и секреции прореннина восемь олигонуклеотидов были синтезированы по модифицированной фосфорамидатной методике (Sinha и др. Tetrahedron letters 24, 5843 (1983) на Genetic Design 6500 (Watertown, МА) автоматическом ДНК-синтезаторе и очищены на 6М мочевина-20% полиакриламидном геле. Аликвоты комплементарных олигонуклеотидов смешивались и сшивались друг с другом при 4oC в течение ночи в ТЭ (10 мМ трис-HCl, рН 8,0, 1 мМ натриевой соли этилендиаминтетрауксусной кислоты). Аликвоты (около 2 мкг) двухцепочечных олигонуклеотидов фосфорилировались в 20 мкл реакционной смеси, содержащей 70 мМ трис (рН 7,6), 10 мМ MgCl2, 5 мМ дитиотрейтола, 5 мМ АТФ, при 37o C, используя Т4 полинуклеотидкиназу.
Получение плазмидной ДНК. Плазмидная ДНК в больших количествах получалась по методике Holmes и др. Anal biochem 114, 195-197 (1981), с последующим центрифугированием в градиенте плотности в этидиум-бромид-CsCl. Миниколичества плазмидной ДНК получались по щелочной SDS методике Birnboim и др. NAR 1, 1513 (1979).
Конструирование векторов экспрессии/секреции для прореннина. Была приготовлена серия различных конструкций для получения конечных векторов экспрессии. Все стадии представлены в виде схемы на фигурах. В общем случае, фрагменты ДНК изолировали путем гель-электрофореза и сшивали с другими фрагментами или расщепленной плазмидной ДНК в 20 мкл 50 ММ трис-HCl (рН 7,5), 10 мМ MgCl2, 20 мМ дитиотрейтола, 1 мМ АТФ, и 200 единиц Т4 лигазы при 4oC. Если требовалось частичное расщепление ДНК рестрикционной эндонуклеазой, оптимальное время расщепления устанавливалось экспериментально.
Идентификация прореннина в культуральной жидкости
Трансформанты дрожжей, содержащие векторы экспрессии, выращивались в течение ночи в среде ГПП (см. выше). После центрифугирования для удаления клеток дрожжей, добавляли 1 мл 50% трихлоруксусной кислоты к каждой 5 мл аликвоте культуральной жидкости и выдерживали при 4oC 60 мин. Центрифугированием получали шарики, которые дважды промывали 2 мл холодного ацетона. Осажденный протеин растворяли в 100 мкл стандартного SDS буфера и аликвоты подвергали электрофорезу на 10% SDS-полиакриламидных гелях (Laemmli U.K. (1970) Nature 227, 680). Освобожденные из геля протеины электрофоретически переносили на нитроцеллюлозу (Schleicher и Schuell, 0,22 мкм) и прореннин определяли иммуноточечным анализом на пластинке геля (Hawkes R. и др. (1982) Anal. Biochem. 119, 142). На фильтр наносили кроличье антитело к прореннину с последующей инкубацией с конъюгированным с пероксидазой козьим антителом к антителу кролика (Cappel, Malvern, Pa). Связанные антитела определялись окрашиванием смесью 4-хлор-1-нафтол и перекись водорода.
Активность по свертыванию молока прореннина в культуральной жидкости. Культуральная жидкость различных трансформантов Y.lipolytica исследовалась на активность по свертыванию молока по модифицированному методу Erbstrom, I. Dairy Sci 41, 1664 (1958). Коротко говоря, исследование включало измерение времени, требуемого реннину в активированных супернатантах культуры для свертывания буферного снятого молока и соотнесения значений со стандартными для очищенного реннина. Культуры дрожжей (25 мл) выращивались в течение ночи в среде ГПП. После центрифугирования для удаления клеток 5 мл аликвоты супернатантов культуры высушивались замораживанием под вакуумом. Каждый лиофилизированный супернатант был ресуспендирован в 300 мкл дистиллированной воды. Серия разбавленной очищенного прореннина теленка была также приготовлена в качестве контрольного стандарта. Прореннин в среде концентратов и контрольные образцы активировались добавлением примерно 5-10 мкл конц. HCl до получения рН приблизительно 2 и инкубировались один час при 22oC. Снятое молоко приготовляли путем прибавления 60 г сухого порошка снятого молока (Difco) к 500 мл 41,5 мМ ацетата натрия (рН 6,3) и 13,6 мМ CaCl2 и перемешивания 20 мин при 4oC. Субстрат был использован для анализа немедленно после приготовления. Аликвоту 60 мкл (эквивалент 1 мл супернатанта культуры) каждого препарата фермента добавляли к 1 мл аликвоты снятого молока при 37oC и регистрировали время свертывания.
Получение синтетических олигонуклеотидов для гена С5а
Олигодезоксинуклеотиды, используемые в синтезе структурного гена С5а, получали по модифицированной фосфорамидатной методике (Sinha и др. ук.соч.) с использованием стеклянной подложки с контролируемым размером пор на Genetic Design 6500 (Watertown, МА) автоматическом ДНК-синтезаторе. При получении использовали 3% (вес/объем) дихлоруксусную кислоту в дихлорметане для удаления тритильной группы, активирование фосфорамидатов насыщенным тетразолом в ацетонитриле, обработку ди-этоксифосфинтетразолидом и окисление водным раствором иод/ТГФ/Matteucci и др. 1981, I. Am. Chem. Soc. 105, 3183). Полное время на цикл добавления составляло 14 мин. Десять 47-мер сегментов А-I рисунка 9 получали с 98,8% средним выходом на стадию (по тритильному анализу), деблокировали по методике Matteucci и др. местное цитирование, осаждали этанолом из 0,3 М ацетата натрия и выделяли путем препаративного гель-электрофореза в 10% денатурированном геле полиакриламид-мочевина перед сшиванием.
Сборка, клонирование и секвенирование человеческого гена С5а
На фиг. 9 показана аминокислотная последовательность нужного протеина и расположение синтетических олигонуклеотидов, необходимых для получения гена, кодирующего человеческий протеин С5а. Все олигомеры, кроме А и F, фосфорилировались по их 5'-концам Т4 полинуклеотидкиназой. Сборка гена включала две первичных реакции отжиг/лигирование, включающие: олигомеры А, В, I и J и олигомеры C, D, E, F, G и H. Образующиеся В 94 п.о. и 141 п.о. двухцепочечные фрагменты ДНК изолировались после электрофореза в 10% полиакриламидном геле, сшивались вместе в их В 235 п.о. продукт изолировался гель-электрофорезом. В 235 п.о. фрагмент ДНК, содержащий структурный ген, кодирующий С5а, вводился между EcoRI и HindIII сайтами вектора рВР322 и трансформировался в компетентные клетки штамма РВ101 E.coli К-12. Рестрикционный анализ плазмидной ДНК, изолированной из 6 трансформантов, показал, что 5 из 6 клонов содержали EcoRI/EcoRI/HindIII фрагмент правильного размера. Нуклеотидную последовательность участка гена С5а каждой из этих плазмид определяли по методу Maxam и др. Methods Enzymol. 65, 499 (1980).
Конструирование и характеризация плазмиды экспрессии С5а для E.coli.
Методика изолирования фрагментов ДНК и условия реакции сшивания были такими же, как описаны Maniatis и др. (1982) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor E.coli trp промотор-оператоp был первоначально получен из ptr pL1 (Edman и др.) (1981) Nature 291, 503). 360 п.о. фрагмент EcoRI, содержащий trp промотор-операторную последовательность, используемый в плазмиде экспрессии С5а (рС5А-48), изолировался из плазмиды экспрессии прореннина pPFZ-R2, описанной в Европейской заявке N 0147178, опубликованной 3 июля 1985 г.
Идентификация С5а в культуральной жидкости Y.lipolytica.
Методика была такой же, как описана выше для прореннина, за исключением того, что в иммуноанализе были использованы козьи антитела к С5а и кроличьи антитела к козьему IgG (Cappel). Козье антитело к С5а человека получали методом Mandezino и др. J.Ymmunol. Methods 53, 41-50 (1982).
Векторы
pLD 40 описанный в Европейской заявке N 0128508, опубликованной 24 апреля 1985 г.
Микроорганизмы
АТСС 20774 Yarrowia lipolytica PC 30869
ATCC 20781 Yarrowia lipolytica DL 112-PC-30869, трансформант с XPR2
ATCC 20776 Yarrowia lipolytica DL-148 Трансформант Y.lipolytica ATCC 20688 c SnaBI дaйджестед pLS-3
ATCC 20775 Yarrowia lipolytica DL-144 Трансформант Y.lipolytica АТСС 20688 с нерасщепленной pLs-3
ATCC 20777 Трансформант Y. lipolytica PC-30869 c SnaBI, расщепленной рС5аХ-3
ATCC 20778 Трансформант Y. lipolytica РС-30869 с SnaBI, расщепленной рХХ-II
ATCC 20779 Трансформант Y. lipolytica РС-30869 с SnaBI, расщепленной РХХ-22
ATCC 20780 Трансформант Y. lipolytica РС-30869 с SnaBI, расщепленной рХХ-33
ATCC 20794 Трансформант Y.lipolytica РС-30869 с pLD56
ATCC 20795 Трансформант Y.lipolytica ATCC 20794 c NruI, расщепленной pLХ-34
Они были депонированы в соответствии с Будапештским договором в американской Коллекции типовых культур, Rockville, Maryland.
Таксономическое исследование Y.lipolytica АТСС 20774 (идентифицированного в коллекции культур Pfizer. Inc. как РС 30869) проведено д-ром J.R.Dezeeuw, который подготовил нижеследующее описание. Использовались методики, рекомендованные J.L.Lodder в "The Yeasts", второе издание, N.Holland Publishing Co. Амстердам, 1970.
CBS 599, типовая культура вида Candida lipolytica ("The Yeasts", второе издание, N.Holland Publishing Co. Амстердам, 1970) и CBS 6124, типовая культура Saccharomcopsis lipolytica в "The Yeasts", третье издание, были взяты для сравнения. Ранее вид был также сопоставлен с Endomycopsis lipolytica. Его состояние Candida lipolytica. Таксономическое положение вида было установлено van der Walt и von Arx, Antonie van Leeuwenhoek 46, 517-521 (1980). Предпочитаемое название в настоящее время Yarrowia lipolytica.
Культуральные, морфологические и физиологические характеристики штамма РС 30869 согласуются со стандартным описанием вида, указанного как Saccharomycopsis lipolytica в "The Yeasts", третье издание /под ред. Kreger-Van Rij, cc. 406-408, Elsevier Science Publishers B.V. Амстердам, 1984.
Сравнение штаммов Yarrowia lipolytica представлено в табл.1.
РС-30869 был сконструирован с помощью генетической рекомбинации подходящих мутантов Y.lipolytica РС-22208, Pfizer почвенный изолят, и Y.lipolytica РС-30026, субкультура NRRL Y-1094. РС-30869 фенотипически отличается от своих родителей дикого типа следующим: (1) не производит активной внеклеточной щелочной протеазы, (2) требует биотина для роста и (3) требует источник L-лейцина.
В течение лог-фазы роста РС-30869 в среде дрожжевой экстракт-пептон-глюкоза (ДЭПГ) почкующиеся клетки имеют яйцевидную форму и средний размер 2,6х5,5 мкм. На ДЭПГ-агаре доминируют псевдо- и истинные мицелии. Бластоспоры присутствуют в большинстве как одиночки. Не обнаруживается каротеноидных пигментов. Культура ведет себя как гаплоид В-типа спаривания в скрещивании с аутентичными тестовыми штаммами видов (табл. 5). Типичная аскоспоруляция наблюдается на агаре V8. Особенности ассимиляции углерода указаны в табл. 2. Ферментация отсутствует. Ион аммония и мочевина, но не нитрат, утилизируются как единственные источники азота (табл. 3). Штамм РС-30869 требует витаминов тиамина и D-биотина (табл. 4). Только тиамин требуется для родителей культуры дикого типа. Никакого роста не наблюдается при 37oC. Другие характеристики представлены в табл.6.
РС-30869 отличается от других штаммов Y.lipolytica, описанных в патентной литературе, как это следует из сравнения их фенотипов (табл. 7 и 8).
АТСС 20228 (Nubel и др. Патент США N 4155811) обнаруживает вид питания дикого типа, подобно типовым штаммам для вида CBS 599 и CBS 6124. Конкретно, он не нуждается для роста в урациле, лейцине или биотине, и он разжижает желатин.
АТСС 20628 (Dezeeuw и др. Патент США N 4407953) в отличие от АТСС 20228 требует дополнительного лейцина для роста. Подобно АТСС 20228 он не нуждается в урациле или биотине. Он также разжижает желатин.
АТСС 20688 (Европейская заявка N 0138508) растет, только если в среду добавлены как урацил, так и лейцин. Эта необходимость в урациле отличает АТСС 20688 как от АТСС 20228, так и АТСС 20628. АТСС 20688 не требует биотин и разжижает желатин.
Культура РС-30869 отличается от всех вышеуказанных. Она нуждается для роста в биоцине и лейцине, но не в урациле. Она не разжижает желатин.
Полная среда содержала 16,7 г/л бактодрожжевой основы, свободной от витаминов, плюс 100 мг/л урацила, 100 мг/л лейцина, 10 мкг/л D-биотина и 200 мкг/л тиамина, HCl.
Среда содержала 120 г/л желатина и 16,7 г/л бактодрожжевой основы, свободной от витаминов, плюс 100 мг/л урацила, 100 мг/л L-лейцина, 10 мкг/л D-биотина и 200 мкг/л тиамина, HCl.
На фиг.1 показана частичная линейная рестрикционная карта перекрывающихся плазмид pLD 57, pLD 58 и pLD 62, изолированных из штамма Y.lipolytica DL 112.
На фиг.2 пробы синтетических олигонуклеотидов для гена XPR2. Из описанной последовательности для большинства первых 25 аминокислотных остатков активной протеазы (Ogrydziak и др. ук.соч.) два участка, отмеченные I и II, дают возможность конструирования 14-мер олигонуклеотидных проб с 32-кратной или меньшей вырожденностью. Эти два участка начинаются соответственно у аминокислот 7 и 18. Четыре различные восьмикратно вырожденные смешанные пробы были приготовлены для каждого участка, они получили номера от 170 до 186, как показано. В изображенной предсказанной последовательности нуклеиновой кислоты "Х" означает все 4 основания, "U" означает оба пурина и "Y" означает оба пиримидина.
На фиг. 3-5 нуклеотидная последовательность гена XPR2 с указанием промотора, пре (от -157 до -136), pro I (от -135 до -98), pro 2 (от -97 до -1), щелочной внеклеточной протеазы и концевых последовательностей.
На фиг. 6 сконструированная последовательность для терминатора вектора pterm 4.
На фиг. 7 сконструированная последовательность и рестрикционная карта плазмиды pLS-3.
На фиг. 8 сконструированная последовательность и рестрикционная карта плазмиды pXX-33.
На фиг. 9 сконструированная последовательность и рестрикционная карта плазмиды рХХ-22.
На фиг. 10 сконструированная последовательность и рестрикционная карта плазмиды рХХ-11.
На фиг.11 аминокислотная последовательность человеческого анафилатоксина С5а.
На фиг.12 рестрикционная карта плазмиды рС5а-48.
На фиг. 13 сконструированная последовательность и рестрикционная карта плазмиды рС5аХ-3.
На фиг.14-16 нуклеотидная последовательность гена LEU-2.
На фиг. 17 сконструированная последовательность и рестрикционная карта плазмиды pLX-34.
Анализ последовательности гена XPR2. Анализ ДНК-последовательности клонированного гена XPR2 проводился методом химической деградации (Maxam и др. 1980, Methods Enzymol 65, 499) на перекрывающихся фрагментах рестрикции, полученных из плазмид pLD 57, pLD 58, pLD 62 (фиг.1) и pLD 84 и pLD 86 (см. ниже). Результаты показали, что клонированные геномные ДНК дрожжей действительно содержат ген для внеклеточной щелочной протеазы. Нуклеотидная последовательность гена XPR2 и аминокислотная последовательность предшественника щелочной протеазы с ее сигнальной последовательностью, выведенная из нуклеотидной последовательности, показаны на фиг.3-5. Значительная часть аминокислотной последовательности внеклеточной протеазы была неизвестна (Ogrudziak и др. ук. соч.) и представлена здесь впервые. Более того, последовательности, требуемые для экспрессии и выделения внеклеточной протеазы, описаны здесь в первый раз. Последовательность ДНК, кодирующая щелочную протеазу, ее предшественник и сигнальные последовательности, состоит из 1362 пар оснований (фиг.3-5). Первичная структура этой полипептидной цепи, выводимая из нуклеотидной последовательности, должна содержать 454 аминокислотных остатка. Щелочная протеаза синтезируется в клетке в форме предшественника, который протеолиитически переводился в секретируемую или зрелую форму. Анализ N-концевой аминокислотной последовательности, выведенной из нуклеотидной последовательности, показал наличие сигнального пептида в молекуле предшественника. Этот сигнальный пептид содержит 22 аминокислотных остатка и его структурные особенности подобны особенностям сигнальных пептидов высших эукариотов и прокариотов (Perlman и др. 1983, J. Mol. Biol. 167, 391). Участку в выведенной аминокислотной последовательности в согласии с известными 25 N-концевыми аминокислотами активной щелочной протеазы (Ogrydziak и др. 1982, J. Gen. Microbiol, 128, 1225) предшествуют 157 аминокислотных остатков, содержащих сигнальный пептид и два сайта расщепления трипсинового типа (Lys-Arg). Эти сайты расщепления использовались для разделения области pro на pro 1 (от -135 до -98) и pro 2 (от -97 до -1), см. фиг.3-5. Активная щелочная протеаза имеет 297 аминокислот, как следует из нуклеотидной последовательности. Аминокислотные последовательности для различных форм протеазы, выведенные из нуклеотидной последовательности, находятся в сочетании с размерами очищенных форм фермента. В дополнение к структурной последовательности предшественника щелочной протеазы было определено примерно 700 п.о. 5'-боковой последовательности и 600 п.о. 3'-боковой последовательности. Анализ этих участков показал, что они содержат последовательности, аналогичные другим эукариотическим промоторам и терминаторам, и, вероятно, они играют существенную роль в экспрессии щелочной протеазы.
Как указано выше, методика трансформации Y.lipolytica и клонирования генов Y. lipolytica путем комплементации мутаций, включая клонирование гена XPR2, который кодирует выделяемую щелочную протеазу, путем комплектации мутации xpr2, описаны в Европейской заявке N 0138508. Методика, описанная в ней, включает трансформацию клетки-хозяина штамма Y.lipolytica частичным Bg Ш-переваром библиотеки генов Y.lipolytica в векторе pLD 40. Данный вектор характеризуется тем, что он содержит в себе малый сегмент, содержащий LEU2 участок Y.lipolytica и сайты рестрикции эндонуклеазы 3EcoRI, 4EcoRV, 6А vaI, IBgIII, INCoI, IApaI, 2XhoI и IBst XI. Один из трансформантов XPR2 Y.lipolytica были использованы для извлечения гена дикого типа (pLD 84 и pLD 86) из Y.lipolytica NRRL У-1094 для применения в конструировании вектора экспрессии/секреции, как описано в примере 1.
Анализ последовательности гена LEU2. Анализ последовательности ДНК клонированного гена LEU2 в pLD 25 (Европейская заявка N 0138508) проводился методом химической деградации (Maxam и др. 1980, Methods, Enzmol. 65, 499) на перекрывающихся фрагментах рестрикции. Для локализации области, кодирующей бета-изопропилмалат (ИПМ) дегидрогеназу, и соответствующей рамки считывания была использована информация о аминокислотной последовательности, ранее определенной для гена LEU2 S.cerevisiae (Andreadis и др. 1984, J. Biol. Chem. 259, 8059). Участок гомогенной последовательности Y.lipolytica который кодирует аминокислотную последовательность, гомологичную участку протеиновой последовательности S.cerevisiae был идентифицирован. Нуклеотидная последовательность гена 2,8-kb LEU2 и аминокислотная последовательность бета ИПМ-дегидрогеназы, выведенная из нуклеотидной последовательности, показаны на фиг. 14-16. Кроме того, последовательности, требуемые для экспрессии бета-ИПМ-дегидрогеназы Y. lipolytica описаны здесь впервые. Последовательность ДНК, кодирующая этот протеин, состоящий из 405 аминокислот, содержит 1215 пар оснований (фиг. 14-16). В дополнение к последовательности, кодирующей бета-ИПМ-дегидрогеназу, были определены примерно 798 п.о. 5'-боковой последовательности и 797 п.о. 3'-боковой последовательности (включая кодон терминации трансляции ТАА). Анализ этих участков показал, что они содержат последовательности, аналогичные другим эукариотическим промоторам и терминаторам, и что они имеют существенное значение для экспрессии.
5'-участок выше гена LEU2 Y. lipolytica содержит ТАТАТАТА-последовательность в 78 п.о. перед сайтом начала трансляции и в 30 п.о. перед предлагаемым сайтом начала транскрипции мРНК. Вторая последовательность, важная для инициации транскрипции в эукариотах, представляет собой бокс СААТ, который в гене LEU2 расположен в 74 п.о. перед предлагаемыми сайтом инициации транскрипции, расположенным в -48 п.о. от ATG (фиг.14-16).
3'-участок ниже гена имеет последовательность от 72 до 120 нуклеотидов после стоп-кодона (ТАА), гомологичную последовательности 5'-TAG.TA/T/GT. TTT-3', предложенной Zaret и др. CeII 28, 563 (1982) как имеющей важное значение для терминации транскрипции в S.cerevisiаe.
Изобретение иллюстрируется следующими примерами.
Пример 1. Использованным штаммом-хозяином был АТСС 20774 (МАТВ Ieu 2-40 bio-6 xp 2-1002). Трансформант XPR2, Y.lipolytica АТСС 20781, определялся как колония, образующая зону на индикаторных чашках со снятым молоком после посева методом отпечатков на чашки с недостатком лейцина. Хромосомную ДНК получали из трансформанта по методу заявки ЕР N 0138508 и использовали для извлечения гена для выделяемой протеазы. Хромосомную ДНК частично расщепляли ферментом BgIII, сшивали для образования кольцевого фрагмента, содержащего репликон E.coli и ген устойчивости к ампициллину из вектора, и использовали для трансформации E.coli. Хромосомную ДНК также расщепляли ферментом SaII и использовали в эксперименте по Southern, который показал, что нормальный участок LEU2 трансформанта не был нарушен. (520 п.о. SalI-Eco RI сегмент области LEU2, представляющий 5'-конец сегмента LEU2 pLD40, использовался в качестве пробы). Поэтому, так как гомология необходима для интеграции плазмидной библиотеки в Y.lipolytica, участок XPR2 должен быть сайтом интеграции. Три перекрывающиеся, но различные плазмиды, pLD 57- pLD 58 и pLD 62, были первоначально извлечены из Y.lipolytica АТСС 20781. Они изображены на фиг. 1. Гибридизация с синтетическими олигонуклеотидными пробами гена XPR2, основанными на известной последовательности первых 25 аминокислотных остатков выделенной активной протеазы (фиг. 2-5), показали, что ген секреции протеазы был клонирован. Для определения того, представляет ли извлеченный ген копию дикого типа или мутантную копию, штамм-реципиент Y.lipolytica был трансформирован pLD 58. Так как не возникло трансформантов, положительных по протеазе, из любых лейцин-независимых трансформантов, был сделан вывод, что pLD 58 содержит мутантный аллель гена.
Форма гена XPR2, присутствующая в штамме NRRL Y-1094 дикого типа, была получена с E.coli в эксперименте по гибpидизации колонии. В качестве пробы использовался 2 тыс.п. фрагмент PvuI-EcoRI, который, как следует из данных по секвенированию, содержит полный структурный ген. Из оригинальной библиотеки частично расщепленных Sau 3A фрагментов NRRL Y-1094 ДНК в pLD 40, описанного в ЕР 0138508, было получено несколько колоний, гибридизующихся с пробой. Две из этих колоний содержали очень схожие плазмиды, обозначенные pLD84 и pLD86, которые были использованы для получения векторов экспрессии. Обе плазмиды содержат одинаковый 5'-конец участка XPR2-сайт Sau 3A (который был присоединен и восстанавливал сайт BamHI вектора), от которого начинается последовательность на фиг.3-5. Каждый содержит целиком структурный ген протеазы и предполагаемый терминатор транскрипции и включает приблизительно 4-5 тыс. п. введенных из участка XPR2 штамма NRRL Y-1094. Включение в pLD 86 содержит дополнительно несколько сотен пар оснований на 3'-конце. Так как мы использовали 3'-цепь до сайта BgIII (2655 пар оснований) для конструирования вектора экспрессии, две плазмиды обеспечивают одинаковую ДНК, которая функционально идентична последовательности на фиг.3-5
Конструирование векторов экспрессии/секреции. План, разработанный для получения экспрессии и секреции прореннина в Y.lipolytica, предусматривает конструирование различных гибридных генов в интегративном векторе клонирования. Подобный подход требует нескольких различных плазмид, которые содержат обширные участки общих последовательностей ДНК. Фактически была использована модулированная конструкционная схема для сборки векторов с геном прореннина, введенным в положение 3' предсказанного сайта XPR2 процессинга сигнального пептида, предлагаемым pro I сайтом процессинга и сайтом расщепления для получения зрелой щелочной протеазы. Желательно, чтобы чужеродный ген был введен между последовательностями дрожжей для промотора и терминатора экспрессии. Ясно, что N-концевая часть последовательностей гибридного гена будет изменяться в различных конструкциях плазмид, однако последовательность структурного гена прореннина, последовательность терминатора XPR2 и ДНК челночного вектора будут одинаковы в каждой конструкции плазмиды экспрессии. Предполагалось, что один и тот же фрагмент структурного гена прореннина и терминатор/векторная плазмида будут использованы в каждой конструкции плазмиды экспрессии, как описано ниже. Различные конструкции плазмид экспрессии секреции прореннина различаются в участке сразу ниже от промоторной последовательности гена XPR2 по длине N-концевой последовательности предшественника щелочной протеазы, которая предшествует последовательности гена прореннина. Поэтому промоторный фрагмент каждой плазмиды экспрессии конструировался как изменяемая последовательность в области соединения XPR2 прореннин. Все векторы экспрессии секреции были собраны сходной реакцией лигирования, включающей три компонента.
Экспериментальные стадии, использованные для конструирования вектора-терминатора pterm 4, изображены на фиг.6. Сначала синтетический линкер присоединяли к фрагменту, содержащему 3'-конец гена XPR2, включающему сигналы окончания транскрипции и полиаденилирования. Плазмиду pLD 84 расщепляли эндонуклеазой КрпI и лигировали с синтетической двухцепочечной линкерной ДНК, изображенной на фиг.6. Продукт лигирования расщепляли эндонуклеазами HindIII и BgIII, и фрагмент из 760 п.о. вводили в плазмиду pLD 41, линеализированную теми же двумя эндонуклеазами до образования pterm 4. Плазмиду pterm 4 идентифицировали по ее рестрикционной карте. Результаты серии рестрикционных расщеплений эндонуклеазой при использовании EcoRv, EcoRI, КрпI, BgIII-HindIII и BgIII-BcII анализировались. Расщепления дают пригодные фрагменты, подтверждающие присутствие синтетического линкера и "полного" 3'-конца гена XPR2 в челночной плазмиде pLD 41, как описано в EP N 0138508. Частичная карта этого 7,3 кb вектора-терминатора показана на фиг.6.
Конструирование плазмиды экспрессии/секреции pLS-3.
На фиг. 7 показано конструирование первоначальной плазмиды, использованной для секреции прореннина в Y. lipolytica. Ее рестрикционная карта представлена на фиг. 7. Конструирование плазмиды секреции прореннина было инициировано приготовлением фрагмента, содержащего большую часть последовательности структурного гена прореннина. Фрагмент ДНК ВсII-Bam HI (частичный) из 1080 п.о. содержащий кодирующую последовательность для остатков прореннина 6-365, изолировали из плазмиды экспрессии прореннина E.coli pPFZ-84A. (Плазмида pPFZ-84А является производной плазмиды экспрессии прореннина pPFZ-R2, конструкция которой описана в заявке ЕР N 0147178, опубликованной 3 июля 1985 г. и которая была получена сайт-направленным мутагенезом с использованием синтетических олигонуклеотидов с замещением фрагментов рестрикции. Конкретно, pPFZ-84А отличается от pPFZ-R2 только двумя парами оснований для аминокислотных остатков прореннина 214(Asn _→ Asp) и 286 (Asp _→ Gly) т.е. кодирует так называемый прореннин А, однако обе плазмиды содержат необходимую последовательность для прореннина и функционально эквивалентны в данном примере. Фрагмент промотора XPR2, содержащий кодирующую последовательность для предшественника щелочной протеазы 1-157 и прореннина 1-5, получали следующим образом. Фрагмент HindIII-AvaI ДНК из 870 п.о. содержащий участок промотора и 5'-конец гена щелочной протеазы, изолировали из субклона XPR2 плазмиды pLD 90. Этот фрагмент связывали с синтетическим фрагментом, имеющим структуру
5'CCGAGATTCCGCTTCTTCTAATGCCAAGCGAGCTGAGATCACTAG 3'
3' CTAAGGACGAAGAAGATTACGGTTCGCTCGACTCTAGTGATCCTAG 5'
направление считывания ________→
Эта последовательность содержит липкий конец AvaI, за которым следует последовательность из последних девяти кодонов про-пептида щелочной протеазы, за которой следует последовательность, кодирующая первые четыре аминокислоты прореннина, и оканчивающаяся в сайте Bam HI. Фрагмент промотора получали по стандартной реакции связывания, используя синтетический фрагмент и фрагмент HindIII-AvaI из 870 п.о. и Т4-лигазу с последующим расщеплением HindIII и BamHI. Образовавшиеся связанные последовательности очищали электрофорезом на геле полиакриламида с выделением соответствующего фрагмента ДНК HindIII-BamHI из 916 п.о. 3'-конец гибридного гена получали из терминатор/векторной плазмиды pterm 4, описанный выше. Плазмида pterm 4 расщеплялась HindIII и ВсII, и, приблизительно 7,3 тыс.п. HindIII-BcII фрагмент ДНК терминатор/вектор, содержащий терминатор XPR2, селективный маркер LEU2 и pBR322, выделяли на геле агарозы.
Плазмиду экспрессии/секреции прореннина pLS-3 собирали путем инкубирования трех компонентов ДНК (HindIII-BcII фрагментов плазмиды pterm 4, промотора HindIII-BamHI из 916 п.о. и фрагментов BamHI-BcII из 1080 п.о.), содержащих ген прореннина, сконструированных, как описано выше в присутствии Т4-лигазы (см. фиг.7). Лигирующую смесь использовали для трансформации штамма MM294 E.coli К12 по СаCl2-методу Dagert и др. Gene 6, 23-28 (1979). Плазмиды выделяли из отобранных трансформантов, устойчивых к ампициллину, и плазмиду pLS-3 идентифицировали по ее рестрикционной карте (фиг.6,А). Участок XPR2-прореннин этой плазмиды секвенировали для подтверждения наличия нужной последовательности синтетической ДНК и правильного соединения нужных фрагментов.
Получение pLD090. Эта плазмида содержит субклон из pLD 84. Участок ДНК от сайта PvuI в области промотора XPR2 до сайта EcoRI в области терминатора был субклонирован в сайт HindIII pBR322 по следующей методике. Несколько микрограмм pLD 84 расщепляли двумя вышеупомянутыми ферментами рестрикции. Затем в "липкие" концы расщепленных молекул ДНК вводился фрагмент кленова ДНК-полимеразы I. Затем обработанные киназой HindIII линкоры (CAAGCTTG из New England Biolabs) добавляли к концам с помощью Т4-лигазы. Избыток линкеров удаляли и получали липкие концы HindIII последующим расщеплением ферментом HindIII. Смесь молекул ДНК разделяли на препаративном агарозном геле, отделяя нужную 2 тыс.п. полосу, очищали и вводили в реакцию лигирования с HindIII-расщепленным вектором pBR322, обработанным бактериальной щелочной фосфатазой. Лигирующую смесь использовали для трансформации компетентных E. coli. Ориентация сайта EcoRI терминатора XPR2, более близкая к сайту EcoRI pBR322, была названа pLD 90, а обратная ориентация pLD 91.
5'конец участка промотора XPR2, который был включен в pLS-3, представляет собой сайт PvuI, приблизительно в 280 п.о. от начала области, последовательность которой указана на фиг.3-5. Было обнаружено, что плазмиды, содержащие ген протеазы дикого типа под контролем только этой части промотора, при интеграции в генном сайте, удаленном от резидентного локуса xpr2, не придают трансформанту способность производить большие количества протеазы (определено по зонам просветления на чашках со снятым молоком).
Мы обнаружили, что если pLS-3 содержит укороченный и поэтому "дефектный" промотор, что интегрант, возникающий при рекомбинации между плазмидой и резидентным геном XPR2 дикого типа, будет образовывать полный промотор, направляющий экспрессию продукта слияния прохимозина, но дефектный по отношению к экспрессии протеазы. Аналогичный эксперимент с нарушением гена был выполнен с актин-геном S.cerevisiae Shortle и др. (Science 217:371-373 1982). В соответствии с нашими ожиданиями некоторые лейцин-независимые трансформанты с pLS-3 были действительно дефектны по отношению к протеазе. Трансформанты, дефектны по протеазе, представляли собой скорее нужные интегранты в локусе XPR2, чем нежелательные побочные продукты, такие как генные конверсии в Ieu2. Со штаммом-реципиентом АТСС 20688 мы обнаружили, что нерасщепленная pLS-3 производила 6,5% дефектных по протеазе трансформантов, тогда как SпаBI-расщепленная плазмида давала приблизительно 70% трансформантов, дефектных по протеазе. Аспект нарушения гена при этой трансформации был использован для того, чтобы избежать необходимости в большом количестве Саузерн-блот экспериментов для нахождения правильного интегранта среди всех трансформантов.
Плазмиды, содержащие структурный ген протеазы дикого типа под контролем промотора XPR2 (начинающегося как указано на фиг.3-5) дают возможность экспрессии значительного количества протеазы, если интегрированы в клетки Y. lipolytica в сайте, ином, чем локус xpr2. Однако для эффективной экспрессии чужеродных генов этим видом интегрантов может потребоваться дальнейшая модификация этого контролирующего участка ДНК.
Секреция прореннина. Штамм АТСС 20688 Y.lipolytica был трансформирован нерасщепленной pLS-3 ДНК и SпаBI-расщепленной pLS-3 ДНК для получения xpr-Ieu+ трансформантов АТСС 20775 (DL 114) и АТСС 20776 (DL 148) соответственно. Эти трансформированные штаммы высевались в тест-пробирку, содержащую среду ДЭПД. Клетки выращивались в течение ночи при 28oC. Аликвоту (250 мкл) этих культур разбавляли 1: 100 в 25 мл среды ГПП. Клетки выращивались во встряхиваемой колбе при 28oC в течение 16-18 ч до возникающей абсорбции 5,0-7,0 при 600 нм и отбирались центрифугированием. Образующаяся культуральная жидкость исследовалась на присутствие прореннина путем концентрирования супернатанта и нанесения концентрата на SDS-PAGE. Гель электрофоретически переносился на нитроцеллюлозную бумагу в присутствии 20 мМ трис-основания, 150 мМ глицина, 20% метанола при 500m amp в течение 2 ч при 4oC. Удаление протеина из геля проверялось окрашиванием с голубым Кумасси.
Нитроцеллюлозную бумагу высушивали при 37oC и помещали на 65oC в течение 1 ч, затем промывали в TBS (200 мМ NaCl, 50 мМ трис-HCl, рН 7,5). Бумагу затем инкубировали при комнатной температуре 30 мин в TBS, содержащем 10% лошадиной сыворотки (Gibco, Chagrin Falls, Ohio) с последующей инкубацией в ТВS, содержащем 10% лошадиной сыворотки и антитела прореннина в соответствующем разведении в течение 16 ч при комнатной температуре. Бумагу затем три раза промывали в TBS с последующей инкубацией в TBS, содержащем 10% лошадиной сыворотки, с последующей инкубацией в течение 2 ч в TBS, содержащем 10% лошадиной сыворотки и козьего антитела к антителу кролика IgG, конъюгированного с пероксидазой. Бумагу затем промывали три раза в течение 10 мин в TBS и проявляли в присутствии 4-хлор-1-нафтола (3 мг/мл в метаноле), добавленного к концентрации 0,5 мг/мл в ТВS, содержащем 0,01% перекиси водорода. Присутствие прореннина молекулярного веса 40000 было подтверждено в обоих супернатантах.
После кислотной активации концентрированных супернатантов культуры (см. выше) значительная активность по свертыванию молока присутствовала в образцах, приготовленных из трансформированных культур АТСС 20775 и 20776, содержащих pLS-3. Как ожидалось, активность по свертыванию молока не обнаружена в супернатантах контрольной культуры штамма реципиента Y. lipolytica АТСС 20688.
Конструирование плазмиды экспрессии/секреции рХХ-33.
Модификация для превращения pLD-3 в усовершенствованную плазмиду экспрессии рХХ-33 изображена на фиг.8. Такая модификация увеличивает участок промотора XPR2 на 280 п.о. Как в случае pLD-3, плазмида экспрессии pXX-33 cодержит гибридный ген, кодирующий весь препро-пептид (157 аминокислотных остатков) щелочной протеазы, присоединенный к полной структурной генной последовательности прореннина.
Перед конструированием плазмид экспрессии/секреции прореннина с последовательностью промотора XPR2 на 280 п.о. больше, чем в pLS-3, было необходимо субклонировать фрагмент рестрикции, содержащий полный ген щелочной протеазы, в сайт HindIII. Этот субклон был собран путем добавления синтетических линкеров к фрагменту рестрикции, выделенному из клона XPR2 геномной библиотеки pLD86. Конструирование этого субклона XPR2 с сайтом HindIII, локализованным слева, было инициировано приготовлением фрагмента ДНК, содержащего весь ген щелочной протеазы. 2,3 тыс.п. EcoRI-BamHI фрагмент (частичный) геномной области клона XPR2 pLD-86 был очищен электрофорезом на агарозном геле и связан с синтетическим фрагментом, имеющим последовательность
5' GATCGAAGCTTG 3'
3' TTCGAACTTAA 5'
Эта линкерная последовательность содержит липкий конец BamHI (но не восстанавливает сайт BamHI), за которым следует сайт HindIII и затем липкий конец EcoRI. Продукт лигирования расщеплен HindIII и встроен в HindIII сайт pBR322. Плазмида pXHP-24 была идентифицирована по ее рестрикционной карте и стала источником фрагментов промотора XPR2 для будущих конструкций экспрессии.
В плазмиде pXHP-24 субклонированный ген XPR2 содержит приблизительно на 280 п. л. больше 5' последовательности промотора XPR2, чем в pLS-3. Первый фрагмент промотора был получен стандартной реакцией лигирования при использовании синтетического фрагмента ДНК (описанного выше для pLS-3) фрагмента HindIII-AvaI с 1150 п.о. pХНР-24 и Т4 лигазы с последующим расщеплением HindIII и BamHI. Образующиеся связанные последовательности очищали гель-электрофорезом, выделяя фрагмент HindIII-BamHI приблизительно в 1196 п.о. Второй фрагмент, содержащий последовательности, кодирующие аминокислотные остатки прореннина 6-151 получали из pLS-3 расщеплением BamHI и XmaI и очисткой на геле образующегося фрагмента ДНК BamHI-XmaI в 440 п.о. Третий фрагмент, содержащий остальную часть гена прореннина, терминатор XPR2 и последовательности вектора получали из pLS-3 расщеплением HindIII и XmaI и очисткой на геле фрагмента вектора HindIII-XmaI приблизительно из 8,0 тыс.п. Эти три фрагмента затем связывали, используя стандартную методику, описанную выше. Реакционную лигирующую использовали для трансформации штамма ММ294 E.coli К12. Плазмиды изолировали из трансформантов, отобранных на основе устойчивости к ампициллину, и плазмиду рХХ-33 идентифицировали по ее рестрикционной карте (фиг. 6). Область протеаза-прореннина этой плазмиды секвенировали для подтверждения правильного соединения нужных фрагментов.
Y.lipolytica АТСС 20774 затем трансформировали рХХ-33, расщепленной SпаВI, для получения Y.lipolytica АТСС 20780 и прореннин, секретируемый трансформированными культурами в культуральный бульон, анализировали, как описано выше в случае pLS-3. Было подтверждено присутствие прореннина в культуральном супернатанте.
После кислотной активации концентрированных культуральных супернатантов (см. выше) значительная активность по свертыванию молока наблюдалась в образцах, приготовленных из трансформированной культуры Y.lipolytica АТСС 20780.
Конструирование плазмиды экспрессии/экспрессии рХХ-22.
Экспериментальные стадии, использованные для конструирования плазмиды экспрессии/секреции рХХ-22, показаны на фиг.7. Вектор экспрессии отличается от pLS-3 в двух отношениях. Подобно рХХ-33, он содержит дополнительный сегмент последовательности промотора XPR2 из 280 п.о. Во-вторых, он содержит последовательность, кодирующую сигнальный пептид щелочной протеазы и только 38 аминокислотных остатков про-пептида (vro I).
План конструирования рХХ-22 был аналогичен использованному для рХХ-33. Первый фрагмент промотора был получен по стандартной реакции связывания при использовании фрагмента HindIII-BgIII из 890 п.о. рХНР-24 и синтетического фрагмента с последовательностью
5' GATCTTGCTCAGATCACTAG 3'
3' AACGACTCTAGTGATCCTAG 5'
и Т4 лигазы с последующим расщеплением HindIII и BamHI. Образующиеся связанные последовательности очищали гель-электрофорезом, выделяя фрагмент ДНК HindIII-BamHI из 920 п.о. Второй фрагмент, кодирующий остатки прореннина 6-151, изолировали из рLS-3 расщеплением BamHI и XmaI, и очисткой на геле образующегося фрагмента ДНК BamHI-XmaI из 440 п.о. Третий фрагмент, содержащий остальную часть гена прореннина, терминатор XPR2 и векторные последовательности, получали расщеплением pLS-3 HindIII и XmaI и очисткой на геле фрагмента вектора приблизительно в 8,0 тыс.п. Затем эти три фрагмента ДНК связывали, используя стандартную методику, описанную выше. Реакционную лигирующую смесь использовали для трансформации штамма MM294 E.coli K12. Плазмиды изолировали из отобранных трансформантов и плазмиду рХХ-22 идентифицировали по ее рестрикционной карте (фиг.7).
Y. lipolytica АТСС 20774 затем трансформировали рХХ-22, расщепленной SпаBI, для получения Y. lipolytica АТСС 20799, и прореннин, выделяемый в культуральный бульон трансформированными культурами, анализировали, как описано выше в случае pLS-3. Присутствие прореннина в культуральном супернатанте подтверждалось согласно методике, описанной выше. После кислотной активации концентрированных культуральных супернатантов (см. выше), значительная активность по свертыванию молока наблюдалась в образцах, приготовленных их трансформированной культуры Y.lipolytica АТСС 20799.
Конструирование плазмиды экспрессии/секреции рХХ-11.
Экспериментальные стадии конструирования плазмиды экспрессии/секреции прореннина рХХ-11 изображены на фиг.10. Эта плазмида содержит последовательность промотора XPR2 и сигнальный пептид из 22 аминокислотных остатков, присоединенный к последовательности, кодирующей прореннин. План конструирования, использованный для pXX-11, был подобен использованному для рХХ-22 и рХХ-33. Фрагмент промотора получали по стандартной реакции связывания при использовании фрагмента ДНК HindIII-BgIII рХНР-24, приблизительно, 750 п.о. и синтетического фрагмента с последовательностью
5' TGGCCGCTCCCCTGCGCCGCCCTGCCGCTGAGATCACTAG 3'
3' AAGACCGGCGAGGGCACCGGCGGGGACGGCGACTCTAGTGATCCTAG 5ʹ __→
и Т4 лигазы с последующим расщеплением HindIII и BamHI. Образующиеся связанные последовательности очищали гель-электрофорезом, выделяя фрагменты ДНК HindIII-BamHI в 790 п.о. Второй фрагмент, кодирующий остатки прореннина 6-151, изолировали из pLS-3 расщеплением BamHI и XmaI и очисткой на геле образующегося фрагмента ДНК BamHI-XmaI в 440 п.л. Третий фрагмент, содержащий остальную часть структурного гена прореннина, терминатор XPR2 и последовательности челночного вектора получали расщеплением pLS-3 HindIII и XmaI очисткой на геле фрагмента вектора приблизительно в 8,0 тыс.п. Затем эти три фрагмента ДНК связывали, используя стандартную методику, описанную выше. Реакционную лигирующую смесь использовали для трансформации штамма ММ294 E. coli К12. Плазмиды выделяли из отобранных трансформантов и плазмиду рХХ-11 идентифицировали по ее рестрикционной карте (фиг.10). Часть XPR2 прореннин этой плазмиды секвенировали для подтверждения нужной последовательности синтетической ДНК и правильного соединения нужных фрагментов.
Y.lipolytica АТСС 20774 затем трансформировали рХХ-11, расщепленной SпаBI, для образования Y.lipolytica 20778, и прореннин, выделенный в культуральную среду трансформированными культурами, анализировали, как описано выше в случае pLS-3. Присутствие прореннина в культуральном супернатанте подтверждалось согласно вышеописанной методике.
Анализы на свертываемость молока (см. выше) показали, что имеется значительная активность по свертыванию молока в культуральном супернатанте трансформантов АТСС 20778, содержащих рХХ-11.
Пример 2. Конструирование "платформы".
Ген В10 дикого типа, соответствующий bio-6 аллею в АТСС 20774, клонировали путем комплементации следующим образом. Библиотека генов частично Sau 3А-расщепленной хромосомной ДНК Y.lipolytica, введенной в BamHI cайт [LD 40 (которая представляет собой pBR322 плюс LEU2 в сайте EcoRI), была сконструирована и приготовлено большое количество библиотечной ДНК как плазмидного препарата смешанной культуры E.coli (это та же самая библиотека, что была использована для клонирования гена XPR2). Несколько микрограмм библиотечной ДНК расщепляли ферментом ApaI (который расщепляет одну связь в участке LEU2). Затем эту ДНК использовали для трансформации АТСС 20774 (Ieu2 xpr2 bio), и трансформированные смеси вызывались на синтетической среде с недостатком лейцина. Были получены десятки тысяч лейцин-независимых трансформантов. Чтобы обнаружить колонии, если они есть, содержащие библиотечные плазмиды, включающие ген В10, лейцин-независимые трансформанты методом отпечатков высевались на агаровые чашки, содержащие биотин-селективную среду (рецептура на литр: 25 мг дестибиотина, 20 г глюкозы, 5 г сульфата аммония, 1 г KH2PO4, 0,5 г MgSO4 · 7H2O, 0,1 г CaCl2, 0,1 г NaCl, 500 мкг борной кислоты, 400 мкг тиамин. HCl, 400 мкг ZnSO4 · 7H2O, 400 мкг MnSO4 · H2O, 200 мкг Na2MgO4 · 2H2O, 200 мкг FeCl3 · 6H2O, 100 мкг KI и 40 мкг CuSO4 · 5H2O).
Один из нескольких Y. lipolytica В10-трансформантов, растущий на биотин-селективной среде, был назван DL 31. Затем приступили к извлечению плазмидной библиотеки генов, содержащей ген В10 штамма DL 31 Y.lipolytica. Была приготовлена хромосомная ДНК из культуры штамма DL 31. Несколько микрограммов этой хромосомной ДНК расщепляли ферментов рестрикции ApaI для того, чтобы вырезать плазмиду библиотеки. Аликвоту расщепленной ДНК использовали в реакции связывания для циркуляризации неизвестной плазмиды библиотеки. Продукт связывания затем использовали для трансформации культуры E.coli к устойчивости к ампициллину путем введения неизвестной В10-содержащей плазмиды в E. coli. Было получено несколько трансформантов E.coli, устойчивых к ампициллину. Из трансформантов E.coli были получены препараты плазмид. Рестрикционные перевары таким образом полученной плазмидной ДНК показывают, что неизвестная В10-содержащая плазмида эквивалентна pLD 40 со встройкой в сайт BamHI. Эта плазмида должна была первоначально происходить из нашей библиотеки генов и была названа pLD 51.
Плазмида pLD 56 была образована как субклон pLD 51 путем удаления гена LEU2 из pLD 51, следующим образом. Аликвоту плазмиды pLD 51 расщепляли ферментом EcoRI для удаления участка LEU2. Расщепленную ДНК использовали в реакции связывания ДНК для рециркуляризации плазмиды. Затем была выполнена трансформация E.coli для клонирования меньшей В10-содержащей плазмиды. Один из ампициллин-устойчивых трансформантов E.coli, как показано, содержал ожидаемую меньшую плазмиду, которая была названа pLD56. Было выполнено несколько рестрикционных расщеплений pLD 56. В10-содержащий сегмент pLD56, который обнаруживается как вставка в BamHI сайт pBR322, имеет длину приблизительно 3,6 тыс.п.
Очень грубая рестрикционная карта вставки ДНК Y.lipolytica из 3,6 тыс.п. в BamHI сайт pBR322 (включая pLD 56) описана ниже с указанием в скобах примерного расстояния в парах оснований от начала вставки. Размеры были оценены на нескольких агарозных гелях и, возможно, содержат относительно большие количественные погрешности: PvuII (800), PvuII (1200), PstI (1800), MIuI (2000), Pst (2300), EcoRv (2700), NcoI (3200) (для ориентации: SaII сайт pBR 322 будет предшествовать описанным сайтам и сайт HindIII будет следовать за ними).
Штамм АТСС 20774 (MATB Ieu 2-40 bio-6 xpr 2-1002) трансформировали интактной pLD 56 (рBR322 плюс приблизительно 3,6 тыс.п. хромосомной ДНК Y.lipolytica, содержащей ген В10). Три различных биотин-независимых трансформанта испытывали на высокочастотную трансформацию NruI-расщепленной (мишень для pKR322) pLD 40 (LEU2 на pBR322) относительно родительского штамма для определения, который из них содержал резидентную pBR322, интегрированную в участок В10. Все три показали способность к высокочастотной трансформации ввиду интеграции pLD40 в резидентную pBR322. Это было подтверждено Саузерн-блот анализом по гибридизации. Один из трех исходных В10-трансформантов Y.lipolytica был назван DL118 и использован далее как реципиент ДНК. Вышеупомянутая рестрикционная карта требовалась для установления: а) что использовать в качестве В10-специфичной пробы гибридизации (область NcoI-PvuII), б) какой фермент требуется, чтобы правильно вырезать плазмиду pLD 56 (MI и I), в) какой фермент расщепляет только одну связь в области pBR322 (CIaI) и г) какой фермент не расщепляет плазмиду вообще (ApaI). Гибридизация по Саузерну CIaI и ApaI переваров ДНК из АТСС 20774 и DL 118 (испытанная с В10-фрагментом) показала, что, как ожидалось, биотин-участок DL118) при сравнении с В10-участком АТСС 20774) был разрушен добавлением ДНК размера приблизительно pLD 56. MIuI перевары ДНК DL 118 (проба с pBR322) показали далее, что добавка была того же размера, как интактная pLD 56.
Конструирование плазмиды экспрессии/секреции pLX-34.
Была сконструирована плазмида экспрессии, которая содержит последовательность, кодирующую прореннин, с сигналами секреции XPR2 (препpопоследовательности из 157 аминокислот) ниже от промотора LEU2. Эта плазмида экспрессии демонстрирует, что может быть использован иной, чем XPR2 промотор для достижения секреции чужеродных протеинов. Кроме того, этот вектор экспрессии способен вызвать экспрессию/секрецию независимо от сайта интеграции в геноме Y.lipolytica. Успешное выделение прореннина с промотором, иным, чем промотор XPR, демонстрирует возможность конструкции вектора экспрессии для идентификации альтернативных новых сильных промоторов в Y.lipolytica. В дополнение к этому данный подход может быть использован для получения культуры экспрессии с двумя отдельными гибридными генами прореннина, один экспрессируемый промотором LEU2, а другой промотором XPR2, интегрированным в различных сайтах генома хозяина.
Экспериментальные стадии, использованные для конструирования вектора экспрессии, который содержит ген прореннина с сигналами секреции щелочной протеазы (предпоследовательность XPR2 157 аминокислот), экспрессируемыми последовательностями промотора LEU2, изображены на фиг.17. Конструирование этой плазмиды было инициировано приготовлением фрагмента промотора LEU2, содержащего около 300 пар оснований 5'-нетранслированной последовательности, предшествующей кодону инициации трансляции ATG гена бета-изопропилмалатдегидрогеназы (фиг.14-16). Фрагмент ДНК HindIII-FokI из 300 п.о. содержащий участок из 270 п.о. последовательности промотора LEU2, был выделен из челночного вектора pLD 40. Этот фрагмент был связан с синтетическим линкером из 54 п.о. имеющим последовательность
-------Leu2-------
Fok I
5'-ATACAACCACFCFCFTCCACAATG
3'-TTGGTGTGTGTAGGTGTTAC
--------Xpr--------
AAGCTCGCTACCGCCTTTACTATTCTCACTGCCGTTC-3'
TTCGAGCGATGGCGGAAATGATAAGAGTGACGGC-5'
T4 лигазой с последующим расщеплением HindIII. Образующиеся линкерные последовательности очищали гель-электрофорезом, выделяя фрагмент ДНК HindIII-BgII приблизительно из 600 п.о. Второй фрагмент, кодирующий остальную часть препропоследовательности XPR2 и первые 152 аминокислоты прореннина, изолировали из плазмиды экспрессии pXX-33 (фиг.6) расщеплением BgII и XmaI и очисткой на геле образующегося фрагмента ДНК из 887 п.о. Третий фрагмент, содержащий остальную часть гена прореннина, терминатор XPR2 и последовательности вектора, приготовляли расщеплением рХХ-33 HindIII и XmaI и очисткой на геле, выделяя приблизительно 8,0 тыс.п. фрагмента вектора. Три фрагмента ДНК связывались при использовании стандартной методики, описанной выше. Лигирующая смесь использовалась для трансформации штамма HB101 E.coli К12. Плазмиды изолировали из трансформантов, отобранных на основе устойчивости к ампициллину, и плазмиду pL X-34 идентифицировали по ее рестрикционной карте (фиг. 13).
Y. lipolytica АТСС 20794 (DL 118) трансформировали NruI-расщепленной ДНК pL Х-34 для получения Y.lipolytica АТСС 20795 (DL 251) и прореннин, выделенный в культуральную жидкость лейцин-независимыми трансформантами культуры, анализировали, как описано выше в случае pLS-3. Данная методика трансформации обеспечивала интеграцию pLX-34 в последовательность pBR322, предварительно введенную в bio локус в хромосоме хозяина (описано выше). Интеграция pL X-34 в этот сайт была подтверждена Southern анализом.
Использование DL 118 в качестве реципиента
Гибридизация по Саузерну выполнялась следующим образом: NruI перевары ДНК из трансформантов DL 118 (гибридизующихся с прохимозиновой пробой, например, когда входящая плазмида представляла плазмиду экспрессии прохимозина) точно вырезали вошедшую плазмиду. Несколько нанограмм NruI расщепленной трансформирующей плазмиды использовались для проверки правильности размера гибридизирующейся полосы. Также NruI перевары (MIuI не выщепляет трансформирующую плазмиду) ДНК из этих трансформантов (анализированных с 32р-помеченной pBR322), что резидентная pBР322 последовательность DL 118 была разрушена при добавлении одной или более молекул трансформирующей плазмиды. Это показывает, что интеграция произошла в нужном сайте.
Трансформированную культуру Y.lipolytica АТСС 20795 (DL 251) выращивали в среде ДЭПД при 22oC, чтобы благоприятствовать экспрессии промотора LEU2. Присутствие прореннина в культуральных супернатантах было подтверждено анализом на свертываемость молока (см.выше) культуральных супернатантов, активированных кислотой, и проверялось иммуноблоттингом (см. выше). Эти результаты показывают, что гибридный ген представляет собой независимую единицу экспрессии, способную к экспрессии/секреции при интеграции в сайт, иной чем XPR2 или LEU2. Это позволяет сконструировать культуру экспрессии с множественными гибридными генами, потенциально способными увеличивать уровень внеклеточного прореннина.
Пример 3. Последовательность синтетического гена для человеческого С5а.
План, разработанный для достижения бактериальной продукции человеческого анафилатоксина С5а, был аналогичен предыдущим методам, использованным для синтеза и экспрессии EGF, как описано в ЕР заявке N 0147178. В нем применялось конструирование гена, в котором кодирующую последовательность для активированного дополнительного компонента С5а, получали синтетически. Зная аминокислотную последовательность человеческого С5а, сконструировали фрагмент ДНК, кодирующий 74 аминокислоты (фиг.9). Синтетическая генная последовательность была выбрана, чтобы максимизировать утилизацю предпочтительного кодона E.coli и S.cerevisiae и обеспечить несколько сайтов рестрикции эндонуклеазой для облегчения характеристики. Данный подход обеспечивает прямую экспрессию анафилатоксина в E.coli путем введения кодона инициации АТС для синтеза протеина перед триплетом, кодирующим первую аминокислоту полипептида С5а. Для облегчения его введения в нужной ориентации в плазмиду pBR322, был сконструирован синтетический ген С5а, содержащий сайты EcoRI и HindIII на своих концах. Для получения конечной генной последовательности С5а, были синтезированы фосфорамидатным методом десять 47-меров и соединены в двухцепочечный фрагмент ДНК из 235 п.л. Фрагмент гена С5а вводили с соответствующим образом расщепленную pBR322 и клонированный ген идентифицировали путем рестрикционного анализа плазмидной ДНК из произвольно выбранных трансформантов. Несколько клонов С5а затем анализировали секвенированием ДНК для идентификации клона с правильной последовательностью. Нужная нуклеотидная последовательность для участка гена С5а была найдена в 2 из 5 исследованных клонов.
Бактериальная экспрессия человеческого С5а. Конструирование плазмиды экспрессии С5а было инициировано расщеплением субклона С5а эндонуклеазой рестрикции EcoRI с последующим дефосфорилированием путем обработки бактериальной щелочной фосфатазой. Используя фрагмент ДНК EcoRI из pPFZ-R2 в 360 п.о. содержащий trp промотор-оператор и последовательности сайта связывания с рибосомой, была сконструирована плазмида экспрессии С5а. Компонентные клетки штамма HB101 E.coli трансформировали лигирующей смесью. Несколько устойчивых к лекарствам колоний от каждой трансформации очищали, и их плазмидные ДЕК подвергали рестрикционному анализу для идентификации ДНК с trp промотором в ориентации, которая будет проявляться в транскрипции гена С5а. Множественные изоляты из этой реакции связывания были идентифицированы с помощью плазмид, содержащих ген анафилатоксина, примыкающий к последовательности бактериального промотора в конфигурации, требуемой для прямой экспрессии С5а. Рестрикционная карта плазмиды экспрессии С5а р С5а-48 представлена на фиг.12. Экспрессия и выделение человеческого анафилатоксина в Y.lipolytica.
Вектор экспрессии/секреции рС5аХ-3, обеспечивающий секрецию человеческого анафилактоксина С5а, был приготовлен по методике, изложенной в примере 1 для рXX-33. Y.lipolytica АТСС 20774 затем трансформировали этим вектором секреции, и человеческий С5а, продуцированный трансформированными культурами, анализировали, как описано выше, за исключением того, что в иммуноблоттинге были использованы козьи антитела к С5а и кроличьи антитела к козьему IgG. Для плазмиды, описанной в данном примере, было подтверждено наличие С5а в культуральном супернатанте.
Конструирование плазмиды экспрессии/секреции рС5аХ-3.
Конструирование плазмиды экспрессии/секреции анафилатоксина рС5аХ-3 показаны на фиг. 11. Эта плазмида содержит последовательность для "полного" промотора XPR2 и сигнала из 157 аминокислотных остатка и про-пептид, присоединенный к синтетической последовательности, кодирующей 74 аминокислотных остатка С5а. План конструирования, использованный для рС5аХ-3, был подобен использованному для рХХ-33. Сначала плазмиду рХНР-24 (или другую плазмиду, содержащую нужную последовательность) расщепляли HindIII и AvaI и фрагмент из 1150 п. о. содержащий промотор XPR2, очищали на геле. Второй фрагмент, содержащий 3' конец про-пептида XPR2 и последовательность структурного гена С5а, получали по стандартной реакции связывания при использовании фрагмента ДНК HinfI-HindIII с приблизительно 220 п.о. из плазмиды экспрессии E.coli рС5а-48 и синтетического фрагмента с последовательностью
5' CCGAGATTCCTGCTTCTTCTAATGCCAAGCGA 3'
3' CTAAGGACGAAGAAGATTACGGTTCGCTTGA 5'
и Т4 лигазы с последующим расщеплением AvaI и HindIII. Образующиеся связанные последовательности очищали гель-электрофорезом, отбирая фрагмент AvaI-HindIII из около 250 п.о. фрагмент HindIII-AvaI, содержащий промотор, и фрагмент AvaI-HindIII, кодирующий С5а, затем связывают Т4 лигазой с последующим расщеплением HindIII. Фрагмент приблизительно в 1,4 тыс.п. очищали на геле и использовали для связывания с HindIII расщепленным pterm 4 (описанным выше). Продукт связывания использовали для трансформации штамма ММ294 E.coli К12. Плазмиды, отобранные по устойчивости к ампициллину, изолировали из отобранных трансформантов, и плазмиду рС5аХ-3 идентифицировали по ее рестрикционной карте. Штамм Y.lipolytica РС-30869, АТСС 20774 затем трансформировали SпаBI расщепленной рС5аХ-3 и анафилатоксин, выделенный в культуральную среду, трансформированными культурами, анализировали, как описано выше. Присутствие С5а в культуральном супернатанте было подтверждено по вышеописанной методике.
Известно, что многие протеины, которые синтезируются рибосомами, связанными с эндоплазмической сетью, производятся в виде гликопротеинов. Действительно, гликозилирование может оказывать влияние на секрецию данного протеина. N-связанное гликозилирование эукариотических протеинов происходит в трипептидных последовательностях аспарагин-Х-треонин и аспарагин-Х-серин, где Х может быть любой аминокислотой, кроме, возможно, аспарата (Hubbard S. и др. 1981, Ann. Rev. Biochem. 50, 555). Аминокислотная последовательность прореннина включает два таких трипептида, однако гель-электрофоретический анализ прореннина, выделяемого в культурах Y.lipolytica, не показывает наличия гликозилирования. В других выделяемых эукариотических протеинах не все аспарагин-Х-треонин/серин сайты гликозилированы. Видимо, определенные аспарагины в трипептидных последовательностях не гликозилируются, так как они недоступны ферментам гликозилирования.
В случае человеческого С5а аминокислотная последовательность включает отдельный сайт гликолизирования или трипептидную последовательность (Asп-IIe-Ser), которая обычно содержит сложный олигосахарид, присоединенный к аспарагину (Fernangez H. и др. 1976, J.Immunol, 117, 1668). Часть молекул С5а, выделяемых в культуральную среду Y.lipolytica, как представляется, гликозилирована, так как широкая область антигенной активности наблюдается в высокомолекулярной части при иммуноблоттинге. Данная гетерогенная электрофоретическая мобильность аналогична наблюдаемой для других секретируемых протеинов и, вероятно, является следствием различий в степени добавления углеводов. По настоящему изобретению очевидное гликозилирование определенных секретируемых чужеродных протеинов предполагает, что экспрессия и секреция Y.lipolytica будут полезны для получения многих обычно гликозилированных эукариотических пиротеинов.
Формула изобретения: 1. Способ получения прореннина, включающий культивирование штамма дрожжей, трансформированного рекомбинантной плазмидной ДНК, кодирующей протеин, и выделение протеина, отличающийся тем, что культивируют J. lipolytica, трансформированный рекомбинантной плазмидой ДНК pL5/3, или pXX-11, или pXX-22, или pXX-33, или pLX-34.
2. Способ по п. 1, отличающийся тем, что культивируют штамм дрожжей J. lipolytica АТСС 20775 и 20776, или 20778, или 20779, или 20780, или 20795.
3. Способ получения штамма дрожжей-продуцента прореннина, предусматривающий трансформацию штамма дрожжей рекомбинантной плазмидой ДНК, кодирующей протеин, и отбор трансформантов, отличающийся тем, что в качестве рекомбинантной плазмидной ДНК используют pLS-3 или pXX-33, или pXX-22, или pXX-11, или pLX-34, а трансформируют штамм дрожжей J.lipolytica АТСС-20688, или 20774, или 20794.
4. Способ получения рекомбинантной плазмидной ДНК pXX-33, заключающийся в том, что проводят расщепление плазмиды pXHP-24 рестриктазами Hind III и Ava I до образования фрагмента размером 1150 п.о. изолируют указанный фрагмент, связывают его с синтетическим фрагментом ДНК со следующей нуклеотидной последовательностью: 5'CCG AGA TTCCTGCTT CTT CTAATGCC AAGCGAGCTGA 3' CT AAGGACGAA GAA GATTACGGTTCGCTCGACT TCACTAG 3' AGTGATC 5', в присутствии лигазы полученную рекомбинантную молекулу расщепляют рестриктазами Hind III и Bam HI до образования фрагмента размером 1196 п.о. фрагмент выделяют, связывают его с фрагментом размером 4 40 п.о. полученным в результате расщепления плазмиды pLS3 рестриктазами Bam HI и Xma I и Hind-III-Xma I фрагментом плазмиды pLS3 размером 8,0 т.п. в присутствии T4 лигазы, далее трансформируют штамм бактерий E.coli, полученный рекомбинантной ДНК, отбирают устойчивые к ампициллину трансформанты и выделяют плазмиду pXX-33.
5. Способ получения рекомбинантной плазмидой ДНК pXX-22, заключающийся в том, что расщепляют плазмиду pXHP24 рестриктазами Hind III и Bgl II до образования фрагмента размером 890 п.о. изолируют указанный фрагмент, связывают его фрагмент с синтетическим фрагментом ДНК со следующей нуклеотидной последовательностью: 5'GATCTTGCTGAGATCACTAC AACGACTCTAGTGATCCTAG 5' в присутствии T 4 лигазы, расщепляют полученную рекомбинантную ДНК рестриктазами Hind III и Bam HI до образования фрагмента размером 920 п.о. фрагмент отделяют, связывают его с фрагментом размером 440 п.о. полученным в результате расщепления плазмиды pLS3 рестриктазами Bam HI и XmaI и фрагментом размером 8,0 т. п. в присутствии T 4 лигазы, далее трансформируют штамм E.coli полученной рекомбинантной ДНК, отбирают устойчивые к ампициллину трансформанты, из которых выделяют плазмиду pXX-22.
6.Способ получения рекомбинантной плазмидной ДНК pXX-11, заключающийся в том, что расщепляют плазмиду pXHP24 рестриктазами Hind III-BnlI до образования фрагмента размером 750 п.о. отделяют указанный фрагмент, связывают его с синтетическим фрагментом ДНК со следующей нуклеотидной последовательностью: 5' TGGCCGCTCCCCTGGCGCCCCTGCCGCTGAG 3' AAG ACCGGCGAGGGGACCGGCGGGTCGGCGACTC ATCACTAG 3' TAGTGATCCTAG 5' в присутствии T4 лигазы, расщепляют полученную рекомбинантную дНК рестриктазой Hind III и Bam HI до образования фрагментов размером 790 п. о. связывают указанный фрагмент с фрагментом размером 440 п.о. полученным в результате расщепления плазмиды pLS3 рестриктазами Bam HI и Xma I размером 8 т.п. в присутствии T4 лигазы, далее транспортируют штамм E. coli полученной рекомбинантной ДНК, отбирают устойчивые к ампициллину трансформанты и изолируют плазмиду pXX-11 из указанных трансформантов.