Главная страница  |  Описание сайта  |  Контакты
Патент на изобретение №2468035

(19)

RU

(11)

2468035

(13)

C2

(51) МПК C07K14/47 (2006.01)

C07K17/02 (2006.01)

C07K19/00 (2006.01)

C12N1/15 (2006.01)

C12N1/19 (2006.01)

C12N1/21 (2006.01)

C12N5/10 (2006.01)

C12N15/09 (2006.01)

G01N33/15 (2006.01)

G01N33/50 (2006.01)

C07K14/705 (2006.01)

(12) ОПИСАНИЕ ИЗОБРЕТЕНИЯ К ПАТЕНТУ Статус: по данным на 16.11.2012 - нет данных Пошлина:

(21), (22) Заявка: 2009144799/10, 22.05.2008

(24) Дата начала отсчета срока действия патента:

22.05.2008

Приоритет(ы):

(30) Конвенционный приоритет:

23.05.2007 JP 2007-137275

(43) Дата публикации заявки: 27.06.2011

(45) Опубликовано: 27.11.2012

(56) Список документов, цитированных в отчете о

поиске: XU JIANGUO ET AL., Heterodimerization of alpha2A- and betal-adrenergic receptors, JOURNAL OF BIOLOGICAL CHEMISTRY, 2003, v.278, l2, p.10770-10777. LI M. ET AL., Modulation of dopamine D2 receptor signaling by actin-binding protein (ABP-280), MOLECULAR PHARMACOLOGY, 2000, v.57, 3, p.446-452. MCLATCHIE L.M. ET AL., RAMPS REGULATE THETRANSPORT AND LIGAND SPECIFICITY OF THE CALCITONIN-RECEPTOR-LIKE RECEPTOR, NATURE, 1998, v.393, p.333-339. FORD ANTHONY P. D. W. ET AL., Pharmacological pleiotropism of the human recombinant alpha-1A-adrenoceptor: Implications for alpha-1-adrenoceptor classification, BRITISH JOURNAL OF PHARMACOLOGY, 1997, v.121, 6, p.1127-1135. FOERSTER K. ET AL., Cardioprotection specific for the G protein Gi2 in chronic adrenergic signaling through beta2-adrenoceptors, PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA, 2003, v.100, 24, p.14475-14480. US 20060019256 A1, 26.01.2006. RU 2260805 C2, 20.09.2005.

(85) Дата начала рассмотрения заявки PCT на национальной фазе: 23.12.2009

(86) Заявка PCT:

JP 2008/059459 20080522

(87) Публикация заявки PCT:

WO 2008/146707 20081204

Адрес для переписки:

190000, Санкт-Петербург, ул. Малая Морская, 15, офис 5, ВОХ 1125, ООО "ПАТЕНТИКА", М.И.Ниловой, рег. 378

(72) Автор(ы):

МУРАМАЦУ Икунобу (JP)

(73) Патентообладатель(и):

Фармаком ЛЛС (JP),

НИППОН ЧЕМИФАР КО., ЛТД. (JP)

(54) СОПРЯЖЕННЫЙ С G-БЕЛКОМ РЕЦЕПТОР, ИМЕЮЩИЙ ИЗМЕНЕННОЕ СРОДСТВО К ЛИГАНДАМ, И ЕГО ПРИМЕНЕНИЕ

(57) Реферат:

Изобретение относится к области биотехнологии, конкретно к исследованию рецептору, сопряженному с G-белком, и может быть использовано в медицине. Получен белковый комплекс, обладающий сродством GPCR 1L к лиганду, включающий GPCR 1L и полипептид с последовательностью аминокислот SEQ ID NO:1. Связывание указанного рецептора, сопряженного с G-белком, с полипептидом изменяет сродство к лиганду рецептора. Также предложены методы скрининга агонистов или антагонистов рецептора, сопряженного с G-белком, с использованием трансформанта, в котором экспрессируется указанный измененный рецептор, сопряженный с G-белком. Заявленное изобретение обеспечивает проведение анализа функции многих предполагаемых рецепторов, сопряженных с G-белком, структура которых еще не известна. 8 н. и 4 з.п. ф-лы, 3 ил., 2 табл., 4 пр.

Область техники

Настоящее изобретение относится к рецепторам, сопряженным с G-белком (GPCRs), которые характеризуются измененным сродством к лигандам, и применению указанных рецепторов. В частности, настоящее изобретение относится к GPCRs, сродство к лигандам которых изменено в результате образования комплекса с определенным белком, и их применению.

Уровень техники

Многие реакции в живых организмах вызваны проникновением в клетку внеклеточной информации и распространению информации по клетке. Мембранные рецепторы служат медиаторами, через которые внеклеточная информация передается в клетки. Хорошо известно, что GPCRs, имеющие 7 трансмембранных доменов, являются одним из основных типов связанных с мембраной рецепторов.

Когда лиганд (например, аминокислота, пептид или амид) связывается с GPCR, GPCR передает информацию в клетку через тримерный G-белок. G-белки, сопряженные с GPCRs, подразделяют на Gs, Gi, Gq и другие, которые активируют/инактивируют различные эффекторные пути (например, сигнальный путь цАМФ, сигнальный путь цГМФ и сигнальный путь фосфолипазы С), соответственно. Например, 1 -адренэргический рецептор главным образом сопряжен с Gq-белком для активации системы фосфолипазы С, что приводит к образованию диацилглицерола и инозитолтрифосфата, таким образом повышая внутриклеточную концентрацию Са 2+ . 2 -адренергический рецептор главным образом сопряжен с Gi-белком для подавления аденилатциклазной системы, что, таким образом, снижает уровень цАМФ. Кроме того, -адренергический рецептор главным образом сопряжен с Gs-белком для активации аденилатциклазной системы, что, таким образом, приводит к повышению уровня цАМФ.

GPCRs повсеместно встречаются и функционируют в нашем организме. Например, 1 -адренэргические рецепторы представлены в периферических кровеносных сосудах, предстательной железе и обеспечивают сокращения. Также известно, что 1 -адренэргические рецепторы функционируют в центральной нервной системе, -адренергические рецепторы в сердце и жировой ткани играют важную роль для регуляции частоты сердечных сокращений и расщепления жиров.

Известно, что GPCRs и зависимые от них системы передачи сигналов не только контролируют физиологический гомеостаз в нашем теле, но и определяют патофизиологическое состояние при различных заболеваниях. Поэтому для того, чтобы лечить такие заболевания, очень важно определить конкретные GPCRs, связанные с определенными заболеваниями, и затем разработать специфичные в отношении GPCRs лекарственные средства (например, агонисты или антагонисты).

Не патентная литература 1

Muramatsu, I. et al. Br. J. Pharmacol., 99: 197 (1990)

He патентная литература 2

Muramatsu, I. et al. Pharmacol. Commun., 6: 23 (1995)

He патентная литература 3

Morishima, S. et al. J. Urol. 177: 377-381 (2007)

He патентная литература 4

Molenaar, P. and Parsonage, W.A.Trends Pharmacol. Sci., 26: 368-375 (2005)

Не патентная литература 5

Samaha, A.N. et al., J. Neurosci. 27: 2979-2986 (2007)

Краткое описание изобретения

В изучении GPCR произошел значительный прогресс, в результате чего было обнаружено большое количество GPCR. Однако все еще существуют несколько предполагаемых GPCRs, для которых определены фенотипы, но структура которых пока неизвестна. Например, 1 -адренергические рецепторы разделяют на три подтипа ( 1A , 1B и 1D ) на основе кодирующих их различных генов. Однако было выдвинуто предположение о существовании в дополнение к классическим 1 -адренергическим рецепторам, дополнительного подтипа ( 1L ) рецепторов, отличающихся по фармакологическому профилю (фенотипу) от классических подтипов. Рецепторы подтипа 1L обладают существенно сниженным сродством к типичному блокатору 1 - рецепторов (празозину) по сравнению с 1A -, 1B - и 1D -подтипами. 1L -подтип обнаруживается только в интактных полосках или сегментах нативных тканей, но не обнаруживается в гомогенатах тканей (см. Не патентная литература 1-3). Дополнительно, известно, что подтипы 1 адреналинового рецептора ( 1H и 1L ), отличающиеся по фенотипу, кодированы одними и теми же генами (см. Не патентная литература 4). Для этого подтипа известен только фенотип, но не его сущность. Подобное можно также отметить для допаминовых рецепторов, мускариновых рецепторов или эндотелиновых рецепторов (см. Не патентная литература 5 и т.п.). Однако механизмы формирование разных фенотипов продуктами одного и того же гена до сих пор не известны.

Настоящее изобретение было создано с учетом этой проблемы, и целью настоящего изобретения является обеспечить способ анализа функции рецептора, сопряженного с G-белком, структура которого не известна.

Белковый комплекс согласно настоящему изобретению характеризуется связыванием GPCR с: (1) полипептидом, который имеет последовательность аминокислот SEQ ID NO:1; (2) полипептидом (i), который имеет последовательность аминокислот SEQ ID NO:1 с делецией, вставкой, заменой или добавлением одной или нескольких аминокислот, и (ii) способен изменять сродство к лиганду GPCR, с которым указанный полипептид образовал комплекс; (3) полипептидом, кодируемым полинуклеотидом, который имеет последовательность нуклеотидов SEQ ID NO:2; (4) полипептидом (i), кодируемым полинуклеотидом, который имеет последовательность нуклеотидов SEQ ID NO:2 с делецией, вставкой, заменой или добавлением одной или нескольких нуклеотидов, и (ii) способен изменять сродство к лиганду GPCR, с которым указанный полипептид образовал комплекс; (5) полипептидом (i), кодируемым полинуклеотидом, которой способен гибридизоваться в жестких условиях гибридизации с полинуклеотидом, который имеет последовательность, комплементарную последовательности нуклеотидов SEQ ID NO:2, и (ii) способен изменять сродство к лиганду GPCR, с которым указанный полипептид образовал комплекс; или (6) полипептидом (i), кодируемым полинуклеотидом, последовательность которого на 70% и более идентична последовательности полинуклеотида, который имеет последовательность нуклеотидов SEQ ID NO:2, и (ii) способен изменять сродство к лиганду GPCR, с которым указанный полипептид образовал комплекс.

Способ получения белкового комплекса согласно настоящему изобретению характеризуется наличием стадии осуществления совместного присутствия GPCR и белка на липидной мембране, при этом указанный полипептид представляет собой: (1) полипептид, который имеет последовательность аминокислот SEQ ID NO:1; (2) полипептид (i), который имеет последовательность аминокислот SEQ ID NO:1 с делецией, вставкой, заменой или добавлением одной или нескольких аминокислот, и (ii) способен изменять сродство к лиганду GPCR, с которым указанный полипептид образовал комплекс; (3) полипептид, кодируемый полинуклеотидом, который имеет последовательность нуклеотидов SEQ ID NO:2; (4) полипептид (i), кодируемый полинуклеотидом, который имеет последовательность нуклеотидов SEQ ID NO:2 с делецией, вставкой, заменой или добавлением одной или нескольких аминокислот, и (ii) способен изменять сродство к лиганду GPCR, с которым указанный полипептид образовал комплекс; (5) полипептид (i), кодируемый полинуклеотидом, который способен гибридизоваться при жестких условиях гибридизации с полинуклеотидом, который имеет последовательность нуклеотидов, комплементарную последовательности нуклеотидов SEQ ID NO:2, и (ii) способен изменять сродство к лиганду GPCR, с которым указанный полипептид образовал комплекс; или (6) полипептид (i), кодируемый полинуклеотидом, последовательность которого на 70% и более идентична последовательности полинуклеотида, который имеет последовательность нуклеотидов SEQ ID NO:2, и (ii) способен изменять сродство к лиганду GPCR, с которым указанный полипептид образовал комплекс.

Благодаря указанным признакам, настоящее изобретение может изменять сродство GPCR к лиганду. Другими словами, способ получения белкового комплекса согласно настоящему изобретению также может представлять собой способ изменения сродства GPCR к его лигандам.

Липидная мембрана согласно настоящему изобретению характеризуется содержанием белкового комплекса. Способ получения липидной мембраны согласно настоящему изобретению характеризуется стадией осуществления совместного присутствия GPCR и белка на липидной мембране, при этом указанный полипептид представляет собой: (1) полипептид, который имеет последовательность аминокислот SEQ ID NO:1; (2) полипептид (i), который имеет последовательность аминокислот SEQ ID NO:1 с делецией, вставкой, заменой или добавлением одной или нескольких аминокислот, и (ii) способен изменять сродство к лиганду рецептора, сопряженного с G-белком, с которым указанный полипептид образовал комплекс; (3) полипептид, кодируемый полинуклеотидом, который имеет последовательность нуклеотидов SEQ ID NO:2; (4) полипептид (i), кодируемый полинуклеотидом, который имеет последовательность нуклеотидов SEQ ID NO:2 с делецией, вставкой, заменой или добавлением одного или нескольких нуклеотидов, и (ii) способен изменять сродство к лиганду GPCR, с которым указанный полипептид образовал комплекс; (5) полипептид (i), кодируемый полинуклеотидом, способным гибридизоваться при жестких условиях гибридизации с полинуклеотидом, который имеет последовательность, комплементарную последовательности нуклеотидов SEQ ID NO:2, и (ii) способен изменять сродство к лиганду GPCR, с которым указанный полипептид образовал комплекс; или (6) полипептид (i), кодируемый полинуклеотидом, последовательность которого на 70% и более идентична последовательности полинуклеотида, который имеет последовательность нуклеотидов SEQ ID NO:2, и (ii) способен изменять сродство к лиганду GPCR, с которым указанный полипептид образовал комплекс.

Дополнительно, трансформант (трансформированная клетка или организм) согласно настоящему изобретению характеризуется тем, что он содержит белковый комплекс. Способ получения трансформанта согласно настоящему изобретению характеризуется стадией экспрессии указанного белкового комплекса и предпочтительно включает стадию введения в клетку гена, кодирующего GPCR, и гена, кодирующего полипептид.

Благодаря указанным признакам, настоящее изобретение облегчает анализ функции GPCR с измененным сродством к лиганду.

Способ скрининга агонистов или антагонистов GPCR с измененным сродством к лиганду согласно настоящему изобретению характеризуется присутствием стадий: [1] получения белкового комплекса посредством обеспечения совместного присутствия GPCR и полипептида на липидной мембране; и [11] инкубирования указанного белкового комплекса совместно с исследуемым веществом (потенциальным агонистом или антагонистом), при этом указанный полипептид представляет собой: (1) полипептид, который имеет последовательность аминокислот SEQ ID NO:1; (2) полипептид (i), который имеет последовательность аминокислот SEQ ID NO:1 с делецией, вставкой, заменой или добавлением одной или нескольких аминокислот, и (ii) способен изменять сродство к лиганду рецептора, сопряженного с G-белком, с которым указанный полипептид образовал комплекс; (3) полипептид, кодируемый полинуклеотидом, который имеет последовательность нуклеотидов SEQ ID NO:2; (4) полипептид (i), кодируемый полинуклеотидом, который имеет последовательность нуклеотидов SEQ ID NO:2 с делецией, вставкой, заменой или добавлением одного или нескольких нуклеотидов, и (ii) способен изменять сродство к лиганду GPCR, с которым указанный полипептид образовал комплекс; (5) полипептид (i), кодируемый полинуклеотидом, способным гибридизоваться при жестких условиях гибридизации с полинуклеотидом, который имеет последовательность, комплементарную последовательности нуклеотидов SEQ ID NO:2, и (ii) способен изменять сродство к лиганду GPCR, с которым указанный полипептид образовал комплекс; или (6) полипептид (i), кодируемый полинуклеотидом, последовательность которого на 70% и более идентична последовательности полинуклеотида, который имеет последовательность нуклеотидов SEQ ID NO:2, и (ii) способен изменять сродство к лиганду GPCR, с которым указанный полипептид образовал комплекс.

Способ получения трансформанта, экспрессирующего GPCR с измененным сродством к лиганду, согласно настоящему изобретению характеризуется присутствием стадии ингибирования экспрессии полипептида в клетке, в которой имеет место экспрессия GPCR, при этом указанный полипептид представляет собой: (1) полипептид, который имеет последовательность аминокислот SEQ ID NO:1; (2) полипептид (i), который имеет последовательность аминокислот SEQ ID NO:1 с делецией, вставкой, заменой или добавлением одной или нескольких аминокислот, и (ii) способен изменять сродство к лиганду рецептора, сопряженного с G-белком, с которым указанный полипептид образовал комплекс; (3) полипептид, кодируемый полинуклеотидом, который имеет последовательность нуклеотидов SEQ ID NO:2; (4) полипептид (i), кодируемый полинуклеотидом, который имеет последовательность нуклеотидов SEQ ID NO:2 с делецией, вставкой, заменой или добавлением одного или нескольких нуклеотидов, и (ii) способен изменять сродство к лиганду GPCR, с которым указанный полипептид образовал комплекс; (5) полипептид (i), кодируемый полинуклеотидом, способным при жестких условиях гибридизации гибридизоваться с полинуклеотидом, который имеет последовательность, комплементарную последовательности нуклеотидов SEQ ID NO:2, и (ii) способен изменять сродство к лиганду GPCR, с которым указанный полипептид образовал комплекс; или (6) полипептид (i), кодируемый полинуклеотидом, последовательность которого на 70% и более идентична последовательности полинуклеотида, который имеет последовательность нуклеотидов SEQ ID NO:2, и (ii) способен изменять сродство к лиганду GPCR, с которым указанный полипептид образовал комплекс.

Благодаря указанным признакам, настоящее изобретение облегчает анализ функции GPCR с измененным сродством к лиганду и обеспечивает возможность изменения сродства GPCR к лиганду. Таким образом, настоящее изобретение также может рассматриваться как способ изменения сродства GPCR к его лигандам.

Способ получения согласно настоящему изобретению предпочтительно является таким, что полипептид представляет собой эндогенный белок, и стадию подавления экспрессии полипептида осуществляют способом РНК интерференции. Также, указанная клетка может представлять собой трансформант, экспрессирующий экзогенный белок GPCR.

Способ скрининга агонистов или антагонистов GPCR с измененным сродством к лиганду согласно настоящему изобретению характеризуется присутствием стадий: [1] подавления экспрессии полипептида в клетке, в которой экспрессируется GPCR; и [11] инкубирования клетки совместно с исследуемым веществом (потенциальным агонистом или антагонистом), при этом полипептид представляет собой (1) полипептид, который имеет последовательность аминокислот SEQ ID NO:1; (2) полипептид (i), который имеет последовательность аминокислот SEQ ID NO:1 с делецией, вставкой, заменой или добавлением одной или нескольких аминокислот, и (ii) способен изменять сродство к лиганду рецептора, сопряженного с G-белком, с которым указанный полипептид образовал комплекс; (3) полипептид, кодируемый полинуклеотидом, который имеет последовательность нуклеотидов SEQ ID NO:2; (4) полипептид (i), кодируемый полинуклеотидом, который имеет последовательность нуклеотидов SEQ ID NO:2 с делецией, вставкой, заменой или добавлением одного или нескольких нуклеотидов, и (ii) способен изменять сродство к лиганду GPCR, с которым полипептид образовал комплекс; (5) полипептид (i), кодируемый полинуклеотидом, способным гибридизоваться при жестких условиях гибридизации с полинуклеотидом, который имеет последовательность, комплементарную последовательности нуклеотидов SEQ ID NO:2, и (ii) способен изменять сродство к лиганду GPCR, с которым указанный полипептид образовал комплекс; или (6) полипептид (i), кодируемый полинуклеотидом, последовательность которого на 70% и более идентична последовательности полинуклеотида, который имеет последовательность нуклеотидов SEQ ID NO:2, и (ii) способен изменять сродство к лиганду GPCR, с которым указанный полипептид образовал комплекс.

Предпочтительно, способ скрининга согласно настоящему изобретению дополнительно включает стадию измерения внутриклеточной концентрации Са 2+ или стадию измерения метаболизма внутриклеточного инозитолфосфата.

Согласно настоящему изобретению GPCR, который входит в состав белкового комплекса, предпочтительно представляет собой адренергический рецептор, допаминовый рецептор, мускариновый рецептор или рецептор эндотелина, а указанный адренергический рецептор может представлять собой -рецептор или -рецептор. Дополнительно, указанный допаминовый рецептор предпочтительно являлся D2 рецептором. Предпочтительно, -рецептор представляет собой 1 -рецептор, и более предпочтительно, 1 -рецептор представляет собой 1A -подтип указанного рецептора. В предпочтительном варианте реализации настоящего изобретения, белковый комплекс согласно настоящему изобретению представляет собой адренергический рецептор 1L -подтипа или 1L -подтипа.

Для более полного понимания сущности и преимуществ настоящего изобретения следует ссылаться на следующее ниже подробное описание изобретения совместно с прилагаемыми рисунками.

Краткое описание фигур

Фигура 1

На фигуре 1 показаны кривые насыщения связывания [ 3 Н]-силодозина в клетках 1L (эксперимент по связыванию целыми клетками).

Фигура 2

На фигуре 2(а) приведены кривые конкурентного связывания празозина в клетках 1L и 1A (эксперимент по связыванию целыми клетками). На фигуре 2(b) показаны кривые конкурентного связывания празозина в гомогенатах клеток 1L и 1A . Пунктирная линия с закрашенными квадратами: кривая конкурентного связывания празозина в целых клетках 1L была описана для сравнения с кривыми в гомогенатах.

Описания вариантов реализации изобретения

1. Белковый комплекс.

Настоящее изобретение обеспечивает белковый комплекс GPCR и определенного полипептида. В описании настоящего изобретения термин «комплекс» означает находящуюся в виде единого целого комбинацию множества веществ и «образование комплекса» и «объединение» взаимозаменяемы. Следует отметить, что необходимо только, чтобы множество веществ, образующих комплекс, взаимодействовали друг с другом в непосредственной близости, при этом указанные вещества могут связываться или не связываться друг с другом. В предпочтительном варианте реализации настоящего изобретения белковый комплекс согласно настоящему изобретению представляет собой GPCR и определенный полипептид, которые взаимодействуют друг с другом в непосредственной близости, и в итоге указанный белковый комплекс функционирует как GPCR с измененным сродством к лиганду.

Данное описание описывает настоящее изобретение на примере адренэргического рецептора (в частности 1A -подтипа) в качестве GPCR, сродство к лиганду которого изменено посредством взаимодействия с определенным полипептидом. Однако специалисту в данной области, который прочел настоящее описание, будет ясно, что GPCR, согласно настоящему изобретению, не ограничивается адренергическим рецептором. Кроме того, специалист в данной области сможет с легкостью получить информацию о последовательности GPCR, согласно настоящему изобретению.

Хорошо известно, что адренергические рецепторы опосредуют работу автономной нервной системы (симпатической нервной системы). Связывание адреналина, норадреналина и т.п. с адренергическим рецептором вызывает различные физиологические ответы, например сокращение гладкой мускулатуры сосудов, повышение кровяного давления и частоты сердечных сокращений, расширение зрачка и повышение уровня глюкозы в крови.

Прогресс в исследовании и развитие новых вариантов лекарственных средств позволили четко понять, что существуют различные типы адренергических рецепторов. Ранее, адренергические рецепторы подразделяли на -рецепторы и -рецепторы согласно их различиям в реакционной способности к изопротеренолу и фентоламину, и дополнительно классифицировали по фармакологическим подгруппам ( 1 -рецептор, 2 -рецептор и -рецептор). Известно, что эти рецепторы по-разному распределены в тканях и выполняют различные функции. Например, известно, что 1 -адренэргические рецепторы выполняют функцию важных медиаторов, которые вызывают сокращения гладкой мускулатуры сосудов, предстательной железы и т.п., и также известно, что они участвуют в управлении сознанием и эмоциями в центральной нервной системе.

В настоящий момент, когда закончено картирование генома человека, можно определить структуру и функции многих белков на генетическом уровне. В случае 1 -адренэргических рецепторов выделили три подтипа ( 1A , 1B и 1D ), на основании различных генов, которые их кодируют. Известно, что эти классические подтипы хорошо совпадают с фармакологическими подтипами. В этом отношении можно считать, что один подтип рецепторов в основном происходит от одного отдельного гена.

Однако давно показано, что в некоторых тканях нашего организма встречается и функционирует уникальный 1 -адренэргический рецептор. Из-за его низкого сродства к типичному блокатору 1 (празозину), этот уникальный подтип был назван « 1L -подтипом», несмотря на то, что соответствующий ген пока не был клонирован.

В таблице 1 приведена классификация и избирательность к лекарственным средствам 1 -адренэргических рецепторов.

[Таблица 1]

Классификация и селективность лекарственных средств в отношении 1 -адренэргических рецепторов

подтип

сродство (pKb)

Силодозин 1,3,4,5

Тамсулозин 1,3,4

Празозин 1,2,3,4,5

RS-17053 2,4

BMY 7378 4,5



10.7-9.5

10.4-9.9

10.6-9.3

9.1-8.4

6.9-5.6

1L

10.7-9.5

10.4-9.9

8.3-7.6

6.3

6.9-5.6



8.1

9.3

10.6-10.1

7.8

7.4

1D

8.6

9.9

10.1-9.9

7.8

9.1

Данные для соединений, приведенных в таблице 1, основаны на приведенных ниже публикациях:

1. Muramatsu, I. et al. Pharmacol. Commun., 6: 23 (1995)

2. Ford, АР. et al. Mol. Pharmacol., 49: 209 (1996)

3. Murata, S. et al. J. Urol., 164: 578 (2000)

4. Hiraizumi-Hiraoka, Y. et al. J. Pharmacol. Exp. Ther., 310: 995 (2004)

5. Murata, S. et al. Br. J. Pharmacol., 127: 19 (1999)

В биологических исследованиях было показано, что 1L -подтип является функциональным рецептором в нижних отделах мочеполовой системы человека и других млекопитающих. Также обнаружили 1L -подтип в интактных сегментах нативных тканей (например, предстательная железа человека). Однако 1L -подтип не обнаруживали с помощью традиционных экспериментов связывания, проводившихся на гомогенизированных тканях. Тот факт, что 1L -подтип не определяли в гомогенизированной ткани, означает, что очень трудно выделить 1L -подтип из ткани. Если неизвестна природа 1L -подтипа, то будет очень трудно исследовать функцию 1L -адренэргического рецептора, в частности, для разработки 1L -селективных лекарственных средств (например, агонистов или антагонистов).

Авторы настоящего изобретения предположили, что 1L -подтип, сущность которого неизвестна, образуется при связывании некой вспомогательной молекулы с уже известным подтипом (возможно, 1A -подтипом). То есть, авторы предположили, что взаимодействие между молекулой рецептора определенного подтипа и ее вспомогательной молекулой, которые совместно составляют 1L -подтип, разрушается при гомогенизации ткани, и в результате 1L -подтип меняет свои свойства на свойства 1A -подтипа. В результате, было обнаружено, что при гомогенизации ткани фармакологический профиль 1L -подтипа превратился в профиль 1A -подтипа. Более того, в результате кропотливых исследований авторы настоящего изобретения подтвердили, что определенный белок связывается с 1A -подтипом, и совместная экспрессия указанного белка с 1A -подтипом в культуре клеток приводит к экспрессии фенотипа 1L -подтипа. То есть, было обнаружено, что 1L -подтип состоит из белкового комплекса, был определен белок, входящий в состав данного комплекса, и таким образом осуществлено настоящее изобретение.

В одном варианте реализации настоящее изобретение обеспечивает комплекс, который образует 1L -подтип адренэргического рецептора. То есть, белковый комплекс согласно данному варианту реализации настоящего изобретения представляет собой 1L -подтип адренэргического рецептора. Данный вариант реализации изобретения позволяет обеспечить лечение любого заболевания, связанного с 1L -подтипом, сущность которого была определена.

Полипептид, составляющий белковый комплекс согласно настоящему изобретению, известен как CRELD (обогащенный цистеином с EGF-подобными доменами) 1а белок, миссенс мутация которого считается связанной с дефектом атриовентрикулярной перегородки (Gene 293: 47-57 (2002), Am. J. Hum. Genet. 72: 1047-1052 (2003)). Информация о последовательности полипептида может быть получена по номеру доступа NCBI: NM_015513 и в настоящем описании, представлена через SEQ ID NO:1 (последовательность аминокислот) и SEQ ID NO:2 (последовательность нуклеотидов). То есть, полипептид, составляющий белковый комплекс согласно одному из вариантов реализации настоящего изобретения, может представлять собой полипептид, который имеет последовательность аминокислот SEQ ID NO:1, или может являться полипептидом, кодируемым полинуклеотидом, который имеет последовательность нуклеотидов SEQ ID NO:2.

Полипептид, который входит в состав белкового комплекса согласно данному варианту реализации настоящего изобретения не ограничивается полипептидом, который имеет последовательность аминокислот SEQ ID NO:1, и может представлять собой мутантный полипептид, сохраняющий активность исходного полипептида. Примером такого мутантного полипептида является полипептид, который: (i) имеет последовательность аминокислот SEQ ID NO:1 с делецией, вставкой, добавлением одной или нескольких аминокислот, и (ii) обладает способностью образовывать комплекс с GPCR и изменять сродство указанного GPCR к лиганду.

С помощью общих методических принципов, известных в данной области, специалист может легко получить мутантный полипептид, из аминокислотной последовательности конкретного полипептида посредстовм делеции, вставки, замены или добавления одной или нескольких аминокислот. Кроме того, на основе информации, содержащейся в настоящем описании изобретения и общих методических принципов, специалист в данной области может легко определить, сохраняет ли мутантный полипептид ту же активность, что и первоначальный полипептид.

Кроме того, полинуклеотид, кодирующий полипептид, входящий в состав белкового комплекса согласно настоящему изобретению, не ограничивается полинуклеотидом, который имеет последовательность нуклеотидов SEQ ID NO:2, и также может представлять собой мутантный полинуклеотид, кодирующий полипептид, сохраняющий способность изменять сродство к лиганду GPCR, с которым указанный полипептид образовал комплекс. Примером такого мутантного полинуклеотида является, но не ограничен им: (1) полинуклеотид, который имеет последовательность нуклеотидов SEQ ID NO:2 с делецией, вставкой, заменой или добавлением одного или нескольких нуклеотидов, (2) полинуклеотид, который способен гибридизоваться в жестких условиях гибридизации с полинуклеотидом, который имеет последовательность, комплементарную последовательности нуклеотидов SEQ ID NO:2, или (3) полинуклеотид, последовательность которого на 70% или более, предпочтительно 80% или более, или более предпочтительно 85% или более, гомологична полинуклеотиду, который имеет последовательность нуклеотидов SEQ ID NO:2.

С помощью общих методических подходов, известных в данной области, специалист может легко получить: мутантный полипептид из аминокислотной последовательности конкретного полинуклеотида посредством делеции, вставки, замены или добавления одной или нескольких аминокислот; мутантный полинуклеотид, способный при жестких условиях гибридизации гибридизоваться с определенным полинуклеотидом; или мутантный полинуклеотид, последовательность которого на 70% или более идентична последовательности определенного полинуклеотида. Далее, на основе описания настоящего изобретения и общих методических принципов специалист в данной области может легко определить, сохраняет ли полипептид, кодируемый указанным мутантным полинуклеотидом, ту же активность, что и полипептид, кодируемый исходным полинуклеотидом.

Применительно к настоящему описанию, термин «жесткие условия гибридизации» означает инкубацию в течение ночи при 42°С в растворе для гибридизиации (содержащем 50% формамид, 5 х SSC [150 мМ NaCl, 15 мМ тринатриевого цитрата], 50 мМ фосфат натрия (рН=7.6), 5 х раствор Денгардса, 10% декстран сульфат и 20 мкг/мл денатурированной спермы лосося), с последующей промывкой фильтра при 65°С в 0.1 х SSC.

Необходимо только провести процедуру специфичной гибридизации по способу, хорошо известному в данной области (например, по способу, описанному в "Molecular Cloning: A Laboratory Manual, 3rd ed., J. Sambrook and D.W.Russell ed., Cold Spring Harbor Laboratory, NY (2001)", который включен посредством ссылки на настоящее описание).

Настоящее изобретение описано выше с использованием адренэргических рецепторов в качестве примера GPCR, составляющих белковый комплекс согласно настоящему изобретению. Однако достаточно, чтобы белковый комплекс согласно настоящему изобретению представлял собой комплекс GPCR и (1) полипептида, который имеет последовательность аминокислот SEQ ID NO:1; (2) полипептида (i), который имеет последовательность аминокислот SEQ ID NO:1 с делецией, вставкой, заменой или добавлением одной или нескольких аминокислот, и (ii) способен изменять сродство к лиганду GPCR, с которым указанный полипептид образовал комплекс; (3) полипептида, кодируемого полинуклеотидом, который имеет последовательность нуклеотидов SEQ ID NO:2; (4) полипептида (i), кодируемого полинуклеотидом, который имеет последовательность нуклеотидов SEQ ID NO:2 с делецией, вставкой, заменой или добавлением одной или нескольких нуклеотидов, и (ii) способен изменять сродство к лиганду GPCR, с которым указанный полипептид образовал комплекс; (5) полипептида (i), кодируемого полинуклеотидом, который способен в жестких условиях гибридизации гибридизоваться с полинуклеотидом, который имеет последовательность, комплементарную последовательности нуклеотидов SEQ ID NO:2 и (ii) способен изменять сродство к лиганду GPCR, с которым указанный полипептид образовал комплекс; или (6) полипептида (i), кодируемого полинуклеотидом, последовательность которого на 70% или более идентична последовательности полинуклеотида, который имеет последовательность нуклеотидов SEQ ID NO:2, и (ii) способен изменять сродство к лиганду GPCR, с которым указанный полипептид образовал комплекс. То есть, GPCR, входящий в состав указанного белкового комплекса, не ограничен адренергическим рецептором, но также может представлять собой допаминовый рецептор, мускариновый рецептор или эндотелиновый рецептор. Кроме того, специалист в данной области может легко получить, из общедоступных баз данных, информацию о последовательности GPCR, к которому относится настоящее изобретение, и поэтому может легко получить желаемый белковый комплекс, на основе информации из описания настоящего изобретения и известных общих методических принципов.

2. Липидная мембрана, содержащая белковый комплекс.

Настоящее изобретение также обеспечивает способ получения белкового комплекса GPCR и определенного полипептида. Способ получения белкового комплекса GPCR и определенного полипептида согласно настоящему изобретению характеризуется стадией осуществления совместного присутствия GPCR и определенного белка на липидной мембране. Таким образом, настоящее изобретение обеспечивает липидную мембрану, содержащую белковый комплекс, и способ ее получения.

Липидная мембрана согласно настоящему изобретению характеризуется содержанием белкового комплекса, описанного выше. Липидная мембрана согласно настоящему изобретению может представлять собой природную липидную мембрану или искусственной липидной мембраной. В тех случаях, когда мембрана представляет собой природную липидную мембрану, подразумевается, что мембрана является биологической мембраной. В тех случаях, когда мембрана представляет собой искусственную липидную мембрану, подразумевается, что мембрана представляет собой плоскую липидную мембрану или липосому.

В одном аспекте настоящего изобретения, липидная мембрана может представлять собой биологическую мембрану трансформанта, в который включен полинуклеотид, кодирующий полипептид, входящий в состав белкового комплекса согласно настоящему изобретению. Такой трансформант можно получить посредством введения в живой организм вектора экспрессии, содержащего полинуклеотид, таким образом, что полипептид экспрессируется в виде биологической мембраны. Следует отметить, что живой организм, который используют в качестве трансформанта, может представлять собой прокариотный или эукариотный организм.

В другом аспекте настоящего изобретения, липидная мембрана может представлять собой липидный бислой, содержащий полипептид, который входит в состав белкового комплекса согласно настоящему изобретению. Липидный бислой представляет собой мембранную структуру, состоящую из двух слоев полярных липидов (в частности, фосфолипидов). Структура липидного бислоя стабилизирована в виде двумерной структуры, если она принимает вид сферы, но она может являться плоской структурой, если ее концы изолированы от молекул воды. При использовании в настоящем описании термином «липосома» обозначается сферический липидный бислой, созданный искусственно, и термин «липидная плоская мембрана» означает плоский липидный бислой, созданный искусственно. В данной области искусственный липидный бислой используют при измерениях активности мембранных белков in vitro (например, белков каналов). Т.о., специалист в данной области может легко получить липидную плоскую мембрану и сделать так, чтобы указанная плоская липидная мембрана удерживала интересующий белок (полипептид). Дополнительно, липосома представляет собой искусственную липидную мембрану, которую также обозначают термином «везикула», и ее можно получить посредством взбивания суспензии липидов (например, фосфолипидов) и последующей обработки их ультразвуком. В этой области, широко известны работы с липосомами в качестве моделей клеточных мембран и способов доставки лекарств (DDS). Таким образом, специалист в данной области может легко получить липосому и заставить липосому удерживать интересующий белок (полипептид).

В одном варианте реализации, настоящее изобретение обеспечивает липидную мембрану, содержащую 1L -подтип адренэргического рецептора. Как описано выше, 1L -подтип адренэргического рецептора представляет собой белковый комплекс молекулы 1A -подтипа и белка CRELD1 . Как 1A -подтип адренэргического рецептора, так и CRELD1 оба являются мембранно связанными белками и, как описано выше, их взаимодействие друг с другом нарушается при гомогенизации (разрушении мембраны). То есть, их взаимодействие друг с другом выражается в размещении и сохранении их обоих на липидной мембране.

В тех случаях, когда липидная мембрана согласно данному варианту реализации настоящего изобретения является биологической мембраной, способ получения липидной мембраны согласно такому варианту реализации может также представлять собой способ получения трансформанта, экспрессирющего 1L -подтип адренэргического рецептора, и который необходимо только дополнить стадией совместной экспрессии белка 1A -адренэргического рецептора и белка CRELD1 . Информация о последовательности 1A -подтипа адренэргического рецептора доступна через номер доступа NCBI - No. U03866 или NM_000680 и, в настоящем описании, представлена как SEQ ID NO:3 (последовательность аминокислот) и SEQ ID NO; 4 (последовательность нуклеотидов). То есть, необходимо только, чтобы способ получения белкового комплекса согласно настоящему варианту реализации включал стадию трансформации хозяина вектором, содержащим полинуклеотид, который имеет последовательность нуклеотидов SEQ ID NO:2, и вектором, содержащим полинуклеотид, состоящий из последовательности нуклеотидов SEQ ID NO:4.

Предпочтительно, чтобы каждый из указанных векторов представлял собой вектор экспрессии, включающий представляющий интерес полинуклеотид, функционально связанный с ним. В настоящем описании термин "функционально связанный" означает, что полинуклеотид, кодирующий представляющий интерес пептид (или белок), находится под контролем контрольного участка, например промотора, и находится в такой форме, что пептид (или белок) может экспрессироваться в клетке - хозяине. Способ получения желаемого вектора с помощью «функционального связывания» полинуклеотида, кодирующего представляющий интерес пептид, с вектором экспрессии хорошо известен в данной области техники. Кроме того, способ введения вектора экспрессии в клетку-хозяина также хорошо известен в данной области. Поэтому специалист в данной области может с легкостью создать желаемый пептид в хозяине.

При использовании в настоящем описании термин «трансформант» означает не только клетку, ткань или орган, но также и отдельный живой организм. К примерам живых организмов, служащих объектами трансформации, относятся, но не ограничены ими, различные микроорганизмы, растения и животные. Следует отметить, что необходимо только ввести в трансформант по крайней мере полинуклеотид, кодирующий полипептид, образующий белковый комплекс согласно настоящему изобретению и нужно, чтобы указанный трансформант экспрессировал такие полипептиды. То есть, следует отметить, что трансформант, полученный с применением других средств, отличных от вектора экспрессии, также входит в область охвата настоящего изобретения. Дополнительно, несмотря на то, что предпочтительно, чтобы в трансформанте согласно настоящему изобретению стабильно экспрессировался полипептид, образующий белковый комплекс согласно настоящему изобретению, представляющий интерес полипептид может экспрессироваться временно. Следует отметить, что использование трансформанта совместно с белковым комплексом согласно данному варианту реализации изобретения позволяет провести скрининг агонистов или антагонистов указанного комплекса, изучая поведение вторичного посредника в клетке хозяина.

В тех случаях, когда липидная мембрана согласно данному варианту реализации настоящего изобретения является искусственной мембраной, способ получения липидной мембраны согласно такому варианту реализации также может представлять собой способ получения планарной липидной мембраны или липосомы, содержащей 1L -подтип адренэргического рецептора и, в частности, необходимо только, чтобы он включал стадию распределения белка 1A -адренэргического рецептора и белка CRELD1 на искусственной плоской мембране. С помощью общих принципов в данной области специалист в данной области может с легкостью перераспределить мембранный белок на искусственной липидной мембране. Применение искусственной липидной мембраны, существующей совместно с белковым комплексом согласно настоящему варианту реализации, позволяет измерить сродство комплекса к лиганду.

3. Применение липидной мембраны.

Специалисту в данной области будет очевидно, что приведенный выше способ получения липидной мембраны может представлять собой как способ получения белкового комплекса, так и способ изменения сродства к лиганду GPCR. Таким образом, настоящее изобретение обеспечивает способ изменения сродства GPCR к его лигандам.

Дополнительно, применение липидной мембраны согласно настоящему изобретению позволяет провести скрининг агониста или антагониста GPCR с измененным сродством к лиганду. То есть, настоящее изобретение обеспечивает способ скрининга агониста или антагониста GPCR с измененным сродством к лиганду.

Способ скрининга согласно настоящему изобретению характеризуется присутствием стадии получения белкового комплекса, описанного выше, на липидной мембране; и инкубации белкового комплекса вместе с исследуемым фактором. В настоящем описании термин «инкубация» означает осуществление совместного нахождения множества веществ и приведение их в такое состояние, что они могут в достаточной степени контактировать друг с другом.

В предпочтительном варианте реализации, способ скрининга согласно настоящему изобретению включает стадию инкубации совместно с исследуемым фактором-кандидатом, трансформанта, содержащего интересующий GPCR (например, клетки, в которой экспрессируется 1L -подтип адренэргического рецептора). Способ скрининга согласно указанному варианту реализации настоящего изобретения позволяет провести скрининг агонистов или антагонистов, представляющих интерес GPCR (например, адренэргического рецептора 1L -подтипа) с помощью измерения изменений вторичного посредника в клетке (например, количества цАМФ в тех случаях, когда G - белок представляет собой Gs или Gi белок, или концентрации инозинтрифосфата и Ca 2+ в тех случаях, когда G -белок является Gq - белком).

Агонисты адренэргического рецептора 1L -подтипа можно использовать в качестве лекарственного средства против недержания мочи, в качестве мидриатического средства, лекарства от глаукомы и для стимуляции центральной нервной системы. Антагонисты адренэргического рецептора 1L -подтипа можно использовать в качестве лекарственного средства против расстройств мочеполовой системы, против болезни Рейно, против нарушения микроциркуляции, в качестве гипотензивного средства, депрессанта центральной нервной системы, средства для улучшения почечного кровотока, диуретического лекарственного средства. Далее, поскольку известно, что 1L -подтип адренэргического рецептора связан с болезнями сердца, и известно, что допаминовый D2 рецептор и мускариновый рецептор связаны с болезнями центральной нервной системы, агонисты или антагонисты этих рецепторов также могут быть полезны.

4. Клетки с «нокдауном» и их применение.

Настоящее изобретение также обеспечивает трансформант, в котором экспрессия полипептида, который образует белковый комплекс с GPCR, была нарушена (нокдаун), и способ его получения. Способ получения трансформанта согласно настоящему изобретению характеризуется присутствием стадии ингибирования экспрессии эндогенного полипептида.

Например, белок CRELD1 , который является полипептидом, который образует комплекс с GPCR, экспрессируется в различных клетках. Поэтому, трансформант, в котором подавлена экспрессия эндогенного белка CRELD1 , является очень полезным в качестве контроля клеток, который используют для анализа функции белкового комплекса или скрининга целевого соединения (например, агониста или антагониста). Клетку с нокдауном, описанную в этом разделе, можно использовать отдельно, но предпочтительно использовать ее в сочетании с описанным выше белковым комплексом или описанной выше липидной мембраной, содержащей комплекс. Следует отметить, что GPCR, который экспрессируется в целевой клетке, может быть эндогенным или экзогенным.

В одном своем аспекте, настоящее изобретение может включать стадию подавления экспрессии эндогенного белка CRELD1 в клетке, в которой экспрессировался GPCR. Это позволяет изменить сродство к лиганду GPCR, который экспрессируется в клетке. Таким образом, способ получения трансформанта согласно настоящему изобретению может представлять собой способ получения трансформанта, экспрессирующего GPCR с измененным сродством к лиганду и способ изменения сродства GPCR к его лиганду. В одном варианте реализации, настоящее изобретение может включать стадию подавления экспрессии эндогенного белка CRELD1 в клетке, в которой экспрессируется 1L -подтип адренэргического рецептора. Это позволяет превратить клетку, проявляющую фенотип 1L -подтипа, в клетку, проявляющую фенотип 1A -подтипа. Предпочтительно, в качестве способа подавления экспрессии эндогенного белка CRELD1 используют способ РНК-интерференции. Способ РНК-интерференции представляет собой хорошо известный в данной области способ, например, экспрессию эндогенного белка CRELD1 можно успешно ингибировать посредством введения в интересующую клетку олигонуклеотида, состоящего из последовательности нуклеотидов SEQ ID NO:5. В том случае, когда для введения в интересующую клетку олигонуклеотида, состоящего из последовательности нуклеотидов SEQ ID NO:5, применяют вектор предпочтительно, чтобы в качестве антисмысловой последовательности использовали олигонуклеотид, который имеет последовательность нуклеотидов SEQ ID NO:6 без каких-либо ограничений.

Дополнительно, настоящее изобретение обеспечивает способ, который характеризуется использованием описанного выше трансформанта, для скрининга агониста или антагониста GPCR с измененным сродством к лиганду.

Настоящее изобретение не ограничивается описанием приведенных вариантов реализации, но может быть изменено специалистом в данной области в пределах формулы изобретения. Вариант реализации, основанный на правильном сочетании технических средств, раскрытых вариантов реализации включен в область охвата настоящего изобретения.

Вся академическая и патентная литература, размещенная здесь, включена посредством ссылки на настоящее описание.

Примеры

1. Структуры.

Ген 1А -адренэргического рецептора человека (ADRA1A) клонировали из библиотеки простаты человека с помощью метода ПЦР. Клонированный ген имеет общую длину 1465 п.н. и последовательность открытой рамки считывания (ОРС), которая идеально соответствует последовательности открытой рамки считывания гена 1А человека (NCBI номер доступа U03866 или NM_000680), о чем сообщали ранее. Дополнительно, последовательности, находящиеся до и после последовательности ОРС, совпадали с последовательностями, о которых сообщали Hirasawa et al. (1993).

Ген CRELD1 клонировали из библиотеки кДНК простаты человека. В результате определения последовательности клонированный ген совпадал с последовательностью, о который сообщали Rupp et al. (2002) (NCBI номер доступа NM_015513).

Затем кодирующий район гена ADRA1A субклонировали по сайту рестрикции EcoRI мультиклонального сайта A pIRES (Clonetech, каталожный номер РТ3266-5). Дополнительно, кодирующий участок CRELD1 субклонировали по сайту рестрикции Xbal мультиклонального сайта В pIRES. В целях субклонирования, к каждому концу каждого гена добавляли адаптер фермента рестрикции.

2. Получение трансформанта.

Вектор амплифицировали/очистили традиционным способом и затем провели трансфекцию клеток СНО-К1, которые представляют собой клетки яичника китайского хомячка, с помощью Lipofectamine 2000 (Invitrogen Corporation) согласно протоколу изготовителя. Через 2 дня после трансфекции, в питательную среду DMEM добавили 1200 мкг/мл антибиотика Генетицина (G418). Клетки, которые не трансфицировали вектором, т.е. клетки, которые обработали так же Lipofectamine 2000 и т.п., и вектор не добавляли, погибали при концентрации G418 1000 мкг/мл. С418-устойчивые клетки разбавляли, суспендировали и распределяли по 96-луночному планшету так, что в среднем на лунку приходилось 0.5 клетки и затем отбирали отдельные колонии. Эту операцию повторяли трижды, в результате чего получили стабильный клон клеток ( 1L клеток), в которых одновременно экспрессировался ген ADRA1A и ген CREDL1 . Далее, в качестве контрольной группы получили клетки, в которых стабильно экспрессировался только ген ADRA1A ( 1A клетки), и клетки, в которых стабильно экспрессировался только ген CREDL1 (CREDL1 клетки).

3. Опыт по связыванию.

Препаратами, использованными в экспериментах по связыванию, и их правильными химическими названиями являются: силодозин, празозин, тамсулозин, RS-17053 (N-[2-(2-циклопропилметоксифенокси) этил)-5-хлор- , -диметил-1Н-индол-3-этанамин гидрохлорид), BMY 7378 (8-[2-[4-(2-метоксифенил)-1-пиперазинил]этил]8-ааспиро[4,5]декан7,9-дион дигидрохлорид).

Стабильный клон изучали с помощью способа фармакологического связывания с [ 3 Н]-силодозином, который является радиолигандом. Эксперимент проводили с использованием способа связывания с целыми клетками. Иначе говоря, за 2-3 дня до эксперимента клетки рассеяли по поверхности для получения конфлюентности 50%, дважды отмыли ледяным PBS и затем соскребли скребком. Клетки, собранные таким образом, повторно суспендировали в растворе Krebs-HEPES и затем инкубировали при 4°С в течение 4 часов вместе с [ 3 H]-силодозином и другим лекарством по мере необходимости. После этого клетки фильтровали/отмывали на фильтре Whatmann GC/F, предварительно обработанном полиэтиленомимином и измеряли радиоактивность с помощью жидкого сцинтилляционного счетчика. Неспецифичное связывание оценивали как связывание в присутствии 30 мкМ фенотоламина.

[А] Эксперименты по связыванию и насыщению согласно цельноклеточному способу.

Исследовали связывание [ 3 H]-силодозина в различных концентрациях (30-1000 нМ) с клетками 1L (Фиг.1). На Фиг.1 изображена кривая насыщения-связывания, полученная с помощью способа анализа связывания с целыми клетками. Специфичное связывание [ 3 H]-силодозина с 1L клетками демонстрирует максимальное связанное количество (Bmax) 134 фмоль/мг белка и значение Kd 843 пМ

(pK D =9.1).

[Б] Эксперимент по конкурентному связыванию.

Известно, что силодозин селективно с высоким сродством связывается с подтипами 1A - и 1L . Термин "высокое сродство" здесь означает, что Kd равна или меньше 1 нМ. Для того чтобы определить фармакологические свойства рецепторов, экспрессируемых на клетках 1L , проводили эксперименты по конкурентному связыванию с празозином в концентрации 300 пМ по сайтам связывания [ 3 H]-силодозина с помощью способа анализа связывания с целыми клетками. В качестве контрольной клеточной линии использовали она клетки. Показано, что [ 3 H]-силодозин является селективным антагонистом для обоих подтипов 1A - и 1L .

Как показано на конкурентной кривой на Фиг.2(а), большинство (88% или выше) рецепторов 1L клеток демонстрируют низкую чувствительность к празозину (pK i =7.6). Дополнительно, аналогично рецепторы имеют низкую чувствительность к RS-17053 и обладают высокой чувствительностью к тамсулозину. Кроме того, рецепторы 1L клеток демонстрируют только низкую чувствительность к BMY 7378 (Таблица 2). С другой стороны, чувствительность (значения pK i ) 1A клеток, использованных в качестве контрольной группы, к празозину (Фиг.2), тамсулозину и RS-17053 достигает 9.5, 9.9 и 8.8, соответственно, что соответствует свойствам 1A , о которых сообщалось ранее (таблица 2).

[Таблица 2]

Фармакологические свойства 1L -адренергических рецепторов в двух клеточных линиях и предстательной железе человека

Лекарство

1L клетки

1A клетки

Предстательная железа человека

[ 3 H]-силодозин

9.1

9.7

9.5

(pK D )

Празозин

7.6

9.5

8.3

Тамсулозин

9.3

9.9

10.0

RS-17053

<6.0

8.8

6.6

BMY 7378

<6.0

6.5

5.9

В этой таблице константы ингибирования (K i ) конкурентных лекарственных средств по сайтам связывания [ 3 H]-силодозина на 1L клетках, 1L клетки, и фрагменты ткани простаты человека приведены в виде logK i (pK i ). Однако величина [ 3 H]-силодозина показывает величину pK D (константа равновесия диссоциации), рассчитанную из кривой связывания насыщения. Величина представляет собой среднее для трех-четырех примеров.

Далее, Фиг.2(b) иллюстрирует результаты, полученные при исследовании чувствительности к празозину в гомогенатах 1L клеток и гомогенатах 1A клеток. Гомогенаты 1L клеток демонстрируют такую же высокую чувствительность к празозину, что и 1A клетки. Это хорошо соотносится с тем, что 1L рецепторы в простате и мозге разрушаются при гомогенизации тканей, и с тем, что фармакологический профиль меняется на 1A фенотип.

Данные по сродству различных лекарственных средств к 1 -адренергическим рецепторам 1L и 1A клеток и простаты человека обобщены в таблице 2. 1L клетки, в которых одновременно экспрессируется ген ADRA1A и ген CRELD1 , отличаются по свойствам рецепторов от 1A рецепторов и по фармакологическим свойствам хорошо соотносятся с 1L рецепторами, о присутствии которых в простате человека и т.п. сообщали. Таким образом, считается, что в отличие от 1A клеток, 1L клетки являются клеточной линией, которая экспрессирует преимущественно 1L рецепторы.

4. Эксперимент по определению концентрации внутриклеточного Са 2+ .

Далее, для того чтобы полностью избавиться от влияния CRELD1 , которые могли эндогенно экспрессироваться в 1A клетках, применили способ РНК-интерференции для получения клеток, в которых экспрессия CRELD1 была полностью подавлена (такие клетки далее обозначают термином "KD клетки"). Для того чтобы подавить экспрессию гена с помощью способа РНК-интерференции, создали вектор посредством вставки олигонуклеотида (смысловая последовательность;

GATCCAGGCGACTTAGTGTTCACCTTCAAGAGAGGTGAACACTAAGTCG ССТТТА: SEQ ID NO:5, антисмысловая последовательность;

AGCTTAAAGGCGACTTAGTGTTCACCTCTCTTGAAGGTGAACACTAAGTC GCCTG: SEQ ID NO:6), содержавшего кодирующий участок мРНК CRELDIa китайского хомячка, в коммерчески доступный pSilencer 4.1-CMV hygro (Ambion, Inc.) согласно инструкциям изготовителя, и затем трансфицировали 1A клетки таким же способом, как описанный выше. Ответ Са 2+ на норадреналин в KD клетках изучали с помощью флуоресцентного фотометрического способа с использованием Рига-2, который является флуоресцентным красителем. Значение рЕС 50 Са 2+ ответа на норадреналин в KD клетках составило 7.9. С другой стороны, когда клетки заранее обрабатывали празозином 10 -8 М в течение 2 минут, дозозависимая кривая ответа Ca 2+ на норадреналин смещалась вправо, и значение pK D оказалось равно 9.3. Это показывает, что ответ Ca 2+ на норадреналин в KD клетках соответствует свойствам 1A -подтипа.

Таким образом, когда экспрессию эндогенного CRELD1 в СНО клетках, в которых экспрессировался ген 1A -подтипа, подавляли с помощью способа РНК-интерференции, идеально проявлялись свойства 1A рецептора. Следует отметить, что проводили некоторые эксперименты, в которых функции рецептора 1A -подтипа, например ответ Са 2+ , исследовали с использованием СНО клеток, в которых экспрессировался ген рецептора. Однако, не всегда было соответствие в свойствах рецептора, полученных в результате этих экспериментов.

Применение настоящего изобретения делает возможным определить GPCR, природа которых оставалась неизвестной, и таким образом, обеспечить лечение любого заболевания, связанного с данным рецептором, и также делает возможным изменить сродство GPCR к лиганду.

Варианты реализации и конкретные примеры выполнения настоящего изобретения, рассмотренные в предыдущем подробном объяснении, служат исключительно для иллюстрации технических подробностей настоящего изобретения, которое не должно быть узко истолковано в пределах таких вариантов реализации и конкретных примеров, но может быть применено в различных вариациях в пределах духа настоящего изобретения, при условии, что эти вариации не выходят за пределы формулы изобретения, приведенной ниже.

Промышленное применение

Известно, что 1L -AR является функциональным рецептором и главной мишенью для многих лекарственных средств системы нижних мочевыводящих путей. Поэтому, представленные клетки, экспрессирующие 1L -AR, созданные авторами настоящего изобретения, следует считать очень полезными для разработки лекарственных средств для лечения нарушения функций мочевых путей у пациентов с доброкачественной гиперплазией простаты и недержанием мочи. Дополнительно, клетки, экспрессирующие 1L -AR, следует считать очень полезными для применения в способе скрининга лекарственных средств для лечения любых заболеваний, связанных с 1L -AR.

Формула изобретения

1. Белковый комплекс, обладающий сродством GPCR 1L к лиганду, включающий GPCR 1A , и полипептид, причем указанный полипептид представляет собой:

(1) полипептид, имеющий последовательность аминокислот SEQ ID NO:1;

или

(2) полипептид, кодируемый полинуклеотидом, имеющим последовательность нуклеотидов SEQ ID NO:2.

2. Трансформированная клетка, экспрессирующая белковый комплекс по п.1, причем указанная клетка содержит:

(i) первый вектор, содержащий первый полинуклеотид, который кодирует GPCR 1A , и второй вектор, содержащий второй полинуклеотид, который кодирует пептид; или

(ii) третий вектор, включающий первый полинуклеотид, который кодирует GPCR 1A , и второй полинуклеотид, который кодирует пептид,

где указанный полипептид представляет собой:

(1) полипептид, имеющий последовательность аминокислот SEQ ID NO:1;

или

(2) полипептид, кодируемый полинуклеотидом, который имеет последовательность нуклеотидов SEQ ID NO:2.

3. Способ получения трансформированной клетки по п.2, включающий стадию совместной экспрессии GPCR 1A и полипептида в изолированной клетке, причем указанный полипептид представляет собой:

(1) полипептид, который имеет последовательность аминокислот SEQ ID NO:1; или

(2) полипептид, кодируемый полинуклеотидом, который имеет

последовательность нуклеотидов SEQ ID NO:2.

4. Способ изменения сродства GPCR 1A к лиганду, включающий стадию экспрессии полипептида в изолированной клетке, в которой экспрессируется GPCR 1A , причем указанный полипептид представляет собой:

(1) полипептид, который имеет последовательность аминокислот SEQ ID NO:1; или

(3) полипептид, кодируемый полинуклеотидом, который имеет

последовательность нуклеотидов SEQ ID NO:2.

5. Способ скрининга агониста или антагониста GPCR 1L , включающий стадии:

одновременной экспрессии в изолированной клетке GPCR 1A и полипептида с образованием GPCR 1L ; и

инкубации клетки, экспрессирующей GPCR 1L с исследуемым фактором, и дополнительно включающий стадии:

измерения внутриклеточной концентрации Са 2+ или метаболизма внутриклеточного инозитолфосфата в клетке, экспрессирующей GPCR 1L , перед стадией инкубации или после нее;

и

определения того, является исследуемый фактор агонистом или

антагонистом GPCR 1L , причем

исследуемый фактор признают агонистом GPCR 1L , если значение, полученное в результате измерения после стадии инкубации, выше значения, полученного в результате измерения до стадии инкубации, и исследуемый фактор признают антагонистом GPCR 1L , если значение, полученное в результате измерения после инкубации, не отличается от значения, полученного в результате измерения до стадии инкубации, причем измерение, осуществляемое после стадии инкубации, проводят в присутствии агониста GPCR 1L ,

где указанный полипептид представляет собой:

(1) полипептид, который имеет последовательность аминокислот SEQ ID NO:1; или

(2) полипептид, кодируемый полинуклеотидом, который имеет последовательность нуклеотидов SEQ ID NO:2.

6. Способ получения трансформированной клетки, экспрессирующей GPCR 1A , включающий стадию подавления экспрессии полипептида в изолированной клетке, в которой экспрессируется GPCR 1L ,

причем указанный полипептид представляет собой:

(1) полипептид, который имеет последовательность аминокислот SEQ ID NO:1; или

(2) полипептид, кодируемый полинуклеотидом, который имеет последовательность нуклеотидов SEQ ID NO:2.

7. Способ по п.6, отличающийся тем, что указанный полипептид представляет собой эндогенный белок.

8. Способ по п.6, отличающийся тем, что стадию подавления экспрессии полипептида осуществляют способом РНК-интерференции.

9. Способ по п.7, отличающийся тем, что способ РНК-интерференции осуществляют посредством вставки олигонуклеотида, который имеет последовательность нуклеотидов SEQ ID NO:5.

10. Способ по п.6, отличающийся тем, что указанная изолированная клетка представляет собой трансформированную клетку, экспрессирующую экзогенный GPCR 1L .

11. Способ изменения сродства GPCR 1L к лиганду, включающий стадию подавления экспрессии полипептида в изолированной клетке, в которой экспрессируется GPCR 1L ,

причем указанный полипептид представляет собой:

(1) полипептид, который имеет последовательность аминокислот SEQ ID NO:1; или

(2) полипептид, кодируемый полинуклеотидом, который имеет последовательность нуклеотидов SEQ ID NO:2.

12. Способ скрининга агониста или антагониста GPCR 1A , включающий стадии:

подавления экспрессии полипептида в изолированной клетке, в которой экспрессируется GPCR 1L с образованием GPCR 1A ; и

инкубации указанной клетки, экспрессирующей GPCR 1A ,

совместно с исследуемым фактором,

и дополнительно включающий стадии:

измерения внутриклеточных концентраций Cа 2+ или

метаболизма внутриклеточного инозитолфосфата в клетке, экспрессирующей GPCR 1A , перед стадией инкубации и после нее; и

определения того, является исследуемый фактор агонистом или антагонистом GPCR 1A , причем

исследуемый фактор признают агонистом GPCR 1A , если значение, полученное в результате измерения после стадии инкубации, выше значения, полученного в результате измерения до инкубации, и

исследуемый фактор признают антагонистом GPCR 1L , если значение, полученное в результате измерения после инкубации, не отличается от значения, полученного в результате измерения до инкубации, при условии, что измерение, осуществляемое после стадии инкубации, проводят в присутствии агониста GPCR 1A ,

причем указанный полипептид представляет собой:

(1) полипептид, который имеет последовательность аминокислот SEQ ID NO:1; или

(2) полипептид, кодируемый полинуклеотидом, который имеет последовательность нуклеотидов SEQ ID NO:2.

РИСУНКИ